Original Article

Mutation of the Androgen-Receptor Gene in Metastatic Androgen-Independent Prostate Cancer

Mary-Ellen Taplin, M.D., Glenn J. Bubley, M.D., Todd D. Shuster, M.D., Martha E. Frantz, Amy E. Spooner, George K. Ogata, Harold N. Keer, M.D., Ph.D., and Steven P. Balk, M.D.

N Engl J Med 1995; 332:1393-1398May 25, 1995

Abstract

Background

Metastatic prostate cancer is a leading cause of cancer-related death in men. The rate of response to androgen ablation is high, but most patients relapse as a result of the outgrowth of androgen-independent tumor cells. The androgen receptor, which binds testosterone and stimulates the transcription of androgen-responsive genes, regulates the growth of prostate cells. We analyzed the androgen-receptor genes from samples of metastatic androgen-independent prostate cancers to determine whether mutations in the gene have a role in androgen independence.

Full Text of Background...

Methods

Complementary DNA was synthesized from metastatic prostate cancers in 10 patients with androgen-independent prostate cancer, and the expression of the androgen-receptor gene was estimated by amplification with the polymerase chain reaction. Exons B through H of the gene were cloned, and mutations were identified by DNA sequencing. The functional effects of the mutations were assessed in cells transfected with mutant genes.

Full Text of Methods...

Results

All androgen-independent tumors expressed high levels of androgen-receptor gene transcripts, relative to the levels expressed by an androgen-independent prostate-cancer cell line (LnCap). Point mutations in the androgen-receptor gene were identified in metastatic cells from 5 of the 10 patients examined. One mutation was in the same codon as the mutation found previously in the androgen-independent prostate-cancer cell line. The mutations were not detected in the primary tumors from two of the patients. Functional studies of two of the mutant androgen receptors demonstrated that they could be activated by progesterone and estrogen.

Full Text of Results...

Conclusions

Most metastatic androgen-independent prostate cancers express high levels of androgen-receptor gene transcripts. Mutations in androgen-receptor genes are not uncommon and may provide a selective growth advantage after androgen ablation.

Full Text of Discussion...

Read the Full Article...

Media in This Article

Figure 3Functional Analysis of Androgen-Receptor Mutations.

Figure 2Results of Semiquantitative Reverse-Transcriptase PCR Amplification of the Androgen Receptor.

Article Activity

295 articles have cited this article

Article

Prostate cancer is the most commonly diagnosed malignant condition and the second leading cause of cancer-related death in American men.1 In its early stage the disease is sometimes curable by radical prostatectomy or radiation therapy. However, metastases are common at presentation and they ultimately afflict many patients who were treated with curative intent when they had early-stage disease. The only effective treatment for metastatic prostate cancer is reduction of testosterone and 5α-dihydrotestosterone concentrations (androgen ablation), by either orchiectomy or the administration of an agonist of luteinizing hormone–releasing hormone (LHRH). The rate of response to androgen ablation can be as high as 80 percent, but the duration of response is only 12 to 18 months.2 The effect of androgen ablation may be augmented by flutamide, an androgen antagonist that acts on the androgen receptor to block the effects of androgens derived from the adrenal gland.3

The mechanisms by which tumor cells escape androgen ablation and become independent of the need for androgen are not understood. Salvage therapy with cytotoxic chemotherapy has generally not been effective in patients with androgen-independent prostate cancer.4 Secondary hormonal treatments with estrogens, progesterones, or glucocorticoids can induce short-term partial responses in a minority of patients.4 Interestingly, a rate of improvement of 30 to 40 percent after flutamide withdrawal has been reported in patients with androgen-independent prostate cancer who received both flutamide and testicular androgen ablation.5

Androgens are required for the development of both the normal prostate and prostate cancer.6 Androgens act through the androgen receptor, which belongs to the steroid-receptor superfamily of ligand-dependent transcription factors.7,8 This superfamily includes receptors for thyroid hormone, retinoic acid, estrogen, progesterone, glucocorticoids, and other steroid hormones. The structure of the androgen receptor is prototypical, with an N-terminal transactivating domain (exon A) and a C-terminal hormone-binding domain (exons D through H) (Figure 1Figure 1Structure of the androgen receptor and Primers Used for PCR Amplification.). Between these areas lies the DNA-binding domain (exons B and C), with its two zinc fingers that bind to specific DNA sequences, termed androgen-responsive elements. Once bound to androgen, the androgen receptor regulates the expression of androgen-responsive genes by binding to their androgen-responsive elements and by interacting with other transcription factors. A notable gene regulated by androgen in prostate cells encodes the prostate-specific antigen.9

Androgen ablation causes dramatic regression of prostate cancer and normal prostate tissue in most patients and in animal models of prostate cancer.10 At the cellular level, androgen ablation induces programmed cell death, or apoptosis,11 which appears to be mediated directly or indirectly by unligated androgen receptors. It seems, therefore, that androgen-independent prostate-cancer cells can escape the apoptosis induced by androgen ablation. A mechanism for this escape could be by mutations in the androgen-receptor gene that allow the receptors to stimulate the growth of prostate cells in the absence of androgen. Mutations in the androgen-receptor gene have been shown to cause the androgen-insensitivity syndrome12-14 and the spinal and bulbar muscular atrophy syndrome,15 but they have been detected only rarely in prostate cancer. In a large number of primary prostate cancers analyzed by several groups, only a single mutant androgen-receptor gene was identified.16-20

The androgen-receptor genes of metastatic androgen-independent prostate cancers have not been examined extensively, owing partly to difficulty in obtaining the appropriate tissue. Nevertheless, recent reports suggest that mutations in the androgen-receptor gene can occur in androgen-independent prostate cancer.18,19,21 In this report we show that in 5 of 10 patients with metastatic androgen-independent prostate cancer, the androgen-receptor genes had point mutations, all in the hormone-binding domain. One mutation was in the same codon as the previously described mutation in the prostate-cancer cell line (LNCaP).22 Functional studies showed that two of the mutant androgen receptors could be activated by progesterone and estrogen. These results suggest that mutant androgen-receptor genes are a selective advantage in metastatic androgen-independent prostate cancer, perhaps because they remain active after androgen ablation.

Methods

Tissue Procurement and Synthesis of Complementary DNA

Prostate-tumor tissue was obtained from patients with metastatic prostate cancer in relapse after androgen ablation by either orchiectomy or the administration of an LHRH agonist. When possible, bone marrow biopsies of posterior iliac-crest metastases were done at sites that correlated with abnormalities identified on bone scans. Other bone marrow samples were obtained at sites of pathologic fractures or from other metastatic sites. All samples were snap-frozen in liquid nitrogen and stored at -80°C until analysis. RNA was extracted from 4 to 10 frozen sections measuring 10 μm, and complementary DNA (cDNA) was synthesized according to standard methods, as described previously.23 Additional frozen sections were analyzed microscopically to confirm the presence of prostate cancer in the samples.

Quantitation of cDNA and Expression of Androgen Receptors

To estimate the amount of cDNA in each sample, amplifications with the polymerase chain reaction (PCR) were carried out with primers for the ubiquitously expressed protein beta₂-microglobulin.24 Serial dilutions of cDNA were amplified by PCR with a beta₂-microglobulin sense primer spanning exons 1 and 2 (atccagcgtactccaaagattcag) and an antisense primer in exon 4 (aaattgaaagttaacttatgcacgc). Each 20-μl reaction mixture contained cDNA, 50 ng of each primer, 100 μg of bovine serum albumin per milliliter, 0.2 mM deoxynucleoside triphosphates, 1.5 mM magnesium chloride, 50 mM potassium chloride, 10 mM TRIS (pH 9.0 at 25°C), and 1 U of Taq DNA polymerase. PCR amplifications were done for 25 to 30 cycles at 94°C for 20 seconds, 55°C for 30 seconds, and 72°C for 60 seconds, followed by a 7-minute extension at 72°C. The PCR products were separated on agarose gels, underwent Southern blotting with a beta₂-microglobulin probe (cacgtcatccagcaga, the sense primer in exon 2), and were quantitated with a phosphorimager (Molecular Dynamics, Sunnyvale, Calif.).

Approximately equal amounts of cDNA, on the basis of the expression of beta₂-microglobulin, were then amplified by PCR with androgen-receptor primers 3 and 5, located in exons A and C, respectively (Figure 1), and primers for beta₂-microglobulin. The PCR reactions were carried out for 24 cycles exactly as described above, except for the inclusion of 50 ng of each androgen-receptor primer. This number of cycles was determined in preliminary experiments to precede the plateau phase of the reaction. The products were analyzed on agarose gels and then hybridized with internal oligonucleotide probes specific for beta₂-microglobulin (see above) and androgen receptor (primer 4).

PCR Amplification, Cloning, and Sequencing of the Androgen Receptor

The androgen-receptor gene was amplified by PCR with primers 1 and 7, located at the 3' end of exon A and in the 3' untranslated region, respectively (Figure 1). A seminested PCR was then carried out with an internal primer in exon A (primer 2). The PCR products were then digested with KpnI and PstI (which cut the sample just 3' of primer 2 in exon A and 5' of primer 7 in exon H) and cloned into the PstI and KpnI sites of pBluescript. Bacterial colonies containing the androgen receptor were identified by hybridization, and multiple isolates from each patient were selected. Plasmids were purified and subjected to double-stranded sequencing with Sequenase and a series of internal sequencing primers, as described by the manufacturer (United States Biochemicals, Cleveland). Between 10 and 14 plasmids from each patient were sequenced. Additional sequencing of plasmids and direct sequencing of PCR products were carried out on a DNA sequencer (model 373A, Applied Biosystems, Foster City, Calif.) with Taq DNA polymerase and fluorescent dideoxynucleotides (Applied Biosystems). Base changes were determined to be mutations, rather than Taq polymerase errors, on the basis of their identification in multiple plasmids and their isolation after a second independent PCR amplification and analysis.

Functional Analysis of Mutant Androgen Receptors

Mutations in the androgen-receptor genes were cloned into the androgen-receptor expression vector pSV.AR_o (kindly provided by Dr. Albert Brinkmann, Erasmus University, Rotterdam, the Netherlands).25 The reporter plasmid MMTVpA3LUC was derived from pHHLUC26 and contained the luciferase gene under the control of an androgen-responsive element in the mouse-mammary-tumor-virus long terminal repeat (kindly provided by Dr. Richard Pestell, Northwestern University Medical School, Chicago). All experiments also included a pSV-β-galactosidase plasmid to control for the efficiency of transfection (Promega, Madison, Wis.). Transient transfections into CV-1 cells were carried out in triplicate with calcium phosphate (Mammalian Cell Transfection Kit, Specialty Media, Lavallette, N.J.) as described by the manufacturer. Approximately 12 hours after the transfections were initiated, the cells were washed and placed in medium containing steroid hormone–free fetal-calf serum for 4 hours. Hormones were then added, and the cells were incubated for another 24 hours. The cells were then lysed, and luciferase and β-galactosidase activity were measured.

Results

Expression of Androgen Receptors in Bone Marrow Metastases from Patients with Androgen-Independent Prostate Cancer

Patients with advanced androgen-independent prostate cancer generally have widespread metastatic disease in the bone marrow. Previous studies showed that the level of expression of androgen receptors by normal lymphoid and myeloid cells was quite low or absent.27 We therefore used a semiquantitative reverse-transcriptase PCR method to measure androgen-receptor transcripts in bone marrow in the presence or absence of prostate cancer.

Figure 2Figure 2Results of Semiquantitative Reverse-Transcriptase PCR Amplification of the Androgen Receptor. shows that bone marrow samples from four patients with androgen-independent prostate cancer who were treated by androgen ablation had readily detectable levels of androgen-receptor gene transcripts (lanes 1, 3, 4, and 5). The levels in these marrow samples were similar to the level expressed by LNCaP (lane 7). In contrast, expression of the androgen-receptor gene was not detectable in samples from patients who were in complete remission after androgen ablation (Figure 2, lane 2, and data not shown). Since none of these samples contained pure populations of tumor cells (Figure 2), the average level of androgen-receptor transcripts in the tumor cells was high relative to that in LNCaP. Figure 2 also shows the level of androgen-receptor gene transcripts in a biopsy specimen obtained during a channel transurethral prostatectomy in a patient with androgen-independent prostate cancer (lane 6). This sample contained a large proportion of tumor cells and showed a correspondingly high level of androgen-receptor gene transcripts.

These results confirmed that metastatic androgen-independent prostate cancers contain high levels of androgen-receptor gene transcripts, whereas cells in normal bone marrow have relatively little. On the basis of these observations, we proceeded to analyze the androgen-receptor genes expressed in bone marrow and other metastatic sites in 10 patients with androgen-independent prostate cancer.

Identification of Androgen-Receptor Mutations

Tumor cells from 10 patients with metastatic androgen-independent prostate cancer (Table 1Table 1Clinical Characteristics of 10 Patients with Prostate Cancer.) were obtained from bone marrow (Patients 1, 2, 3, 4, 6, 8, 9, and 10), pleural fluid (Patient 5), or a skin nodule (Patient 7). The DNA-binding and hormone-binding domains of the androgen-receptor gene were amplified by PCR and cloned. Multiple isolates (10 to 14 from each patient) were sequenced. Androgen-receptor gene mutations were identified in 5 of the 10 patients (Table 2Table 2Mutations in the Androgen-Receptor Gene Identified in Five Patients with Androgen-Independent Prostate Cancer.). Each of these mutations was confirmed by independent PCR amplifications.

Four of the bone marrow samples (Patients 1, 2, 3, and 4) contained androgen-receptor genes with single point mutations in the hormone-binding domain. The mutation in Patient 1 was in the same codon as the mutation reported previously in LNCaP, but resulted in a different amino acid change (threonine to serine, rather than threonine to alanine).22 Both mutant and wild-type androgen-receptor genes were identified in Patients 1, 3, and 4. The wild-type genes could have been derived from normal cells in the biopsy specimens or from tumor cells with wild-type androgen-receptor genes. In contrast, every androgen-receptor gene isolated from Patient 2 had a mutation in codon 874, raising the possibility that this variation was a polymorphism and not a somatic mutation related to the malignant cell itself. To distinguish between these two possibilities, genomic DNA was isolated from peripheral-blood mononuclear cells and amplified with exon H–specific primers. The germ-line androgen-receptor gene in this material was wild type. Thus, the codon 874 variant in Patient 2 was a somatic mutation (data not shown).

