Original Article
Detection of Herpesvirus-Like DNA Sequences in Kaposi's Sarcoma in Patients with and Those without HIV Infection
N Engl J Med 1995; 332:1181-1185May 4, 1995
- Abstract
Background
Herpesvirus-like DNA sequences have recently been found in lesions from patients with Kaposi's sarcoma and the acquired immunodeficiency syndrome (AIDS). It is not known whether these sequences are also present in classic Kaposi's sarcoma or in the Kaposi's sarcoma that occurs in homosexual men who are seronegative for the human immunodeficiency virus (HIV).
Methods
We analyzed DNA in tissue samples from patients with AIDS-associated Kaposi's sarcoma, patients with classic Kaposi's sarcoma, and HIV-seronegative homosexual men with Kaposi's sarcoma. We also analyzed DNA in samples of uninvolved tissue from these patients and in control tissue from healthy subjects. All samples were tested blindly by polymerase chain reaction (PCR) with specific primers to amplify KS330233, a herpesvirus-like DNA sequence.
Results
The KS330233 PCR product was found in 20 of 21 tissue samples (95 percent) from the patients with Kaposi's sarcoma, including 10 of the 11 samples from the patients with AIDS-associated Kaposi's sarcoma, all 6 samples from the patients with classic Kaposi's sarcoma, and all 4 samples from the HIV-negative homosexual men with Kaposi's sarcoma. Only 1 of the 21 control samples (5 percent) was positive (odds ratio, 400; 95 percent confidence interval, 19 to 17,300). Of the 14 samples of uninvolved skin from the patients with Kaposi's sarcoma, 3 were positive for KS330233. Representative PCR-product sequences were more than 98 percent identical for the three types of Kaposi's sarcoma, suggesting that all three are caused by the same agent.
Conclusions
The same herpesvirus-like DNA sequences are present in AIDS-associated Kaposi's sarcoma, classic Kaposi's sarcoma, and the Kaposi's sarcoma that occurs in HIV-negative homosexual men. Therefore, this presumably new human herpesvirus is not solely an opportunistic infection in patients with AIDS, and the three forms of Kaposi's sarcoma may be caused by the same infectious agent.
Media in This Article
Figure 2
DNA Sequences for KS330233 PCR Products Amplified from Tissue Samples Obtained from Seven Patients with Kaposi's Sarcoma.Figure 1
Example of KS330233 PCR Amplifications from the First Batch of Tissue Samples from Patients with Kaposi's Sarcoma and Controls.Article Activity
- Article
Kaposi's sarcoma is the most common neoplasm in patients with the acquired immunodeficiency syndrome (AIDS),1 and in some cohorts of homosexual men with AIDS, the lifetime risk of Kaposi's sarcoma approaches 50 percent.2 Epidemiologic evidence suggests an infectious cause of AIDS-associated Kaposi's sarcoma.3 Surveillance data indicate that Kaposi's sarcoma is roughly 20 times more likely to develop in patients with AIDS who are homosexual or bisexual than in those who have hemophilia.1,4 Among homosexual men with AIDS, the risk of Kaposi's sarcoma is associated with specific sexual practices5 and geographic locations.4,6
Histopathologically similar forms of Kaposi's sarcoma also occur in people who are seronegative for the human immunodeficiency virus (HIV). The classic form is an indolent sarcoma that usually occurs on the lower extremities,7 most often in elderly men of Mediterranean, Middle Eastern, or Eastern European ethnic origin.8 Evidence that classic Kaposi's sarcoma may have an infectious cause comes from studies in Sweden indicating an upsurge in cases of classic Kaposi's sarcoma in the 1970s, before the AIDS epidemic.9 Serologic studies suggest that this form of Kaposi's sarcoma may be associated with cytomegalovirus infection.10,11
The frequency of Kaposi's sarcoma in HIV-negative homosexual men is higher than expected, supporting the hypothesis that the etiologic agent can be sexually transmitted and is distinct from HIV type 1.12 In HIV-seronegative homosexual men with Kaposi's sarcoma, there is no detectable immunodeficiency and the tumor resembles classic Kaposi's sarcoma in its presentation and clinical course (unpublished data). Endemic Kaposi's sarcoma in Africa13,14 and post-transplantation Kaposi's sarcoma15 are additional forms that occur in immunocompetent and immunocompromised persons, respectively.