Paraffin blocks containing primary-tumor specimens obtained during a prostatectomy (Patient 3) and a core biopsy of the prostate (Patient 4) were available. Areas containing tumor were microdissected, and the DNA was extracted and amplified by PCR with exon-specific primers. The androgen-receptor genes in both cases were wild type, whereas these genes were mutated in the metastatic tumors.

The cells from Patient 5, which were derived from a malignant pleural effusion, had an androgen-receptor gene with four mutations located in exons D, E, and H (Table 2). Every isolate from two separate PCR amplifications contained these four mutations, which were also evident when the amplified PCR products were sequenced directly (data not shown). This patient's prostate cancer was unusual clinically in that it presented in an inguinal lymph node and the subsequent malignant pleural effusion, which contained cells weakly positive for prostate-specific antigen, resolved with flutamide treatment. Analysis of DNA from peripheral-blood mononuclear cells with primers specific for exons E and H demonstrated that the mutations in these exons were not polymorphisms (data not shown).

Functional Analysis of Mutant Androgen Receptors

The mutant androgen-receptor genes from Patients 1 and 2, which contained single point mutations and appeared to be expressed by the majority of tumor cells, were studied functionally. The cloned genes from these two tumors were transfected into CV-1 cells, and their ability to respond to progesterone and estradiol was assessed. The wild-type and mutant androgen receptors were inactive in the absence of androgen but could be stimulated by androgen (Figure 3Figure 3Functional Analysis of Androgen-Receptor Mutations.). As has been shown previously,22 the wild-type androgen receptor was specific for androgens and was only weakly stimulated by estrogen or progesterone (Figure 3). In contrast, the mutant androgen receptors from both patients were stimulated by estrogen and progesterone (Figure 3).

Discussion

We showed that semiquantitative amplification with reverse transcription PCR can detect transcripts of the androgen-receptor gene in metastatic androgen-independent prostate-cancer cells. The level of androgen-receptor gene expression in these samples was at least comparable to the amount expressed by LNCaP. This finding is consistent with results of immunohistochemical analysis of the expression of androgen-receptor genes in patients with advanced androgen-independent prostate cancer.20,29 They indicate that down-regulation of the gene cannot be a frequent mechanism of escape from programmed cell death triggered by androgen ablation. Instead, they suggest that tumor-cell growth after androgen ablation requires the expression of a functional androgen-receptor gene.

Sequence analyses revealed point mutations in the hormone-binding domain of the androgen-receptor gene in 5 of 10 patients with androgen-independent prostate cancer. Mutations in the androgen-receptor gene were not found in the two archival specimens of primary tumor examined, a result consistent with previous studies showing that these mutations are extremely rare in primary prostate cancer.16-20 This finding indicates that androgen ablation selects for tumor cells with certain mutations of the androgen-receptor gene, presumably because these mutant androgen receptors do not require the usual levels of androgen to stimulate cell growth. Functional studies showing that these mutations alter the hormone specificity of the androgen receptor further support this conclusion.

The mutations in codons 874 and 877 studied in this report both generated androgen receptors that could be stimulated by estrogen and progesterone. The LNCaP mutation described previously in codon 877 (threonine to alanine) generated an androgen receptor that could also be activated by estrogen, progesterone, and flutamide.22 A mutant androgen receptor recently isolated from a patient with androgen-independent prostate cancer (with a substitution of methionine for valine at codon 715) could similarly be stimulated by progesterone.18 These observations, together with previous mutagenesis studies of codon 877,30 indicate that a number of mutations in the hormone-binding domain can alter the specificity of the androgen receptor. In vitro studies indicate that the androgen receptor can also be constitutively activated by deletions in the hormone-binding domain,31 although such deletions have not yet been identified in vivo. Point mutations and deletions in the estrogen receptor have been found in breast cancer.32,33

Clinical data indicate that many androgen-independent prostate cancers are sensitive to secondary hormonal treatments, including flutamide withdrawal.4,5 These observations also suggest that functionally altered androgen receptors may be present in a substantial proportion of patients with androgen-independent prostate cancer. Nonetheless, there are other possible mechanisms of androgen independence,34,35 the importance of which remains to be established. It is most likely that androgen-independent prostate cancers are heterogeneous, even in individual patients. The relatively short-lived response to androgen ablation indicates that a large number of cells must be androgen-independent before androgen ablation as a result of independent mutations in the androgen-receptor gene and alterations in other proteins. Our results suggest that mutant androgen-receptor genes in androgen-independent prostate cancer could be useful targets of new drugs for the treatment of prostate cancer.

Supported by a Hematology Career Training Program grant (HL07516) (to Drs. Taplin and Shuster), by a Junior Faculty Research Award from the American Cancer Society (to Dr. Balk), and by a National Cancer Institute award (R-29 CA51438) (to Dr. Bubley).

We are indebted to Drs. Albert Brinkmann (Erasmus University) and Richard Pestell (Northwestern University Medical School) for providing plasmids; to Dr. William DeWolf (Urology Division, Beth Israel Hospital), Dr. Michael Constantine (Hematology–Oncology Division, Beth Israel Hospital), Dr. Phillip Kantoff (Dana–Farber Cancer Institute), and other members of the Beth Israel Hospital Hematology–Oncology Division for their cooperation and help in obtaining biopsy specimens; to Janet R. Butmare (Department of Pathology, Beth Israel Hospital) for cutting frozen sections; and to Pushpa Srivastava for automated sequencing.

Source Information

From the Oncology Division, Department of Medicine, University of Massachusetts Medical Center, Worcester (M.-E.T.), and the Hematology–Oncology Division, Department of Medicine, Beth Israel Hospital and Harvard Medical School, Boston (G.J.B., T.D.S., M.E.F., A.E.S., G.K.O., H.N.K., S.P.B.).

Address reprint requests to Dr. Balk at the Hematology–Oncology Division, Beth Israel Hospital, 330 Brookline Ave., Boston, MA 02215.

References

References

1. 1

   Boring CC, Squires TS, Tong T. Cancer statistics, 1992. CA Cancer J Clin 1992;42:19-38[Erratum, CA Cancer J Clin 1992;42:127-8.]
   CrossRef | Web of Science | Medline

2. 2

   Crawford ED. Challenges in the management of prostate cancer. Br J Urol 1992;70:Suppl 1:33-38
   CrossRef | Medline

3. 3

   van Tinteren H, Dalesio O. Systematic overview (metaanalysis) of all randomized trials of treatment of prostate cancer. Cancer 1993;72:Suppl:3847-3850
   CrossRef | Web of Science | Medline

4. 4

   Dawson NA. Treatment of progressive metastatic prostate cancer. Oncology 1993;7:17-24, 27[Erratum, Oncology (Huntingt) 1993;7:2.]
   Medline

5. 5

   Scher HI, Kelly WK. Flutamide withdrawal syndrome: its impact on clinical trials in hormone-refractory prostate cancer. J Clin Oncol 1993;11:1566-1572
   Web of Science | Medline

6. 6

   Cunha GR, Donjacour AA, Cooke PS, et al. The endocrinology and developmental biology of the prostate. Endocr Rev 1987;8:338-362
   CrossRef | Web of Science | Medline

7. 7

   Evans RM. The steroid and thyroid hormone receptor superfamily. Science 1988;240:889-895
   CrossRef | Web of Science | Medline

8. 8

   Beato M. Gene regulation by steroid hormones. Cell 1989;56:335-344
   CrossRef | Web of Science | Medline

9. 9

   Riegman PHJ, Vlietstra RJ, van der Korput JAGM, Brinkmann AO, Trapman J. The promoter of the prostate-specific antigen gene contains a functional androgen responsive element. Mol Endocrinol 1991;5:1921-1930
   CrossRef | Web of Science | Medline

10. 10

    Huggins C, Stevens RE Jr, Hodges CV. Studies on prostate cancer. II. The effects of castration on advanced carcinoma of the prostate gland. Arch Surg 1941;43:209-223
    Web of Science

11. 11

    Colombel M, Olsson CA, Ng PY, Buttyan R. Hormone-regulated apoptosis results from reentry of differentiated prostate cells onto a defective cell cycle. Cancer Res 1992;52:4313-4319
    Web of Science | Medline

12. 12

    Marcelli M, Tilley WD, Wilson CM, Griffin JE, Wilson JD, McPhaul MJ. Definition of the human androgen receptor gene structure permits the identification of mutations that cause androgen resistance: premature termination of the receptor protein at amino acid residue 588 causes complete androgen resistance. Mol Endocrinol 1990;4:1105-1116
    CrossRef | Web of Science | Medline

13. 13

    Lubahn DB, Brown TR, Simental JA, et al. Sequence of the intron/exon junctions of the coding region of the human androgen receptor gene and identification of a point mutation in a family with complete androgen insensitivity. Proc Natl Acad Sci U S A 1989;86:9534-9538[Erratum, Proc Natl Acad Sci U S A 1990;87:4411.]
    CrossRef | Web of Science | Medline

14. 14

    De Bellis A, Quigley CA, Cariello NF, et al. Single base mutations in the human androgen receptor gene causing complete androgen insensitivity: rapid detection by a modified denaturing gradient gel electrophoresis technique. Mol Endocrinol 1992;6:1909-1920
    CrossRef | Web of Science | Medline

15. 15

    Caskey CT, Pizzuti A, Fu Y-H, Fenwick RG Jr, Nelson DL. Triplet repeat mutations in human disease. Science 1992;256:784-789
    CrossRef | Web of Science | Medline

16. 16

    Newmark JR, Hardy DO, Tonb DC, et al. Androgen receptor gene mutations in human prostate cancer. Proc Natl Acad Sci U S A 1992;89:6319-6323
    CrossRef | Web of Science | Medline

17. 17

    Culig Z, Klocker H, Eberle J, et al. DNA sequence of the androgen receptor in prostatic tumor cell lines and tissue specimens assessed by means of the polymerase chain reaction. Prostate 1993;22:11-22
    CrossRef | Web of Science | Medline

18. 18

    Culig Z, Hobisch A, Cronauer MV, et al. Mutant androgen receptor detected in an advanced-stage prostatic carcinoma is activated by adrenal androgens and progesterone. Mol Endocrinol 1993;7:1541-1550
    CrossRef | Web of Science | Medline

19. 19

    Suzuki H, Sato N, Watabe Y, Masai M, Seino S, Shimazaki J. Androgen receptor gene mutations in human prostate cancer. J Steroid Biochem Mol Biol 1993;46:759-765
    CrossRef | Web of Science | Medline

20. 20

    Ruizeveld de Winter JA, Janssen PJA, Sleddens HMEB, et al. Androgen receptor status in localized and locally progressive hormone refractory human prostate cancer. Am J Pathol 1994;144:735-746
    Web of Science | Medline

21. 21

    Gaddipati JP, McLeod DG, Heidenberg HB, et al. Frequent detection of codon 877 mutation in the androgen receptor gene in advanced prostate cancers. Cancer Res 1994;54:2861-2864
    Web of Science | Medline

22. 22

    Veldscholte J, Ris-Stalpers C, Kuiper GGJM, et al. A mutation in the ligand binding domain of the androgen receptor of human LNCaP cells affects steroid binding characteristics and response to anti-androgens. Biochem Biophys Res Commun 1990;173:534-540
    CrossRef | Web of Science | Medline

23. 23

    Porcelli S, Yockey CE, Brenner MB, Balk SP. Analysis of T cell antigen receptor (TCR) expression by human peripheral blood CD4-8- α/β T cells demonstrates preferential use of several V β genes and an invariant TCR α chain. J Exp Med 1993;178:1-16
    CrossRef | Web of Science | Medline

24. 24

    Gussow D, Rein R, Ginjaar I, et al. The human β2-microglobulin gene: primary structure and definition of the transcriptional unit. J Immunol 1987;139:3132-3138
    Web of Science | Medline

25. 25

    Brinkmann AO, Faber PW, van Rooij HCJ, et al. The human androgen receptor: domain structure, genomic organization and regulation of expression. J Steroid Biochem 1989;34:307-310
    CrossRef | Medline

26. 26

    Nordeen SK. Luciferase reporter gene vectors for analysis of promoters and enhancers. Biotechniques 1988;6:454-458
    Web of Science | Medline

27. 27

    Quarmby VE, Yarbrough WG, Lubahn DB, French FS, Wilson EM. Autologous down-regulation of androgen receptor messenger ribonucleic acid. Mol Endocrinol 1990;4:22-28
    CrossRef | Web of Science | Medline

28. 28

    Lubahn DB, Joseph DR, Sar M, et al. The human androgen receptor: complementary deoxyribonucleic acid cloning, sequence analysis and gene expression in prostate. Mol Endocrinol 1988;2:1265-1275
    CrossRef | Web of Science | Medline

29. 29

    van der Kwast TH, Schalken J, Ruizeveld de Winter JA, et al. Androgen receptors in endocrine-therapy-resistant human prostate cancer. Int J Cancer 1991;48:189-193
    CrossRef | Web of Science | Medline

30. 30

    Ris-Staplers C, Verleun-Mooijman MCT, Trapman J, Brinkmann AO. Threonine on amino acid position 868 in the human androgen receptor is essential for androgen binding specificity and functional activity. Biochem Biophys Res Commun 1993;196:173-180
    CrossRef | Web of Science | Medline

31. 31

    Jenster G, van der Korput HAGM, van Vroonhoven C, van der Kwast TH, Trapman J, Brinkmann AO. Domains of the human androgen receptor involved in steroid binding, transcriptional activation, and subcellular localization. Mol Endocrinol 1991;5:1396-1404
    CrossRef | Web of Science | Medline

32. 32

    Fuqua SA, Chamness GC, McGuire WL. Estrogen receptor mutations in breast cancer. J Cell Biochem 1993;51:135-139
    CrossRef | Web of Science | Medline

33. 33

    Karnik PS, Kulkarni S, Liu XP, Budd GT, Bukowski RM. Estrogen receptor mutations in tamoxifen-resistant breast cancer. Cancer Res 1994;54:349-353
    Web of Science | Medline

34. 34

    McDonnell TJ, Troncoso P, Brisbay SM, et al. Expression of the protooncogene bcl-2 in the prostate and its association with emergence of androgen-independent prostate cancer. Cancer Res 1992;52:6940-6944
    Web of Science | Medline

35. 35

    Bookstein R, MacGrogan D, Hilsenbeck SG, Sharkey F, Allred DC. p53 Is mutated in a subset of advanced-stage prostate cancers. Cancer Res 1993;53:3369-3373
    Web of Science | Medline

Citing Articles (295)

Citing Articles

1. 1

   Y Li, T H Hwang, L A Oseth, A Hauge, R L Vessella, S C Schmechel, B Hirsch, K B Beckman, K A Silverstein, S M Dehm. (2012) AR intragenic deletions linked to androgen receptor splice variant expression and activity in models of prostate cancer progression. Oncogene
   CrossRef

2. 2

   Deborah Mukherji, Carmel J Pezaro, Johann S De-Bono. (2012) MDV3100 for the treatment of prostate cancer. Expert Opinion on Investigational Drugs1-7
   CrossRef

3. 3

   Kati K. Waltering, Alfonso Urbanucci, Tapio Visakorpi. (2012) Androgen receptor (AR) aberrations in castration-resistant prostate cancer. Molecular and Cellular Endocrinology
   CrossRef

4. 4

   Gopal L. Khatik, Jasmine Kaur, Varun Kumar, Kulbhushan Tikoo, Vipin A. Nair. (2012) 1,2,4-oxadiazoles: a new class of anti-prostate cancer agents. Bioorganic & Medicinal Chemistry Letters
   CrossRef

5. 5

   Mari Nakabayashi, Lillian Werner, William K. Oh, Meredith M. Regan, Philip W. Kantoff, Mary-Ellen Taplin. (2011) Secondary Hormonal Therapy in Men With Castration-Resistant Prostate Cancer. Clinical Genitourinary Cancer 9:2, 95-103
   CrossRef

6. 6

   Changmeng Cai, Housheng Hansen He, Sen Chen, Ilsa Coleman, Hongyun Wang, Zi Fang, Shaoyong Chen, Peter S. Nelson, X. Shirley Liu, Myles Brown, Steven P. Balk. (2011) Androgen Receptor Gene Expression in Prostate Cancer Is Directly Suppressed by the Androgen Receptor Through Recruitment of Lysine-Specific Demethylase 1. Cancer Cell 20:4, 457-471
   CrossRef

7. 7

   E-Chu Huang, Guoxun Chen, Seung Joon Baek, Michael F. McEntee, J. Jason Collier, Steven Minkin, John Biggerstaff, Jay Whelan. (2011) Zyflamend Reduces the Expression of Androgen Receptor in a Model of Castrate-Resistant Prostate Cancer. Nutrition and Cancer110929073437000
   CrossRef

8. 8

   E S Antonarakis, A J Armstrong. (2011) Evolving standards in the treatment of docetaxel-refractory castration-resistant prostate cancer. Prostate Cancer and Prostatic Diseases 14:3, 192-205
   CrossRef

9. 9

   C. Nabhan, B. Parsons, E. Z. Touloukian, W. M. Stadler. (2011) Novel approaches and future directions in castration-resistant prostate cancer. Annals of Oncology 22:9, 1948-1957
   CrossRef

10. 10

    Bertrand Tombal. (2011) What is the pathophysiology of a hormone-resistant prostate tumour?. European Journal of Cancer 47, S179-S188
    CrossRef

11. 11

    J. Puente Vazquez, E. Grande Pulido, L. M. Anton Aparicio. (2011) Cytokine and endocrine signaling in prostate cancer. Medical Oncology
    CrossRef

12. 12

    Timothy A. Yap, Andrea Zivi, Aurelius Omlin, Johann S. de Bono. (2011) The changing therapeutic landscape of castration-resistant prostate cancer. Nature Reviews Clinical Oncology 8:10, 597-610
    CrossRef

13. 13

    Gopal L. Khatik, Jasmine Kaur, Varun Kumar, Kulbhushan Tikoo, P. Venugopalan, Vipin A. Nair. (2011) Aldol derivatives of Thioxoimidazolidinones as potential anti-prostate cancer agents. European Journal of Medicinal Chemistry 46:8, 3291-3301
    CrossRef

14. 14

    Keith R. Solomon, Michael R. Freeman. (2011) The Complex Interplay Between Cholesterol and Prostate Malignancy. Urologic Clinics of North America 38:3, 243-259
    CrossRef

15. 15

    Jusheng Zheng, Bin Yang, Tao Huang, Yinghua Yu, Jing Yang, Duo Li. (2011) Green Tea and Black Tea Consumption and Prostate Cancer Risk: An Exploratory Meta-Analysis of Observational Studies. Nutrition and Cancer 63:5, 663-672
    CrossRef

16. 16

    S Kawamura, I Sato, T Wada, K Yamaguchi, Y Li, D Li, X Zhao, S Ueno, H Aoki, T Tochigi, M Kuwahara, T Kitamura, K Takahashi, S Moriya, T Miyagi. (2011) Plasma membrane-associated sialidase (NEU3) regulates progression of prostate cancer to androgen-independent growth through modulation of androgen receptor signaling. Cell Death and Differentiation
    CrossRef

17. 17

    Koji Hoshino, Hitoshi Ishiguro, Jun-ichi Teranishi, Shin-ichiro Yoshida, Satoshi Umemura, Yoshinobu Kubota, Hiroji Uemura. (2011) Regulation of androgen receptor expression through angiotensin II type 1 receptor in prostate cancer cells. The Prostate 71:9, 964-975
    CrossRef

18. 18

    Diane M. Robins. (2011) Androgen receptor gene polymorphisms and alterations in prostate cancer: Of humanized mice and men. Molecular and Cellular Endocrinology
    CrossRef

19. 19

    Kiminori Ohta, Tokuhito Goto, Shinya Fujii, Masatoshi Kawahata, Akifumi Oda, Shigeru Ohta, Kentaro Yamaguchi, Shuichi Hirono, Yasuyuki Endo. (2011) Crystal structure, docking study and structure–activity relationship of carborane-containing androgen receptor antagonist 3-(12-hydroxymethyl-1,12-dicarba-closo-dodecaboran-1-yl)benzonitrile. Bioorganic & Medicinal Chemistry 19:11, 3540-3548
    CrossRef

20. 20

    Emily B. Askew, John T. Minges, Andrew T. Hnat, Elizabeth M. Wilson. (2011) Structural features discriminate androgen receptor N/C terminal and coactivator interactions. Molecular and Cellular Endocrinology
    CrossRef

21. 21

    Jérôme Doyen, Catherine Alix-Panabières, Paul Hofman, Scott K. Parks, Emmanuel Chamorey, Hervé Naman, Jean-Michel Hannoun-Lévi. (2011) Circulating tumor cells in prostate cancer: A potential surrogate marker of survival. Critical Reviews in Oncology/Hematology
    CrossRef

22. 22

    Leonardo Oliveira Reis. (2011) Old issues and new perspectives on prostate cancer hormonal therapy: the molecular substratum. Medical Oncology
    CrossRef

23. 23

    S. Takahashi, T. Watanabe, M. Okada, K. Inoue, T. Ueda, I. Takada, T. Watabe, Y. Yamamoto, T. Fukuda, T. Nakamura, C. Akimoto, T. Fujimura, M. Hoshino, Y. Imai, D. Metzger, K. Miyazono, Y. Minami, P. Chambon, T. Kitamura, T. Matsumoto, S. Kato. (2011) Noncanonical Wnt signaling mediates androgen-dependent tumor growth in a mouse model of prostate cancer. Proceedings of the National Academy of Sciences 108:12, 4938-4943
    CrossRef

24. 24

    Hai-Liang Zhang, Li-Feng Yang, Yao Zhu, Xu-Dong Yao, Shi-Lin Zhang, Bo Dai, Yi-Ping Zhu, Yi-Jun Shen, Guo-Hai Shi, Ding-Wei Ye. (2011) Serum miRNA-21: Elevated levels in patients with metastatic hormone-refractory prostate cancer and potential predictive factor for the efficacy of docetaxel-based chemotherapy. The Prostate 71:3, 326-331
    CrossRef

25. 25

    Fernand Labrie. (2011) Blockade of testicular and adrenal androgens in prostate cancer treatment. Nature Reviews Urology 8:2, 73-85
    CrossRef

26. 26

    Seiji Arai, Yoshimichi Miyashiro, Yasuhiro Shibata, Yukio Tomaru, Mikio Kobayashi, Seijiro Honma, Kazuhiro Suzuki. (2011) Effect of castration monotherapy on the levels of adrenal androgens in cancerous prostatic tissues. Steroids 76:3, 301-308
    CrossRef

27. 27

    Shinya Fujii, Ayumi Yamada, Keiko Tomita, Mao Nagano, Tokuhito Goto, Kiminori Ohta, Takashi Harayama, Yasuyuki Endo, Hiroyuki Kagechika. (2011) p-Carborane-based androgen antagonists active in LNCaP cells with a mutated androgen receptor. MedChemComm 2:9, 877
    CrossRef

28. 28

    Yaming Qiao, Lu Wang, Li-Qun Cai, Chen Tan, Julianne Imperato-McGinley, Yuan-Shan Zhu. (2011) Inhibition of Aberrant Androgen Receptor Induction of Prostate Specific Antigen Gene Expression, Cell Proliferation and Tumor Growth by 17α-Estradiol in Prostate Cancer. The Journal of Urology 185:1, 305-314
    CrossRef

29. 29

    Neil E. Martin, Lorelei A. Mucci, Massimo Loda, Ronald A. DePinho. (2011) Prognostic Determinants in Prostate Cancer. The Cancer Journal 17:6, 429-437
    CrossRef

30. 30

    Dongxia Ge, Allen C. Gao, Qiuyang Zhang, Sen Liu, Yun Xue, Zongbing You. (2011) LNCaP prostate cancer cells with autocrine interleukin-6 expression are resistant to IL-6-induced neuroendocrine differentiation due to increased expression of suppressors of cytokine signaling. The Prostaten/a-n/a
    CrossRef

31. 31

    Alfonso Urbanucci, Saara Marttila, Olli A. Jänne, Tapio Visakorpi. (2011) Androgen receptor overexpression alters binding dynamics of the receptor to chromatin and chromatin structure. The Prostaten/a-n/a
    CrossRef

32. 32

    Lynn N. Thomas, Timothy J. Morehouse, Catherine K.L. Too. (2011) Testosterone and prolactin increase carboxypeptidase-D and nitric oxide levels to promote survival of prostate cancer cells. The Prostaten/a-n/a
    CrossRef

33. 33

    Sujit Basu, Donald J. Tindall. (2010) Androgen Action in Prostate Cancer. Hormones and Cancer 1:5, 223-228
    CrossRef

34. 34

    Carolina Castilla, Belén Congregado, José M. Conde, Rafael Medina, Francisco J. Torrubia, Miguel A. Japón, Carmen Sáez. (2010) Immunohistochemical Expression of Hsp60 Correlates With Tumor Progression and Hormone Resistance in Prostate Cancer. Urology 76:4, 1017.e1-1017.e6
    CrossRef

35. 35

    Rong Hu, Samuel R Denmeade, Jun Luo. (2010) Molecular processes leading to aberrant androgen receptor signaling and castration resistance in prostate cancer. Expert Review of Endocrinology & Metabolism 5:5, 753-764
    CrossRef

36. 36

    Shahriar Koochekpour. (2010) Androgen receptor signaling and mutations in prostate cancer. Asian Journal of Andrology 12:5, 639-657
    CrossRef

37. 37

    SRC McCracken, GC Durkan, RS Pickard, CN Robson. (2010) Diagnosis and management of prostate cancer in the older man. Reviews in Clinical Gerontology 20:03, 193-204
    CrossRef

38. 38

    Motohide Uemura, Seijiro Honma, Suyoun Chung, Ryo Takata, Mutsuo Furihata, Kazuo Nishimura, Norio Nonomura, Yasutomo Nasu, Tsuneharu Miki, Taro Shuin, Tomoaki Fujioka, Akihiko Okuyama, Yusuke Nakamura, Hidewaki Nakagawa. (2010) 5αDH-DOC (5α-dihydro-deoxycorticosterone) activates androgen receptor in castration-resistant prostate cancer. Cancer Science 101:8, 1897-1904
    CrossRef

39. 39

    Chidi N. Molokwu, Olajumoke O. Adeniji, Shankar Chandrasekharan, Freddie C. Hamdy, David J. Buttle. (2010) Androgen Regulates ADAMTS15 Gene Expression in Prostate Cancer Cells. Cancer Investigation 28:7, 698-710
    CrossRef

40. 40

    Martin Ligr, Yirong Li, Xuanyi Zou, Garrett Daniels, Jonathan Melamed, Yi Peng, Wei Wang, Jinhua Wang, Harry Ostrer, Michele Pagano, Zhengxin Wang, Michael J. Garabedian, Peng Lee. (2010) Tumor Suppressor Function of Androgen Receptor Coactivator ARA70α in Prostate Cancer. The American Journal of Pathology 176:4, 1891-1900
    CrossRef

41. 41

    S. L. Stott, R. J. Lee, S. Nagrath, M. Yu, D. T. Miyamoto, L. Ulkus, E. J. Inserra, M. Ulman, S. Springer, Z. Nakamura, A. L. Moore, D. I. Tsukrov, M. E. Kempner, D. M. Dahl, C. L. Wu, A. J. Iafrate, M. R. Smith, R. G. Tompkins, L. V. Sequist, M. Toner, D. A. Haber, S. Maheswaran. (2010) Isolation and Characterization of Circulating Tumor Cells from Patients with Localized and Metastatic Prostate Cancer. Science Translational Medicine 2:25, 25ra23-25ra23
    CrossRef

42. 42

    Shreya Shah, Eric Small. (2010) Emerging biological observations in prostate cancer. Expert Review of Anticancer Therapy 10:1, 89-101
    CrossRef

43. 43

    Hanna E. Suikki, Paula M. Kujala, Teuvo L.J. Tammela, Wytske M. van Weerden, Robert L. Vessella, Tapio Visakorpi. (2010) Genetic alterations and changes in expression of histone demethylases in prostate cancer. The Prostaten/a-n/a
    CrossRef

44. 44

    Kiran Mahajan, Sridevi Challa, Domenico Coppola, Harshani Lawrence, Yunting Luo, Harsukh Gevariya, Weiwei Zhu, Y. Ann Chen, Nicholas J. Lawrence, Nupam P. Mahajan. (2010) Effect of Ack1 tyrosine kinase inhibitor on ligand-independent androgen receptor activity. The Prostaten/a-n/a
    CrossRef

45. 45

    Chen-Li Lai, René van den Ham, Jan Mol, Erik Teske. (2009) Immunostaining of the androgen receptor and sequence analysis of its DNA-binding domain in canine prostate cancer. The Veterinary Journal 181:3, 256-260
    CrossRef

46. 46

    G. Shaw, R.T.D. Oliver. (2009) Intermittent hormone therapy and its place in the contemporary endocrine treatment of prostate cancer. Surgical Oncology 18:3, 275-282
    CrossRef

47. 47

    George W. Yardy, David C. Bicknell, Jennifer L. Wilding, Sylvia Bartlett, Ying Liu, Bruce Winney, Gareth D.H. Turner, Simon F. Brewster, Walter F. Bodmer. (2009) Mutations in the AXIN1 Gene in Advanced Prostate Cancer. European Urology 56:3, 486-494
    CrossRef

48. 48

    Tetsuya Fujimura, Satoru Takahashi, Tomohiko Urano, Jinpei Kumagai, Taro Murata, Kenichi Takayama, Tetsuo Ogushi, Kuniko Horie-Inoue, Yasuyoshi Ouchi, Tadaichi Kitamura, Masami Muramatsu, Yukio Homma, Satoshi Inoue. (2009) Expression of Cytochrome P450 3A4 and Its Clinical Significance in Human Prostate Cancer. Urology 74:2, 391-397
    CrossRef

49. 49

    André N. Vis, Fritz H. Schröder. (2009) Key targets of hormonal treatment of prostate cancer. Part 1: the androgen receptor and steroidogenic pathways. BJU International 104:4, 438-448
    CrossRef

50. 50

    Rieko Tadokoro, Trevor Bunch, John W. R. Schwabe, Ieuan A. Hughes, Jane C. Murphy. (2009) Comparison of the molecular consequences of different mutations at residue 754 and 690 of the androgen receptor (AR) and androgen insensitivity syndrome (AIS) phenotype. Clinical Endocrinology 71:2, 253-260
    CrossRef

51. 51

    Dixan A. Benitez, Marcela A. Hermoso, Eulalia Pozo-Guisado, Pedro M. Fernández-Salguero, Enrique A. Castellón. (2009) Regulation of cell survival by resveratrol involves inhibition of NFκB-regulated gene expression in prostate cancer cells. The Prostate 69:10, 1045-1054
    CrossRef

52. 52

    Howard C. Shen, Steven P. Balk. (2009) Development of Androgen Receptor Antagonists with Promising Activity in Castration-Resistant Prostate Cancer. Cancer Cell 15:6, 461-463
    CrossRef

53. 53

    Terence W. Friedlander, Charles J. Ryan. (2009) Novel hormonal approaches in prostate cancer. Current Oncology Reports 11:3, 227-234
    CrossRef

54. 54

    R Trauger, E Corey, D Bell, S White, A Garsd, D Stickney, C Reading, J Frincke. (2009) Inhibition of androstenediol-dependent LNCaP tumour growth by 17α-ethynyl-5α-androstane-3α, 17β-diol (HE3235). British Journal of Cancer 100:7, 1068-1072
    CrossRef

55. 55

    Matthew N. Simmons, Eric A. Klein. (2009) Combined Androgen Blockade Revisited: Emerging Options for the Treatment of Castration-Resistant Prostate Cancer. Urology 73:4, 697-705
    CrossRef

56. 56

    Jean-Pierre Bergerat, Jocelyn Craline. (2009) Pleiotropic functional properties of androgen receptor mutants in prostate cancer. Human Mutation 30:2, 145-157
    CrossRef

57. 57

    Hong-Lin Devlin, Maria Mudryj. (2009) Progression of prostate cancer: Multiple pathways to androgen independence. Cancer Letters 274:2, 177-186
    CrossRef

58. 58

    Hai-Lei Mao, Zhi-Qi Zhu, Charlie Degui Chen. (2009) The androgen receptor in hormone-refractory prostate cancer. Asian Journal of Andrology 11:1, 69-73
    CrossRef

59. 59

    Xin Yuan, Steven P. Balk. (2009) Mechanisms mediating androgen receptor reactivation after castration. Urologic Oncology: Seminars and Original Investigations 27:1, 36-41
    CrossRef

60. 60

    Naoki Terada, Yosuke Shimizu, Toru Yoshida, Atsushi Maeno, Tomomi Kamba, Takahiro Inoue, Eijiro Nakamura, Toshiyuki Kamoto, Osamu Ogawa. (2009) Antiandrogen withdrawal syndrome and alternative antiandrogen therapy associated with the W741C mutant androgen receptor in a novel prostate cancer xenograft. The Prostaten/a-n/a
    CrossRef

61. 61

    DAVID G. BOSTWICK, ISABELLE MEIERS. 2009. Prostate. , 1121-1180.
    CrossRef

62. 62

    Begoña Mellado, Jordi Codony, María José Ribal, Laura Visa, Pere Gascón. (2009) Molecular biology of androgen-independent prostate cancer: the role of the androgen receptor pathway. Clinical and Translational Oncology 11:1, 5-10
    CrossRef

63. 63

    Shinya Fujii, Kiminori Ohta, Tokuhito Goto, Hiroyuki Kagechika, Yasuyuki Endo. (2009) Acidic heterocycles as novel hydrophilic pharmacophore of androgen receptor ligands with a carborane core structure. Bioorganic & Medicinal Chemistry 17:1, 344-350
    CrossRef

64. 64

    Angela Brodie, Vincent Njar, Luciana Furtado Macedo, T. Sean Vasaitis, Gauri Sabnis. (2009) The Coffey Lecture: Steroidogenic enzyme inhibitors and hormone dependent cancer. Urologic Oncology: Seminars and Original Investigations 27:1, 53-63
    CrossRef

65. 65

    S. Joseph Sirintrapun, Anil V. Parwani. (2008) Molecular Pathology of the Genitourinary Tract: Prostate and Bladder. Surgical Pathology Clinics 1:1, 211-236
    CrossRef

66. 66

    Jun-ichi Teranishi, Hitoshi Ishiguro, Koji Hoshino, Kazumi Noguchi, Yoshinobu Kubota, Hiroji Uemura. (2008) Evaluation of role of angiotensin III and aminopeptidases in prostate cancer cells. The Prostate 68:15, 1666-1673
    CrossRef

67. 67

    Hla Y. Win, Mildred Acevedo-Duncan. (2008) Atypical protein kinase C phosphorylates IKKαβ in transformed non-malignant and malignant prostate cell survival. Cancer Letters 270:2, 302-311
    CrossRef

68. 68

    Hiroyoshi Suzuki, Koji Okihara, Hideaki Miyake, Masato Fujisawa, Susumu Miyoshi, Tetsuro Matsumoto, Motohiro Fujii, Yoshio Takihana, Tsuguru Usui, Tadashi Matsuda, Seiichiro Ozono, Hiromi Kumon, Tomohiko Ichikawa, Tsuneharu Miki. (2008) Alternative Nonsteroidal Antiandrogen Therapy for Advanced Prostate Cancer That Relapsed After Initial Maximum Androgen Blockade. The Journal of Urology 180:3, 921-927
    CrossRef

69. 69

    H Makkonen, T Jääskeläinen, T Pitkänen-Arsiola, M Rytinki, K K Waltering, M Mättö, T Visakorpi, J J Palvimo. (2008) Identification of ETS-like transcription factor 4 as a novel androgen receptor target in prostate cancer cells. Oncogene 27:36, 4865-4876
    CrossRef

70. 70

    Miltiadis Paliouras, Eleftherios P. Diamandis. (2008) An AKT activity threshold regulates androgen-dependent and androgen-independent PSA expression in prostate cancer cell lines. Biological Chemistry 389:6, 773-780
    CrossRef

71. 71

    Taija M. Kiviharju-af Hällström, Marikki Laiho. (2008) Genetic changes and DNA damage responses in the prostate. The Prostate 68:8, 902-918
    CrossRef

72. 72

    Giovanni Luca Gravina, Claudio Festuccia, Danilo Millimaggi, Vincenza Dolo, Vincenzo Tombolini, Mariano de Vito, Carlo Vicentini, Mauro Bologna. (2008) Chronic azacitidine treatment results in differentiating effects, sensitizes against bicalutamide in androgen-independent prostate cancer cells. The Prostate 68:7, 793-801
    CrossRef

73. 73

    G N Brooke, M G Parker, C L Bevan. (2008) Mechanisms of androgen receptor activation in advanced prostate cancer: differential co-activator recruitment and gene expression. Oncogene 27:21, 2941-2950
    CrossRef

74. 74

    Kathleen Kelly, Juan Juan Yin. (2008) Prostate cancer and metastasis initiating stem cells. Cell Research 18:5, 528-537
    CrossRef

75. 75

    Mark A Rubin. (2008) Targeted therapy of cancer: new roles for pathologists—prostate cancer. Modern Pathology 21, S44-S55
    CrossRef

76. 76

    Mary-Ellen Taplin, Judith Manola, William K. Oh, Philip W. Kantoff, Glenn J. Bubley, Matthew Smith, Diana Barb, Christos Mantzoros, Edward P. Gelmann, Steven P. Balk. (2008) A phase II study of mifepristone (RU-486) in castration-resistant prostate cancer, with a correlative assessment of androgen-related hormones. BJU International 101:9, 1084-1089
    CrossRef

77. 77

    Michael J. McPhaul. (2008) Mechanisms of prostate cancer progression to androgen independence. Best Practice & Research Clinical Endocrinology & Metabolism 22:2, 373-388
    CrossRef

78. 78

    James L. Mohler. (2008) A role for the androgen-receptor in clinically localized and advanced prostate cancer. Best Practice & Research Clinical Endocrinology & Metabolism 22:2, 357-372
    CrossRef

79. 79

    Jasmine George, Nidhi Nigam, Yogeshwer Shukla. (2008) Tea: age-old beverage as an effective cancer chemopreventive agent. Oncology Reviews 1:4, 243-252
    CrossRef

80. 80

    Lynn N. Thomas, Robert C. Douglas, Catherine B. Lazier, Catherine K.L. Too, Roger S. Rittmaster, Donald J. Tindall. (2008) Type 1 and Type 2 5α-Reductase Expression in the Development and Progression of Prostate Cancer. European Urology 53:2, 244-252
    CrossRef

81. 81

    Takeshi HOSOYA, Tsuyoshi MONDEN, Yoshitatsu FUKABORI, Koshi HASHIMOTO, Teturou SATOH, Kikuo KASAI, Masanobu YAMADA, Masatomo MORI. (2008) A Novel Splice Variant of the Nuclear Coactivator p120 Functions Strongly for Androgen Receptor: Characteristic Expression in Prostate Disease. Endocrine Journal 55:4, 657-665
    CrossRef

82. 82

    Hiroji Uemura, Hitoshi Ishiguro, Yoshinobu Kubota. (2008) Pharmacology and new perspectives of angiotensin II receptor blocker in prostate cancer treatment. International Journal of Urology 15:1, 19-26
    CrossRef

83. 83

    Yong Q. Chen, Iris J. Edwards, Steven J. Kridel, Todd Thornburg, Isabelle M. Berquin. (2007) Dietary fat’gene interactions in cancer. Cancer and Metastasis Reviews 26:3-4, 535-551
    CrossRef

84. 84

    Gretchen A. Gignac, Michael J. Morris, Maha Hussain. (2007) Castration Resistant, Taxane Naïve Metastatic Prostate Cancer: Current Clinical Approaches and Future Directions. The Journal of Urology 178:3, S30-S35
    CrossRef

85. 85

    Takahiro Inoue, Takashi Kobayashi, Naoki Terada, Yosuke Shimizu, Toshiyuki Kamoto, Osamu Ogawa, Eijiro Nakamura. (2007) Roles of androgen-dependent and -independent activation of signal transduction pathways for cell proliferation of prostate cancer cells. Expert Review of Endocrinology & Metabolism 2:5, 689-704
    CrossRef

86. 86

    Yelena B. Wetherill, Benson T. Akingbemi, Jun Kanno, John A. McLachlan, Angel Nadal, Carlos Sonnenschein, Cheryl S. Watson, R. Thomas Zoeller, Scott M. Belcher. (2007) In vitro molecular mechanisms of bisphenol A action. Reproductive Toxicology 24:2, 178-198
    CrossRef

87. 87

    Q Wei, M Li, X Fu, R Tang, Y Na, M Jiang, Y Li. (2007) Global analysis of differentially expressed genes in androgen-independent prostate cancer. Prostate Cancer and Prostatic Diseases 10:2, 167-174
    CrossRef

88. 88

    Xu-Bao Shi, Lingru Xue, Clifford G. Tepper, Regina Gandour-Edwards, Paramita Ghosh, Hsing-Jien Kung, Ralph W. deVere White. (2007) The oncogenic potential of a prostate cancer-derived androgen receptor mutant. The Prostate 67:6, 591-602
    CrossRef

89. 89

    Renée Chmelar, Grant Buchanan, Eleanor F. Need, Wayne Tilley, Norman M. Greenberg. (2007) Androgen receptor coregulators and their involvement in the development and progression of prostate cancer. International Journal of Cancer 120:4, 719-733
    CrossRef

90. 90

    Ayla Ergün, Carolyn A Lawrence, Michael A Kohanski, Timothy A Brennan, James J Collins. (2007) A network biology approach to prostate cancer. Molecular Systems Biology 3,
    CrossRef

91. 91

    H.G. van der Poel. (2007) Molecular markers in the diagnosis of prostate cancer. Critical Reviews in Oncology/Hematology 61:2, 104-139
    CrossRef

92. 92

    William K. Oh, Miah-Hiang Tay, Jiaoti Huang. (2007) Is there a role for platinum chemotherapy in the treatment of patients with hormone-refractory prostate cancer?. Cancer 109:3, 477-486
    CrossRef

93. 93

    Maria Nieto, Stephen Finn, Massimo Loda, William C. Hahn. (2007) Prostate cancer: Re-focusing on androgen receptor signaling. The International Journal of Biochemistry & Cell Biology 39:9, 1562-1568
    CrossRef

94. 94

    Thomas W. Bonagura, Min Deng, Terry R. Brown. (2007) A naturally occurring mutation in the human androgen receptor of a subject with complete androgen insensitivity confers binding and transactivation by estradiol. Molecular and Cellular Endocrinology 263:1-2, 79-89
    CrossRef

95. 95

    Akira Nagaoka, Yoko Kubota, Seiichi Kurosu, Teruhiro Nakada, Vladimir Bilim, Yosihiko Tomita, Teiichi Motoyama. (2006) Absence of Bcl-2 expression favors response to the short-term administration of diethylstilbestrol diphosphate in prostate Cancer. The Prostate 66:16, 1779-1787
    CrossRef

96. 96

    Daniel Sanchez, David Rosell, Beatriz Honorato, Jorge Lopez, Juan Arocena, Gonzalo Sanz. (2006) Androgen receptor mutations are associated with Gleason score in localized prostate cancer. BJU International 98:6, 1320-1325
    CrossRef

97. 97

    Eric J. Small, Charles J. Ryan. (2006) The Case for Secondary Hormonal Therapies in the Chemotherapy Age. The Journal of Urology 176:6, S66-S71
    CrossRef

98. 98

    Ingo K. Mellinghoff. 2006. Novel Approaches to Androgen Receptor Blockade. , 163-178.
    CrossRef

99. 99

    William G. Nelson, Angelo M. De Marzo. 2006. The Molecular Pathogenesis and Pathophysiology of Prostate Cancer. , 1-25.
    CrossRef

100. 100

     Rajvir Dahiya. 2006. Cancer of the Prostate: Molecular Genetics. .
     CrossRef

101. 101

     Hanna E. Mäki, Kati K. Waltering, Mika J. Wallén, Paula M. Martikainen, Teuvo L.J. Tammela, Wytske M. van Weerden, Robert L. Vessella, Tapio Visakorpi. (2006) Screening of genetic and expression alterations of SRC1 gene in prostate cancer. The Prostate 66:13, 1391-1398
     CrossRef

102. 102

     Steven Attia, George Wilding. (2006) Novel antioxidant technology for prostate cancer chemoprevention and treatment. Expert Opinion on Therapeutic Patents 16:9, 1255-1267
     CrossRef

103. 103

     Akinobu Maeda, Koh-ichi Nakashiro, Shingo Hara, Toyokazu Sasaki, Yoshihiro Miwa, Nozomu Tanji, Masayoshi Yokoyama, Hiroyuki Hamakawa, Ryoichi Oyasu. (2006) Inactivation of AR activates HGF/c-Met system in human prostatic carcinoma cells. Biochemical and Biophysical Research Communications 347:4, 1158-1165
     CrossRef

104. 104

     Philip M. Arlen, William L. Dahut, James L. Gulley. (2006) Immunotherapy for Prostate Cancer: What's the Future?. Hematology/Oncology Clinics of North America 20:4, 965-983
     CrossRef

105. 105

     Charles J. Ryan. (2006) Secondary Hormonal Manipulations in Prostate Cancer. Hematology/Oncology Clinics of North America 20:4, 925-934
     CrossRef

106. 106

     Ephraim E. Parent, Carl Jenks, Terry Sharp, Michael J. Welch, John A. Katzenellenbogen. (2006) Synthesis and biological evaluation of a nonsteroidal bromine-76-labeled androgen receptor ligand 3-[76Br]bromo-hydroxyflutamide. Nuclear Medicine and Biology 33:6, 705-713
     CrossRef

107. 107

     Bala S. Balakumaran, Phillip G. Febbo. (2006) New Insights into Prostate Cancer Biology. Hematology/Oncology Clinics of North America 20:4, 773-796
     CrossRef

108. 108

     Xin Yuan, Tong Li, Hongyun Wang, Tao Zhang, Moumita Barua, Robert A. Borgesi, Glenn J. Bubley, Michael L. Lu, Steven P. Balk. (2006) Androgen Receptor Remains Critical for Cell-Cycle Progression in Androgen-Independent CWR22 Prostate Cancer Cells. The American Journal of Pathology 169:2, 682-696
     CrossRef

109. 109

     Tiina Pitkänen-Arsiola, J. Erin Tillman, Guangyu Gu, Jialing Yuan, Richard L. Roberts, Marcus Wantroba, Gerhard A. Coetzee, Michael S. Cookson, Susan Kasper. (2006) Androgen and anti-androgen treatment modulates androgen receptor activity and DJ-1 stability. The Prostate 66:11, 1177-1193
     CrossRef

110. 110

     Amir H. Shariff, M. Hammad Ather. (2006) Neuroendocrine differentiation in prostate cancer. Urology 68:1, 2-8
     CrossRef

111. 111

     Mei-Lan He, Hui-Qing Yuan, An-Li Jiang, Ai Yu Gong, Wei-Wen Chen, Peng-Ju Zhang, Charles Y. F. Young, Jian-Ye Zhang. (2006) Gum mastic inhibits the expression and function of the androgen receptor in prostate cancer cells. Cancer 106:12, 2547-2555
     CrossRef

112. 112

     T Kurisu, T Tanaka, J Ishii, K Matsumura, K Sugimura, T Nakatani, H Kawashima. (2006) Expression and function of human steroid receptor RNA activator in prostate cancer cells: role of endogenous hSRA protein in androgen receptor-mediated transcription. Prostate Cancer and Prostatic Diseases 9:2, 173-178
     CrossRef

113. 113

     Sandy Srinivas, Aruna V. Krishnan, Natalia Colocci, David Feldman. (2006) Phase II study evaluating oral triamcinolone in patients with androgen-independent prostate cancer. Urology 67:5, 1001-1006
     CrossRef

114. 114

     Karine Pereira de Jésus-Tran, Pierre-Luc Côté, Line Cantin, Jonathan Blanchet, Fernand Labrie, Rock Breton. (2006) Comparison of crystal structures of human androgen receptor ligand-binding domain complexed with various agonists reveals molecular determinants responsible for binding affinity. Protein Science 15:5, 987-999
     CrossRef

115. 115

     Randi L. Shand, Edward P. Gelmann. (2006) Molecular biology of prostate-cancer pathogenesis. Current Opinion in Urology 16:3, 123-131
     CrossRef

116. 116

     Shan-Zhong Yang, Isam A. Eltoum, Sarki A. Abdulkadir. (2006) Enhanced EGR1 activity promotes the growth of prostate cancer cells in an androgen-depleted environment. Journal of Cellular Biochemistry 97:6, 1292-1299
     CrossRef

117. 117

     Kohsuke Uchida, Naoya Masumori, Atsushi Takahashi, Naoki Itoh, Kazunori Kato, Robert J. Matusik, Taiji Tsukamoto. (2006) Murine androgen-independent neuroendocrine carcinoma promotes metastasis of human prostate cancer cell line LNCaP. The Prostate 66:5, 536-545
     CrossRef

118. 118

     Scott E. Eggener, Jeff A. Stern, Pankaj M. Jain, Shane Oram, Junkui Ai, Xiaoyan Cai, Kim A. Roehl, Zhou Wang. (2006) Enhancement of intermittent androgen ablation by “off-cycle” maintenance with finasteride in LNCaP prostate cancer xenograft model. The Prostate 66:5, 495-502
     CrossRef

119. 119

     Imtiaz A. Siddiqui, Vaqar M. Adhami, Mohammad Saleem, Hasan Mukhtar. (2006) Beneficial effects of tea and its polyphenols against prostate cancer. Molecular Nutrition & Food Research 50:2, 130-143
     CrossRef

120. 120

     Tomohiko Ichikawa, Hiroyoshi Suzuki, Takeshi Ueda, Akira Komiya, Takashi Imamoto, Satoko Kojima. (2005) Hormone treatment for prostate cancer: current issues and future directions. Cancer Chemotherapy and Pharmacology 56:S1, 58-63
     CrossRef

121. 121

     Mari Nakabayashi, Meredith M. Regan, Deborah Lifsey, Philip W. Kantoff, Mary-Ellen Taplin, Oliver Sartor, William K. Oh. (2005) Efficacy of nilutamide as secondary hormonal therapy in androgen-independent prostate cancer. BJU International 96:6, 783-786
     CrossRef

122. 122

     Sunita R Setlur, Mark A Rubin. (2005) Current Thoughts on the Role of the Androgen Receptor and Prostate Cancer Progression. Advances in Anatomic Pathology 12:5, 265-270
     CrossRef

123. 123

     Laura N. Glasscock, Sophie M. Réhault, Christopher W. Gregory, Scott T. Cooper, Tracy P. Jackson, Maureane Hoffman, Frank C. Church. (2005) Protein C inhibitor (plasminogen activator inhibitor-3) expression in the CWR22 prostate cancer xenograft. Experimental and Molecular Pathology 79:1, 23-32
     CrossRef

124. 124

     PHILIP M. ARLEN, JAMES L. GULLEY, NUSHIN TODD, RONALD LIEBERMAN, SETH M. STEINBERG, STEVE MORIN, ANNE BASTIAN, JENNIFER MARTE, KWONG-YOK TSANG, PATRICIA BEETHAM, DOUGLAS W. GROSENBACH, JEFFREY SCHLOM, WILLIAM DAHUT. (2005) ANTIANDROGEN, VACCINE AND COMBINATION THERAPY IN PATIENTS WITH NONMETASTATIC HORMONE REFRACTORY PROSTATE CANCER. The Journal of Urology 174:2, 539-546
     CrossRef

125. 125

     S BOTT, M ARYA, I SHERGILL, M WILLIAMSON. (2005) Molecular changes in prostatic cancer. Surgical Oncology 14:2, 91-104
     CrossRef

126. 126

     Michael J. Morris, Neeta Pandit-Taskar, Chaitanya Divgi, Steven Larson, Howard I. Scher. (2005) Targeting osseous metastases: rationale and development of radioimmunotherapy for prostate cancer. Current Urology Reports 6:3, 163-170
     CrossRef

127. 127

     Charles J. Ryan, Eric J. Small. (2005) Secondary hormonal manipulations in prostate cancer. Current Oncology Reports 7:3, 228-233
     CrossRef

128. 128

     Bernard Paule. (2005) Reappraisal of the Concept of Hormone Therapy in Metastatic Prostate Cancer and Implications for Treatment. European Urology 47:6, 729-735
     CrossRef

129. 129

     Guangchun Chen, Xiaohui Wang, Shimin Zhang, Ying Lu, Yinghao Sun, Jinshan Zhang, Zongbin Li, Jian Lu. (2005) Androgen receptor mutants detected in recurrent prostate cancer exhibit diverse functional characteristics. The Prostate 63:4, 395-406
     CrossRef

130. 130

     P FEBBO, M LOWENBERG, A THORNER, M BROWN, M LODA, T GOLUB. (2005) ANDROGEN MEDIATED REGULATION AND FUNCTIONAL IMPLICATIONS OF FKBP51 EXPRESSION IN PROSTATE CANCER. The Journal of Urology 173:5, 1772-1777
     CrossRef

131. 131

     Phillip G Febbo, Geoffrey S Ginsburg. (2005) Personalized diagnostic and therapeutic strategies in oncology. Personalized Medicine 2:2, 97-110
     CrossRef

132. 132

     Nushin F Todd, Ronald Lieberman, James L Gulley, William Dahut, Philip M Arlen. (2005) Prolonged Response to Nilutamide in a Patient with Stage D0.5 Prostate Cancer Who Previously Failed Androgen Deprivation Therapy. American Journal of Therapeutics 12:2, 172-174
     CrossRef

133. 133

     Arun S Singh, Cindy H Chau, Douglas K Price, William D Figg. (2005) Mechanisms of Disease: polymorphisms of androgen regulatory genes in the development of prostate cancer. Nature Clinical Practice Urology 2:2, 101-107
     CrossRef

134. 134

     Alan So, Martin Gleave, Antonio Hurtado-Col, Colleen Nelson. (2005) Mechanisms of the development of androgen independence in prostate cancer. World Journal of Urology 23:1, 1-9
     CrossRef

135. 135

     Susan Kasper. (2005) Survey of genetically engineered mouse models for prostate cancer: Analyzing the molecular basis of prostate cancer development, progression, and metastasis. Journal of Cellular Biochemistry 94:2, 279-297
     CrossRef

136. 136

     Scott M Dehm, Donald J Tindall. (2005) Regulation of androgen receptor signaling in prostate cancer. Expert Review of Anticancer Therapy 5:1, 63-74
     CrossRef

137. 137

     William G Nelson. (2004) Agents in development for prostate cancer prevention. Expert Opinion on Investigational Drugs 13:12, 1541-1554
     CrossRef

138. 138

     Hiroshi Miyamoto, Edward M. Messing, Chawnshang Chang. (2004) Androgen deprivation therapy for prostate cancer: Current status and future prospects. The Prostate 61:4, 332-353
     CrossRef

139. 139

     Marika J. Linja, Tapio Visakorpi. (2004) Alterations of androgen receptor in prostate cancer. The Journal of Steroid Biochemistry and Molecular Biology 92:4, 255-264
     CrossRef

140. 140

     Guilherme Kirjner Toscani, Eunice Martin Chaves, Fabola Lara Cervi, Marcelo Belmonte Tavares, Ilma Simoni Brum da Silva, Helena Eye Corleta, Edison Capp. (2004) Gene expression and tyrosine kinase activity of insulin receptor in uterine leiomyoma and matched myometrium. Archives of Gynecology and Obstetrics 270:3, 170-173
     CrossRef

141. 141

     Koh-ichi Nakashiro, Shingo Hara, Yuji Shinohara, Miho Oyasu, Hitoshi Kawamata, Satoru Shintani, Hiroyuki Hamakawa, Ryoichi Oyasu. (2004) Phenotypic Switch from Paracrine to Autocrine Role of Hepatocyte Growth Factor in an Androgen-Independent Human Prostatic Carcinoma Cell Line, CWR22R. The American Journal of Pathology 165:2, 533-540
     CrossRef

142. 142

     Jin-Rong Zhou, Lunyin Yu, Luiz F. Zerbini, Towia A. Libermann, George L. Blackburn. (2004) Progression to androgen-independent LNCaP human prostate tumors: Cellular and molecular alterations. International Journal of Cancer 110:6, 800-806
     CrossRef

143. 143

     Rile Li, Thomas Wheeler, Hong Dai, Anna Frolov, Timothy Thompson, Gustavo Ayala. (2004) High Level of Androgen Receptor Is Associated With Aggressive Clinicopathologic Features and Decreased Biochemical Recurrence-free Survival in Prostate. The American Journal of Surgical Pathology 28:7, 928-934
     CrossRef

144. 144

     K.C Balaji, Prema S Rao, David J Smith, Somaja Louis, Lynette M Smith, Simon Sherman, Dean Bacich, Denise O’Keefe. (2004) Microarray analysis of differential gene expression in androgen independent prostate cancer using a metastatic human prostate cancer cell line model. Urologic Oncology: Seminars and Original Investigations 22:4, 313-320
     CrossRef

145. 145

     Michael J. Morris, Neeta Pandit-Taskar, Chaitanya Divgi, Steven Larson, Howard I. Scher. (2004) Targeting osseous metastases: Rationale and development of radioimmunotherapy for prostate cancer. Current Oncology Reports 6:3, 222-229
     CrossRef

146. 146

     Kati P Porkka, Tapio Visakorpi. (2004) Molecular Mechanisms of Prostate Cancer. European Urology 45:6, 683-691
     CrossRef

147. 147

     Caroline D. Scatena, Mischa A. Hepner, Yoko A. Oei, Joan M. Dusich, Shang-Fan Yu, Tony Purchio, Pamela R. Contag, Darlene E. Jenkins. (2004) Imaging of bioluminescent LNCaP-luc-M6 Tumors: A new animal model for the study of metastatic human prostate cancer. The Prostate 59:3, 292-303
     CrossRef

148. 148

     Karl M Kasamon, Nancy A Dawson. (2004) Update on hormone-refractory prostate cancer. Current Opinion in Urology 14:3, 185-193
     CrossRef

149. 149

     Robert A. McPherson, Mark C. Conaway, Chris W. Gregory, Wei Yue, Richard J. Santen. (2004) The novel Ras antagonist, farnesylthiosalicylate, suppresses growth of prostate cancer in vitro. The Prostate 58:4, 325-334
     CrossRef

150. 150

     Mary-Ellen Taplin, Steven P. Balk. (2004) Androgen receptor: A key molecule in the progression of prostate cancer to hormone independence. Journal of Cellular Biochemistry 91:3, 483-190
     CrossRef

151. 151

     Angelo M. De Marzo, Theodore L. DeWeese, Elizabeth A. Platz, Alan K. Meeker, Masashi Nakayama, Jonathan I. Epstein, William B. Isaacs, William G. Nelson. (2004) Pathological and molecular mechanisms of prostate carcinogenesis: Implications for diagnosis, detection, prevention, and treatment. Journal of Cellular Biochemistry 91:3, 459-477
     CrossRef

152. 152

     SATOKO KOJIMA, HIROYOSHI SUZUKI, KOICHIRO AKAKURA, MASAKI SHIMBO, TOMOHIKO ICHIKAWA, HARUO ITO. (2004) Alternative Antiandrogens to Treat Prostate Cancer Relapse After Initial Hormone Therapy. The Journal of Urology 171:2, 679-683
     CrossRef

153. 153

     Hiroshi Miyamoto, Mujib M. Rahman, Chawnshang Chang. (2004) Molecular basis for the antiandrogen withdrawal syndrome. Journal of Cellular Biochemistry 91:1, 3-12
     CrossRef

154. 154

     Maureen E. Harper, Lindy Goddard, Christopher Smith, Robert I. Nicholson. (2004) Characterization of a transplantable hormone-responsive human prostatic cancer xenograft TEN12 and its androgen-resistant sublines. The Prostate 58:1, 13-22
     CrossRef

155. 155

     Charles J Ryan, Eric J Small. (2003) Role of secondary hormonal therapy in the management of recurrent prostate cancer. Urology 62, 87-94
     CrossRef

156. 156

     Hironori Ohtsu, Hideji Itokawa, Zhiyan Xiao, Ching-Yuan Su, Charles C.-Y Shih, Tzuying Chiang, Eugene Chang, YiFen Lee, Shang-Yi Chiu, Chawnshang Chang, Kuo-Hsiung Lee. (2003) Antitumor agents 222.††For Part 221, see ref 1. Synthesis and anti-androgen activity of new diarylheptanoids. Bioorganic & Medicinal Chemistry 11:23, 5083-5090
     CrossRef

157. 157

     Liu-Ying Luo, Linda Grass, Eleftherios P. Diamandis. (2003) Steroid hormone regulation of the human kallikrein 10 (KLK10) gene in cancer cell lines and functional characterization of the KLK10 gene promoter. Clinica Chimica Acta 337:1-2, 115-126
     CrossRef

158. 158

     Yasuhide Miyoshi, Hitoshi Ishiguro, Hiroji Uemura, Kiyoshi Fujinami, Hiroshi Miyamoto, Yoshiko Miyoshi, Hitoshi Kitamura, Yoshinobu Kubota. (2003) Expression of AR associated protein 55 (ARA55) and androgen receptor in prostate cancer. The Prostate 56:4, 280-286
     CrossRef

159. 159

     Isabel O. Oliveira, Cintia Lhullier, Ilma S. Brum, Poli Mara Spritzer. (2003) Gene expression of type 2 17β hydroxysteroid dehydrogenase in scalp hairs of hirsute women. Steroids 68:7-8, 641-649
     CrossRef

160. 160

     Nelson, William G., De Marzo, Angelo M., Isaacs, William B., . (2003) Prostate Cancer. New England Journal of Medicine 349:4, 366-381
     Full Text

161. 161

     Cynthia L Martel, Paul H Gumerlock, Frederick J Meyers, Primo N Lara. (2003) Current strategies in the management of hormone refractory prostate cancer. Cancer Treatment Reviews 29:3, 171-187
     CrossRef

162. 162

     Davide Tassinari, Francesca Fochessati, Ilaria Panzini, Barbara Poggi, Sergio Sartori, Alberto Ravaioli. (2003) Rapid Progression of Advanced “Hormone-Resistant” Prostate Cancer During Palliative Treatment with Progestins for Cancer Cachexia. Journal of Pain and Symptom Management 25:5, 481-484
     CrossRef

163. 163

     Peter Iversen. (2003) Current Topics in the Treatment of Hormone-Refractory Prostate Cancer. European Urology Supplements 2:3, 3-8
     CrossRef

164. 164

     &NA;. (2003) Androgen deprivation is the mainstay of treatment for advanced prostate cancer. Drugs & Therapy Perspectives 19:3, 16-19
     CrossRef

165. 165

     Cláudia M. Coutinho-Camillo, M. Mitzi Brentani, Ossamu Butugan, Humberto Torloni, Maria A. Nagai. (2003) Relaxation of Imprinting of IGFII gene in Juvenile Nasopharyngeal Angiofibromas. Diagnostic Molecular Pathology 12:1, 57-62
     CrossRef

166. 166

     Satoru Takahashi, Shugo Suzuki, Shingo Inaguma, Yoshihisa Ikeda, Young-Man Cho, Norio Hayashi, Takahiro Inoue, Yoshiki Sugimura, Naoki Nishiyama, Tamio Fujita, Julie Chao, Toshikazu Ushijima, Tomoyuki Shirai. (2003) Down-regulated expression of prostasin in high-grade or hormone-refractory human prostate cancers. The Prostate 54:3, 187-193
     CrossRef

167. 167

     Emma M.A Ball, Gail P Risbridger. (2003) New perspectives on growth factor-sex steroid interaction in the prostate. Cytokine & Growth Factor Reviews 14:1, 5-16
     CrossRef

168. 168

     Barbara Comuzzi, Leonidas Lambrinidis, Hermann Rogatsch, Sonia Godoy-Tundidor, Nikola Knezevic, Ivan Krhen, Zvonimir Marekovic, Georg Bartsch, Helmut Klocker, Alfred Hobisch, Zoran Culig. (2003) The Transcriptional Co-Activator cAMP Response Element-Binding Protein-Binding Protein Is Expressed in Prostate Cancer and Enhances Androgen- and Anti-Androgen-Induced Androgen Receptor Function. The American Journal of Pathology 162:1, 233-241
     CrossRef

169. 169

     Jose D Debes, Donald J Tindall. (2002) The role of androgens and the androgen receptor in prostate cancer. Cancer Letters 187:1-2, 1-7
     CrossRef

170. 170

     Cor A Berrevoets, Arzu Umar, Albert O Brinkmann. (2002) Antiandrogens: selective androgen receptor modulators. Molecular and Cellular Endocrinology 198:1-2, 97-103
     CrossRef

171. 171

     Matthew R. Smith, Donald Kaufman, Daniel George, William K. Oh, Maryanne Kazanis, Judith Manola, Philip W. Kantoff. (2002) Selective aromatase inhibition for patients with androgen-independent prostate carcinoma. Cancer 95:9, 1864-1868
     CrossRef

172. 172

     Daniel Sliva, Carlos Labarrere, Veronika Slivova, Miroslav Sedlak, Frank P Lloyd, Nancy W.Y Ho. (2002) Ganoderma lucidum suppresses motility of highly invasive breast and prostate cancer cells. Biochemical and Biophysical Research Communications 298:4, 603-612
     CrossRef

173. 173

     Ingo K Mellinghoff, Charles L Sawyers. (2002) The emergence of resistance to targeted cancer therapeutics. Pharmacogenomics 3:5, 603-623
     CrossRef

174. 174

     Steven P Balk. (2002) Androgen receptor as a target in androgen-independent prostate cancer. Urology 60:3, 132-138
     CrossRef

175. 175

     Karine Steketee, Leon Timmerman, Angelique C.J. Ziel-van der Made, Paul Doesburg, Albert O. Brinkmann, Jan Trapman. (2002) Broadened ligand responsiveness of androgen receptor mutants obtained by random amino acid substitution of H874 and mutation hot spot T877 in prostate cancer. International Journal of Cancer 100:3, 309-317
     CrossRef

176. 176

     Satoru Takahashi, Shingo Inaguma, Michihisa Sakakibara, Young-Man Cho, Shugo Suzuki, Yoshihisa Ikeda, Lin Cui, Tomoyuki Shirai. (2002) DNA methylation in the androgen receptor gene promoter region in rat prostate cancers. The Prostate 52:1, 82-88
     CrossRef

177. 177

     Satoru Takahashi, Shugo Suzuki, Shingo Inaguma, Yoshihisa Ikeda, Young-Man Cho, Naoki Nishiyama, Tamio Fujita, Takahiro Inoue, Takuichi Hioki, Yoshiki Sugimura, Toshikazu Ushijima, Tomoyuki Shirai. (2002) Down-regulation of human X-box binding protein 1 (hXBP-1) expression correlates with tumor progression in human prostate cancers. The Prostate 50:3, 154-161
     CrossRef

178. 178

     Joanne N. Davis, Omer Kucuk, Fazlul H. Sarkar. (2002) Expression of prostate-specific antigen is transcriptionally regulated by genistein in prostate cancer cells. Molecular Carcinogenesis 34:2, 91-101
     CrossRef

179. 179

     ANTONIO A. SINISI, PAOLO CHIEFFI, DANIELA PASQUALI, ANNAMARIA KISSLINGER, STEFANIA STAIBANO, ANTONIO BELLASTELLA, DONATELLA TRAMONTANO. (2002) EPN: A NOVEL EPITHELIAL CELL LINE DERIVED FROM HUMAN PROSTATE TISSUE. In Vitro Cellular & Developmental Biology - Animal 38:3, 165
     CrossRef

180. 180

     Samir S. Taneja, Susan Ha, Michael J. Garabedian. (2002) Androgen stimulated cellular proliferation in the human prostate cancer cell line LNCaP is associated with reduced retinoblastoma protein expression. Journal of Cellular Biochemistry 84:1, 188-200
     CrossRef

181. 181

     Apurva Desai, Walter M Stadler, Nicholas J Vogelzang. (2001) Nilutamide: possible utility as a second-line hormonal agent. Urology 58:6, 1016-1020
     CrossRef

182. 182

     Kyllikki Haapala, Eija-R Hyytinen, Mikko Roiha, Marita Laurila, Immo Rantala, Heikki J Helin, Pasi A Koivisto. (2001) Androgen Receptor Alterations in Prostate Cancer Relapsed during a Combined Androgen Blockade by Orchiectomy and Bicalutamide. Laboratory Investigation 81:12, 1647-1651
     CrossRef

183. 183

     Lucia Altucci, Hinrich Gronemeyer. (2001) Nuclear receptors in cell life and death. Trends in Endocrinology & Metabolism 12:10, 460-468
     CrossRef

184. 184

     M. E. Grossmann, H. Huang, D. J. Tindall. (2001) Androgen Receptor Signaling in Androgen-Refractory Prostate Cancer. JNCI Journal of the National Cancer Institute 93:22, 1687-1697
     CrossRef

185. 185

     Youssef A. Elhaji, Bruce Gottlieb, Rose Lumbroso, Lenore K. Beitel, William D. Foulkes, Leonard Pinsky, Mark A. Trifiro. (2001) The polymorphic CAG repeat of the androgen receptor gene: a potential role in breast cancer in women over 40. Breast Cancer Research and Treatment 70:2, 109-116
     CrossRef

186. 186

     Richard J. Santen, Gina R. Petroni, Michael J. Fisch, Charles E. Myers, Dan Theodorescu, Roger B. Cohen. (2001) Use of the aromatase inhibitor anastrozole in the treatment of patients with advanced prostate carcinoma. Cancer 92:8, 2095-2101
     CrossRef

187. 187

     Jeffrey S. Montgomery, Douglas K. Price, William D. Figg. (2001) The androgen receptor gene and its influence on the development and progression of prostate cancer. The Journal of Pathology 195:2, 138-146
     CrossRef

188. 188

     BERNHARD PLANZ, QIFA WANG, SANDRA D. KIRLEY, MICHAEL MARBERGER, W. SCOTT MCDOUGAL. (2001) REGULATION OF KERATINOCYTE GROWTH FACTOR RECEPTOR AND ANDROGEN RECEPTOR IN EPITHELIAL CELLS OF THE HUMAN PROSTATE. The Journal of Urology 166:2, 678-683
     CrossRef

189. 189

     Monika Schmelz, Anne E. Cress, Jean Barrera, Kathy M. McDaniel, Tracy L. Davis, Laura Fuchs, Bruce L. Dalkin, Raymond B. Nagle. (2001) PEAZ-1: A new human prostate neoplastic epithelial cell line. The Prostate 48:2, 79-92
     CrossRef

190. 190

     Michael Koutsilieris, Constantine S Mitsiades. (2001) Molecular biology and cellular physiology of refractoriness to androgen ablation therapy in advanced prostate cancer. Expert Opinion on Investigational Drugs 10:6, 1099-1115
     CrossRef

191. 191

     Sara S. Strom, Margaret R. Spitz, Yuko Yamamura, Richard J. Babaian, Peter T. Scardino, Qingyi Wei. (2001) Reduced expression ofhMSH2 andhMLH1 and risk of prostate cancer: A case-control study. The Prostate 47:4, 269-275
     CrossRef

192. 192

     Katherine A. Harris, Eric J. Small. (2001) Secondary hormonal manipulation of prostate cancer. Current Urology Reports 2:3, 224-230
     CrossRef

193. 193

     Bruce Gottlieb, Lenore K. Beitel, Mark A. Trifiro. (2001) Variable expressivity and mutation databases: The androgen receptor gene mutations database. Human Mutation 17:5, 382-388
     CrossRef

194. 194

     Alexandre Chlenski, Koh-ichi Nakashiro, Kathleen V. Ketels, Galina I. Korovaitseva, Ryoichi Oyasu. (2001) Androgen receptor expression in androgen-independent prostate cancer cell lines. The Prostate 47:1, 66-75
     CrossRef

195. 195

     Lars Brive, David B. Agus, Kathryn R. Ely. (2001) Structure-Based Androgen Receptor Gene Mutation Database: A Tool to Link Molecular Location and Receptor Function. The Prostate Journal 3:2, 76-91
     CrossRef

196. 196

     Glenn J. Bubley, Steven P. Balk, Robin M. Joyce, Mary-Ellen Taplin. (2001) Lack of Effect of Aminoglutethimide and Hydrocortisone Added to High-Dose Bicalutamide for Androgen-Independent Prostate Cancer. The Prostate Journal 3:2, 98-104
     CrossRef

197. 197

     D.M Avila, S Zoppi, M.J McPhaul. (2001) The androgen receptor (AR) in syndromes of androgen insensitivity and in prostate cancer. The Journal of Steroid Biochemistry and Molecular Biology 76:1-5, 135-142
     CrossRef

198. 198

     Bruce Gottlieb, Lenore K Beitel, Mark A Trifiro. (2001) Somatic mosaicism and variable expressivity. Trends in Genetics 17:2, 79-82
     CrossRef

199. 199

     Zoran Culig, Helmut Klocker, Georg Bartsch, Alfred Hobisch. (2001) Androgen Receptor Mutations in Carcinoma of the Prostate. American Journal of PharmacoGenomics 1:4, 241-249
     CrossRef

200. 200

     Jussi P Elo, Tapio Visakorpi. (2001) Molecular genetics of prostate cancer. Annals of Medicine 33:2, 130-141
     CrossRef

201. 201

     Katherine A. Harris, David M. Reese. (2001) Treatment Options in Hormone-Refractory Prostate Cancer. Drugs 61:15, 2177-2192
     CrossRef

202. 202

     Zoran Culig, Alfred Hobisch, Georg Bartsch, Helmut Klocker. (2000) Expression and function of androgen receptor in carcinoma of the prostate. Microscopy Research and Technique 51:5, 447-455
     CrossRef

203. 203

     Samir S. Taneja. (2000) EDITORIAL: MOLECULAR MARKERS OF CANCER PROGRESSION. READY OR NOT, HERE THEY COME. The Journal of Urology1996-1997
     CrossRef

204. 204

     Samir S. Taneja. (2000) EDITORIAL: MOLECULAR MARKERS OF CANCER PROGRESSION. READY OR NOT, HERE THEY COME. The Journal of Urology 164:6, 1996-1997
     CrossRef

205. 205

     Dmitry N. Grigoryev, Brian J. Long, Vincent C.O. Njar, Angela H.M. Brodie. (2000) Pregnenolone stimulates LNCaP prostate cancer cell growth via the mutated androgen receptor. The Journal of Steroid Biochemistry and Molecular Biology 75:1, 1-10
     CrossRef

206. 206

     V.J. Gnanapragasam, C.N. Robson, H.Y. Leung, D.E. Neal. (2000) Androgen receptor signalling in the prostate. BJU International 86:9, 1001-1013
     CrossRef

207. 207

     Tsuyoshi Nakayama, Masatoshi Watanabe, Hiroyoshi Suzuki, Minoru Toyota, Nobuyuki Sekita, Yoshifumi Hirokawa, Atsushi Mizokami, Haruo Ito, Ryuichi Yatani, Taizo Shiraishi. (2000) Epigenetic Regulation of Androgen Receptor Gene Expression in Human Prostate Cancers. Laboratory Investigation 80:12, 1789-1796
     CrossRef

208. 208

     Tomasz Beer, Derek Raghavan. (2000) Chemotherapy for hormone-refractory prostate cancer: Beauty is in the eye of the beholder. The Prostate 45:2, 184-193
     CrossRef

209. 209

     Akihide Fujimoto, Minoru Takata, Naohito Hatta, Kazuhiko Takehara. (2000) Expression of Structurally Unaltered Androgen Receptor in Extramammary Paget's Disease. Laboratory Investigation 80:9, 1465-1471
     CrossRef

210. 210

     A. Yamamoto, Y. Hashimoto, K. Kohri, E. Ogata, S.-a. Kato, K. Ikeda, M. Nakanishi. (2000) Cyclin E as a Coactivator of the Androgen Receptor. The Journal of Cell Biology 150:4, 873-880
     CrossRef

211. 211

     MENACHEM LAUFER, SAMUEL R. DENMEADE, VICTORIA J. SINIBALDI, MICHAEL A. CARDUCCI, MARIO A. EISENBERGER. (2000) COMPLETE ANDROGEN BLOCKADE FOR PROSTATE CANCER: WHAT WENT WRONG?. The Journal of Urology 164:1, 3-9
     CrossRef

212. 212

     Alfred Hobisch, Hermann Rogatsch, Anton Hittmair, Dietmar Fuchs, Georg Bartsch, Helmut Klocker, Georg Bartsch, Zoran Culig. (2000) Immunohistochemical localization of interleukin-6 and its receptor in benign, premalignant and malignant prostate tissue. The Journal of Pathology 191:3, 239-244
     CrossRef

213. 213

     MENACHEM LAUFER, SAMUEL R. DENMEADE, VICTORIA J. SINIBALDI, MICHAEL A. CARDUCCI, MARIO A. EISENBERGER. (2000) COMPLETE ANDROGEN BLOCKADE FOR PROSTATE CANCER: WHAT WENT WRONG?. The Journal of Urology3-9
     CrossRef

214. 214

     David M. Reese, Eric J. Small. (2000) Therapy of Advanced Prostate Cancer: Part I: Antiandrogen Withdrawal, Androgen Receptor Mutations, and Secondary Hormonal Manipulations. The Prostate Journal 2:3, 116-122
     CrossRef

215. 215

     MARCO MARCELLI, T.C. SHAO, GLENN R. CUNNINGHAM. (2000) Endocrinology of Benign and Malignant Prostate Disease in Aging. Journal of Anti-Aging Medicine 3:2, 191-200
     CrossRef

216. 216

     Steve Horvath, Nan M. Laird, Michael Knapp. (2000) The Transmission/Disequilibrium Test and Parental-Genotype Reconstruction for X-Chromosomal Markers. The American Journal of Human Genetics 66:3, 1161-1167
     CrossRef

217. 217

     Jason F. Kelly, Alan Pollack, Gunar K. Zagars. (2000) Serum testosterone is not a correlate of prostate cancer lymph node involvement, but does predict biochemical failure for lymph node positive disease. Urologic Oncology: Seminars and Original Investigations 5:2, 78-84
     CrossRef

218. 218

     Nancy A. Dawson, Mark Conaway, Susan Halabi, Eric P. Winer, Eric J. Small, Diana Lake, Nicholas J. Vogelzang. (2000) A randomized study comparing standard versus moderately high dose megestrol acetate for patients with advanced prostate carcinoma. Cancer 88:4, 825-834
     CrossRef

219. 219

     Angeliki Magklara, Linda Grass, Eleftherios P. Diamandis. (2000) Differential steroid hormone regulation of human glandular kallikrein (hK2) and prostate-specific antigen (PSA) in breast cancer cell lines. Breast Cancer Research and Treatment 59:3, 263-270
     CrossRef

220. 220

     Tapio Visakorpi. (2000) The androgen receptor as a therapeutic target in prostate cancer. Expert Opinion on Therapeutic Targets 4:1, 65-71
     CrossRef

221. 221

     Eu Leong Yong, Joyce Lim, Wang Qi, Victor Ong, Amparo Mifsud. (2000) Molecular basis of androgen receptor diseases. Annals of Medicine 32:1, 15-22
     CrossRef

222. 222

     Hiroshi Miyamoto and Chawnshang Chang. (2000) Antiandrogens fail to block androstenedione-mediated mutated androgen receptor transactivation in human prostate cancer cells. International Journal of Urology 7:1, 32-34
     CrossRef

223. 223

     Bruce Gottlieb, Leonard Pinsky, Lenore K. Beitel, Mark Trifiro. (1999) Androgen insensitivity. American Journal of Medical Genetics 89:4, 210-217
     CrossRef

224. 224

     P Lara. (1999) Molecular biology of prostate carcinogenesis. Critical Reviews in Oncology/Hematology 32:3, 197-208
     CrossRef

225. 225

     Mika J. Walln, Marika Linja, Kaius Kaartinen, Johanna Schleutker, Tapio Visakorpi. (1999) Androgen receptor gene mutations in hormone-refractory prostate cancer. The Journal of Pathology 189:4, 559-563
     CrossRef

226. 226

     Bernhard Planz, H. Thomas Aretz, QiFa Wang, Shahin Tabatabaei, Sandra D. Kirley, Chi-Wei Lin, W. Scott McDougal. (1999) Immunolocalization of the keratinocyte growth factor in benign and neoplastic human prostate and its relation to androgen receptor. The Prostate 41:4, 233-242
     CrossRef

227. 227

     Menachem Laufer, Victoria J Sinibaldi, Michael A Carducci, Mario A Eisenberger. (1999) Rapid disease progression after the administration of bicalutamide in patients with metastatic prostate cancer. Urology 54:4, 745
     CrossRef

228. 228

     Andreas Chott, Zijie Sun, Daniel Morganstern, Jing Pan, Tong Li, Martin Susani, Isabella Mosberger, Melissa P. Upton, Glenn J. Bubley, Steven P. Balk. (1999) Tyrosine Kinases Expressed in Vivo by Human Prostate Cancer Bone Marrow Metastases and Loss of the Type 1 Insulin-Like Growth Factor Receptor. The American Journal of Pathology 155:4, 1271-1279
     CrossRef

229. 229

     Katsuyuki Kuratsukuri, Kazunobu Sugimura, Kouji Harimoto, Hidenori Kawashima, Taketoshi Kishimoto. (1999) ?Decoy? of androgen-responsive element induces apoptosis in LNCaP cells. The Prostate 41:2, 121-126
     CrossRef

230. 230

     Z Culig, J Hoffmann, M Erdel, I E Eder, A Hobisch, A Hittmair, G Bartsch, G Utermann, M R Schneider, K Parczyk, H Klocker. (1999) Switch from antagonist to agonist of the androgen receptor blocker bicalutamide is associated with prostate tumour progression in a new model system. British Journal of Cancer 81:2, 242-251
     CrossRef

231. 231

     Zijie Sun, Jing Pan, WeiQiao Xie Hope, Stanley N. Cohen, Steven P. Balk. (1999) Tumor susceptibility gene 101 protein represses androgen receptor transactivation and interacts with p300. Cancer 86:4, 689-696
     CrossRef

232. 232

     P.J. Russell, S. Bennett, A. Joshua, Y. Yu, S.R. Downing, M.A. Hill, E.A. Kingsley, R.S. Mason, J. Berry. (1999) Elevated expression of FGF-2 does not cause prostate cancer progression in LNCaP cells. The Prostate 40:1, 1-13
     CrossRef

233. 233

     Helmut Rohrbach, Christian J. Haas, Gustavo B. Baretton, Astrid Hirschmann, Joachim Diebold, Ralf-Peter Behrendt, Udo Lhrs. (1999) Microsatellite instability and loss of heterozygosity in prostatic carcinomas: Comparison of primary tumors, and of corresponding recurrences after androgen-deprivation therapy and lymph-node metastases. The Prostate 40:1, 20-27
     CrossRef

234. 234

     Min Gao, Liliana Ossowski, Anna C. Ferrari. (1999) Activation of Rb and decline in androgen receptor protein precede retinoic acid-induced apoptosis in androgen-dependent LNCaP cells and their androgen-independent derivative. Journal of Cellular Physiology 179:3, 336-346
     CrossRef

235. 235

     Long G. Wang, Xiao M. Liu, Willi Kreis, Daniel R. Budman. (1999) Phosphorylation/Dephosphorylation of Androgen Receptor as a Determinant of Androgen Agonistic or Antagonistic Activity. Biochemical and Biophysical Research Communications 259:1, 21-28
     CrossRef

236. 236

     David M. Reese, Eric J. Small. (1999) SECONDARY HORMONAL MANIPULATIONS IN HORMONE REFRACTORY PROSTATE CANCER. Urologic Clinics of North America 26:2, 311-321
     CrossRef

237. 237

     NORA M. NAVONE, MICHAEL E. LABATE, PATRICIA TRONCOSO, LOUIS L. PISTERS, CLAUDIO J. CONTI, ANDREW C. VON ESCHENBACH, CHRISTOPHER J. LOGOTHETIS. (1999) p53 MUTATIONS IN PROSTATE CANCER BONE METASTASES SUGGEST THAT SELECTED p53 MUTANTS IN THE PRIMARY SITE DEFINE FOCI WITH METASTATIC POTENTIAL. The Journal of Urology304-308
     CrossRef

238. 238

     NORA M. NAVONE, MICHAEL E. LABATE, PATRICIA TRONCOSO, LOUIS L. PISTERS, CLAUDIO J. CONTI, ANDREW C. VON ESCHENBACH, CHRISTOPHER J. LOGOTHETIS. (1999) p53 MUTATIONS IN PROSTATE CANCER BONE METASTASES SUGGEST THAT SELECTED p53 MUTANTS IN THE PRIMARY SITE DEFINE FOCI WITH METASTATIC POTENTIAL. The Journal of Urology 161:1, 304-308
     CrossRef

239. 239

     Bruce Gottlieb, Lenore K. Beitel, Rose Lumbroso, Leonard Pinsky, Mark Trifiro. (1999) Update of the androgen receptor gene mutations database. Human Mutation 14:2, 103-114
     CrossRef

240. 240

     WILLIAM K. OH, PHILIP W. KANTOFF. (1998) MANAGEMENT OF HORMONE REFRACTORY PROSTATE CANCER. The Journal of Urology1220-1229
     CrossRef

241. 241

     Richard A Hiipakka, Shutsung Liao. (1998) Molecular Mechanism of Androgen Action. Trends in Endocrinology & Metabolism 9:8, 317-324
     CrossRef

242. 242

     WILLIAM K. OH, PHILIP W. KANTOFF. (1998) MANAGEMENT OF HORMONE REFRACTORY PROSTATE CANCER: CURRENT STANDARDS AND FUTURE PROSPECTS. The Journal of Urology 160:4, 1220-1229
     CrossRef

243. 243

     Srinivas N. Pentyala, Terry C. Whyard, Wayne C. Waltzer, Alan G. Meek, Yaacov Hod. (1998) Androgen induction of urokinase gene expression in LNCaP cells is dependent on their interaction with the extracellular matrix. Cancer Letters 130:1-2, 121-126
     CrossRef

244. 244

     A.J. Dowling, I.F. Tannock. (1998) Systemic treatment for prostate cancer. Cancer Treatment Reviews 24:4, 283-301
     CrossRef

245. 245

     Carlos Reyes-Moreno, Antigone Sourla, Isabelle Chpki, Charles Doillon, Michael Koutsilieris. (1998) Osteoblast-derived survival factors protect PC-3 human prostate cancer cells from adriamycin apoptosis. Urology 52:2, 341-347
     CrossRef

246. 246

     Nina N. Nupponen, Laura Kakkola, Pasi Koivisto, Tapio Visakorpi. (1998) Genetic Alterations in Hormone-Refractory Recurrent Prostate Carcinomas. The American Journal of Pathology 153:1, 141-148
     CrossRef

247. 247

     J. Armstrong. (1998) The current status of adjuvant hormonal therapy combined with radiation therapy for localised prostate cancer. Irish Journal of Medical Science 167:3, 138-144
     CrossRef

248. 248

     L Wang. (1998) Androgen Antagonistic Effect of Estramustine Phosphate (EMP) Metabolites on Wild-Type and Mutated Androgen Receptor. Biochemical Pharmacology 55:9, 1427-1433
     CrossRef

249. 249

     Zoran Culig, Alfred Hobisch, Anton Hittmair, Heike Peterziel, Andrew C.B. Cato, Georg Bartsch, Helmut Klocker. (1998) Expression, structure, and function of androgen receptor in advanced prostatic carcinoma. The Prostate 35:1, 63-70
     CrossRef

250. 250

     J.K. Richer, C.A. Lange, A.M. Wierman, K.M. Brooks, L. Tung, G.S. Takimoto, K.B. Horwitz. (1998) Progesterone receptor variants found in breast cells repress transcription by wild-type receptors. Breast Cancer Research and Treatment 48:3, 231-241
     CrossRef

251. 251

     Yoshihisa Umekita, Yoshiatsu Sagara, Hiroki Yoshida. (1998) Estrogen Receptor Mutations and Changes in Estrogen Receptor and Progesterone Receptor Protein Expression in Metastatic or Recurrent Breast Cancer. Cancer Science 89:1, 27-32
     CrossRef

252. 252

     Christos N. Papandreou, Badar Usmani, Yiping Geng, Thomas Bogenrieder, Ronald Freeman, Sherwin Wilk, Connie L. Finstad, Victor E. Reuter, C. Thomas Powell, David Scheinberg, Catherine Magill, Howard I. Scher, Anthony P. Albino, David M. Nanus. (1998) Neutral endopeptidase 24.11 loss in metastatic human prostate cancer contributes to androgen-independent progression. Nature Medicine 4:1, 50-57
     CrossRef

253. 253

     Robin Joyce, Mary Anne Fenton, Paola Rode, Michael Constantine, Lisa Gaynes, Geert Kolvenbag, William DeWolf, Steve Balk, Mary Ellen Taplin, Glenn J. Bubley. (1998) HIGH DOSE BICALUTAMIDE FOR ANDROGEN INDEPENDENT PROSTATE CANCER: EFFECT OF PRIOR HORMONAL THERAPY. The Journal of Urology 159:1, 149-153
     CrossRef

254. 254

     Stephan Tenbaum, Aria Baniahmad. (1997) Nuclear receptors: Structure, function and involvement in disease. The International Journal of Biochemistry & Cell Biology 29:12, 1325-1341
     CrossRef

255. 255

     Noboru Konishi, Niasaki Cho, Kunichika Yamamoto, Yoshio Hiasa. (1997) Genetic changes in prostate cancer. Pathology International 47:11, 735-747
     CrossRef

256. 256

     Eric J. Small, Ari Baron, Robert Bok. (1997) Simultaneous antiandrogen withdrawal and treatment with ketoconazole and hydrocortisone in patients with advanced prostate carcinoma. Cancer 80:9, 1755-1759
     CrossRef

257. 257

     X Zhu, J.-P Liu. (1997) Steroid-independent activation of androgen receptor in androgen-independent prostate cancer. Molecular and Cellular Endocrinology 134:1, 9-14
     CrossRef

258. 258

     Tarek W. Wehbe, Barry S. Stein, Wallace L. Akerley. (1997) Prostate-Specific Antigen Response to Withdrawal of Megestrol Acetate in a Patient With Hormone-Refractory Prostate Cancer. Mayo Clinic Proceedings 72:10, 932-934
     CrossRef

259. 259

     G Coutant, J.P. Algayres, M.L. Dordain, F Selle, P.Y. Le Berruyer, H Bili, J.P. Daly. (1997) Syndrome d'arrêt des anti-androgènes lors de l'échappement au traitement hormonal du cancer de la prostate métastatique. La Revue de Médecine Interne 18:9, 732-734
     CrossRef

260. 260

     Carl W. Miller, Roberta Morosetti, Moray J. Campbell, Susana Mendoza, H. Phillip Koeffler. (1997) Integrity of the 1,25-dihydroxyvitamin D3 receptor in bone, lung, and other cancers. Molecular Carcinogenesis 19:4, 254-257
     CrossRef

261. 261

     Alfred Hobisch, Anton Hittmair, Günter Daxenbichler, Stefan Wille, Christian Radmayr, Petra Hobisch-Hagen, Georg Bartsch, Helmut Klocker, Zoran Culig. (1997) Metastatic lesions from prostate cancer do not express oestrogen and progesterone receptors. The Journal of Pathology 182:3, 356-361
     CrossRef

262. 262

     EL Yong, Q Wang, TG Tut, FJ Ghadessy, SC Ng. (1997) Male infertility and the androgen receptor: molecular, clinical and therapeutic aspects. Reproductive Medicine Review 6:02, 113
     CrossRef

263. 263

     Zoran Culig, Alfred Hobisch, Anton Hittmair, Marcus V. Cronauer, Christian Radmayr, Ju Zhang, Georg Bartsch, Helmut Klocker. (1997) Synergistic activation of androgen receptor by androgen and luteinizing hormone-releasing hormone in prostatic carcinoma cells. The Prostate 32:2, 106-114
     CrossRef

264. 264

     William D. Figg, Glenn Kroog, Paul Duray, McClellan M. Walther, Nicholas Patronas, Oliver Sartor, Eddie Reed. (1997) Flutamide withdrawal plus hydrocortisone resulted in clinical complete response in a patient with prostate carcinoma. Cancer 79:10, 1964-1968
     CrossRef

265. 265

     Wm. Kevin Kelly, Susan Slovin, Howard I. Scher. (1997) STEROID HORMONE WITHDRAWAL SYNDROMES. Urologic Clinics of North America 24:2, 421-431
     CrossRef

266. 266

     Eric J. Small, Ari D. Baron, Linda Fippin, Dan Apodaca. (1997) Ketoconazole Retains Activity in Advanced Prostate Cancer Patients with Progression Despite Flutamide Withdrawal. The Journal of Urology1204-1207
     CrossRef

267. 267

     Karen A. Klein, Robert E. Reiter, James Redula, Hamid Moradi, Xaio Lin Zhu, Arthur R. Brothman, Dolores J. Lamb, Marco Marcelli, Arie Belldegrun, Owen N. Witte, Charles L. Sawyers. (1997) Progression of metastatic human prostate cancer to androgen independence in immunodeficient SCID mice. Nature Medicine 3:4, 402-408
     CrossRef

268. 268

     Eric J. Small, Ari D. Baron, Linda Fippin, Dan Apodaca. (1997) Ketoconazole Retains Activity in Advanced Prostate Cancer Patients with Progression Despite Flutamide Withdrawal. The Journal of Urology 157:4, 1204-1207
     CrossRef

269. 269

     Marc B. Garnick. (1997) Hormonal therapy in the management of prostate cancer: From Huggins to the present. Urology 49:3, 5-15
     CrossRef

270. 270

     Shuyuan Yeh, Hiroshi Miyamoto, Chawnshang Chang. (1997) Hydroxyflutamide may not always be a pure antiandrogen. The Lancet 349:9055, 852-853
     CrossRef

271. 271

     Yoichi Arai, Tatsuhiro Yoshiki, Osamu Yoshida. (1997) c-erbB-2 oncoprotein: A potential biomarker of advanced prostate cancer. The Prostate 30:3, 195-201
     CrossRef

272. 272

     Timothy J. McDonnel, Nora M. Navone, Patricia Troncoso, Louis L. Pisters, Claudio Conti, Andrew C. von Eschenbach, Shawn Brisbay, Christopher J. Logothetis. (1997) Expression of BCL-2 Oncoprotein and P53 Protein Accumulation in Bone Marrow Metastases of Androgen Independent Prostate Cancer. The Journal of Urology 157:2, 569-574
     CrossRef

273. 273

     Timothy J. McDonnel, Nora M. Navone, Patricia Troncoso, Louis L. Pisters, Claudio Conti, Andrew C. von Eschenbach, Shawn Brisbay, Christopher J. Logothetis. (1997) Expression of BCL-2 Oncoprotein and P53 Protein Accumulation in Bone Marrow Metastases of Androgen Independent Prostate Cancer. The Journal of Urology569-574
     CrossRef

274. 274

     Christoph A. Meier. (1997) Minireview: Regulation of Gene Expression by Nuclear Hormone Receptors. Journal of Receptors and Signal Transduction 17:1-3, 319-335
     CrossRef

275. 275

     M. P. Wirth, S. E. Froschermaier. (1997) The antiandrogen withdrawal syndrome. Urological Research 25:S2, S67-S71
     CrossRef

276. 276

     T. M. Reijke. (1997) Intermittent androgen deprivation in advanced prostate cancer. Urological Research 25:S2, S63-S66
     CrossRef

277. 277

     Richard J. Santen, Alain Thibault, Charles Myers, Leland Chung. (1997) Meeting summary: Workshop conference on endocrine therapy of advanced prostate cancer, airlie house, November 3–4, 1996. Urologic Oncology: Seminars and Original Investigations 3:1, 31-38
     CrossRef

278. 278

     Lidia Averboukh, Peng Liang, Philip W. Kantoff, Arthur B. Pardee. (1996) Regulation of S100P expression by androgen. The Prostate 29:6, 350-355
     CrossRef

279. 279

     Kenneth J. Pienta, Jo Ann Goodson, Peggy S. Esper. (1996) Epidemiology of prostate cancer: molecular and environmental clues. Urology 48:5, 676-683
     CrossRef

280. 280

     David G. Bostwick, Anna Pacelli, Antonio Lopez-Beltran. (1996) Molecular biology of prostatic intraepithelial neoplasia. The Prostate 29:2, 117-134
     CrossRef

281. 281

     Jon A. Kemppainen, Elizabeth M. Wilson. (1996) Agonist and antagonist activities of hydroxyflutamide and casodex relate to androgen receptor stabilization. Urology 48:1, 157-163
     CrossRef

282. 282

     Karsten Parczyk, Martin R. Schneider. (1996) The future of antihormone therapy: innovations based on an established principle. Journal of Cancer Research and Clinical Oncology 122:7, 383-396
     CrossRef

283. 283

     Glenn J. Bubley, Steven P. Balk. (1996) TREATMENT OF METASTATIC PROSTATE CANCER. Hematology/Oncology Clinics of North America 10:3, 713-725
     CrossRef

284. 284

     J. E. Fowler, P. Pandey, L. E. Seaver, T. P. Feliz. (1996) In Reply. The Journal of Urology1705
     CrossRef

285. 285

     J.E. Fowler, P. Pandey, L.E. Seaver, T.P. Feliz. (1996) In Reply: Prostate Specific Antigen after Gonadal Androgen Withdrawal and Deferred Flutamide Treatment. The Journal of Urology 155:5, 1705
     CrossRef

286. 286

     Matthew N. Middleman, Richard M. Lush, Oliver Sartor, Eddie Reed, William D. Figg. (1996) Treatment approaches for metastatic cancer of the prostate based on recent molecular evidence. Cancer Treatment Reviews 22:2, 105-118
     CrossRef

287. 287

     Kenneth V. Honn, Amer Aref, Yong Q. Chen, Michael L. Cher, John D. Crissman, Jeffrey D. Forman, Xiang Gao, David Grignon, Maha Hussain, Arthur T. Porter, J. Edson Pontes, Isaac Powell, Bruce Redman, Wael Sakr, Richard Severson, Dean G. Tang, David P. Wood. (1996) Prostate cancer old problems and new approaches. Pathology & Oncology Research 2:1-2, 98-109
     CrossRef

288. 288

     Gail S. Prins, Myeong H. Jung, Robert L. Vellanoweth, Bandana Chatterjee, Arun K. Roy. (1996) Age-dependent expression of the androgen receptor gene in the prostate and its implication in glandular differentiation and hyperplasia. Developmental Genetics 18:2, 99-106
     CrossRef

289. 289

     J. Trapman, A.O. Brinkmann. (1996) The Androgen Receptor in Prostate Cancer. Pathology - Research and Practice 192:7, 752-760
     CrossRef

290. 290

     Howard I. Scher, Zuo Feng Zhang, David Nanus, William Kevin Kelly. (1996) Hormone and antihormone withdrawal: implications for the management of androgen-independent prostate cancer. Urology 47:1, 61-69
     CrossRef

291. 291

     E. David Crawford, Edward P. DeAntoni, Colleen A. Ross. (1996) The role of prostate-specific antigen in the chemoprevention of prostate cancer. Journal of Cellular Biochemistry 63:S25, 149-155
     CrossRef

292. 292

     William D. Figg, Nancy Dawson, Matthew N. Middleman, Otis Brawley, Richard M. Lush, Adrian Senderowicz, Seth H. Steinberg, Anne Tompkins, Eddie Reed, Oliver Sartor. (1996) Flutamide Withdrawal and Concomitant Initiation of Aminoglutethimide in Patients with Hormone Refractory Prostate Cancer. Acta Oncologica 35:6, 763-765
     CrossRef

293. 293

     (1995) Mutated Androgen Receptors of Prostate-Cancer Cells. New England Journal of Medicine 333:15, 1010-1011
     Full Text

294. 294

     Sophie Sun, Steven A. Narod, Arman Aprikian, Parviz Ghadirian, Fernand Labrie. (1995) Androgen receptor and familial prostate cancer. Nature Medicine 1:9, 848-849
     CrossRef

295. 295

     Wilson, Jean D., . (1995) The Promiscuous Receptor — Prostate Cancer Comes of Age. New England Journal of Medicine 332:21, 1440-1441
     Full Text

Letters