Chang et al.16 used representational difference analysis17 to identify unique DNA sequences associated with Kaposi's sarcoma in patients with AIDS. These DNA sequences were shown to be of nonhuman origin and closely homologous to minor capsid and tegument protein genes of the gammaherpesviruses, Epstein–Barr virus, and herpesvirus saimiri. A polymerase-chain-reaction (PCR) primer set amplifying a sequence of 233 base pairs (bp), designated KS330233, identified these herpesvirus-like sequences in all 25 tissue specimens from patients with AIDS-associated Kaposi's sarcoma that were both amplifiable and histologically confirmed. In addition, these sequences have been found in specimens of involved tissue from patients with AIDS and body-cavity–based lymphomas16,18 but not in most samples of uninvolved tissue from these patients and not in tissue from patients without AIDS.
Although these findings suggest that a new human herpesvirus is the cause of AIDS-associated Kaposi's sarcoma, it is possible that this agent preferentially colonizes preexisting Kaposi's sarcoma in immunosuppressed patients and does not have an etiologic role.16 To determine whether these herpesvirus-like DNA sequences are also present in lesions from immunocompetent persons with Kaposi's sarcoma, we performed a randomized, blind evaluation to determine the presence of the sequences in tissue samples from patients with AIDS-associated Kaposi's sarcoma, patients with classic Kaposi's sarcoma, and HIV-seronegative homosexual men with Kaposi's sarcoma.
Methods
Patient Enrollment
Patients with AIDS-associated Kaposi's sarcoma, patients with classic Kaposi's sarcoma, and HIV-seronegative homosexual men with Kaposi's sarcoma seen in a private practice in New York City were enrolled in the study. All patients provided informed consent to participate in the study and were tested to determine their HIV serologic status. Tissue specimens were collected during routine clinical examinations. Data on demographic characteristics and risk factors were collected at the time of enrollment. The diagnosis of Kaposi's sarcoma was confirmed by histopathological examination. The serologic status of the HIV-seronegative homosexual patients was confirmed by repeated enzyme-linked immunoassays and Western blot tests at the time of the diagnosis of Kaposi's sarcoma.
Tissue Collection, Storage, and Preparation
Tissue specimens were obtained from lesions and from uninvolved skin at the time of the biopsy. Control skin samples were obtained from patients with neither Kaposi's sarcoma nor AIDS who were undergoing elective plastic surgery. Control samples of peripheral-blood mononuclear cells were obtained from healthy, HIV-seronegative donors.
The tissue specimens were fresh-frozen immediately after removal and stored at -70°C. tissue was generally obtained by punch biopsy, which limited the amount of DNA available for analysis.
DNA was extracted with chloroform phenol, resuspended in deionized distilled water at a concentration of 0.1 μg per microliter, and stored at 4°C.19 Control DNA specimens were extracted from peripheral-blood mononuclear cells and excess skin tissue obtained from patients without Kaposi's sarcoma who had undergone cosmetic surgery. All identifying information on control samples was removed to maintain confidentiality. To ensure blinding, DNA specimens from Kaposi's sarcoma lesions and from control tissues were extracted and coded in a separate laboratory by persons uninvolved in PCR testing. Control specimens were randomly distributed among the batches of samples to be tested. Each batch of samples tested included negative controls (those without DNA) and positive controls (those containing DNA with the KS330233 sequence).
PCR Amplification for KS330233
All DNA samples were confirmed to be amplifiable with PCR primers specific for a conserved region of a human interferon gene.19 PCR primers were synthesized (Operon, Alameda, Calif.) to amplify the 233-bp KS330233 region of the sequence associated with Kaposi's sarcoma and AIDS. This sequence is homologous to portions of the minor capsid genes ORF26 and BDLF1 of herpesvirus saimiri and the Epstein–Barr virus, respectively.16
Each PCR reaction used approximately 0.2 μg of genomic DNA, 100 pmol of each primer (5'TCCGTGTTGTCTACGTCCAG3' and 5'AGCCGAAAGGATTCCACCAT3'), 2 units of Taq polymerase, 100 μM of each deoxynucleotide triphosphate, 1.5 mm magnesium chloride, 50 mm potassium chloride, 10 mm TRIS–hydrochloride (pH 9.0), and 0.1 percent Triton X-100 in a final volume of 50 μl. PCR amplification was carried out at 94°C for 2 minutes (1 cycle); 94°C for 1 minute, 58°C for 1 minute, and 72°c for 1.5 minutes (35 to 40 cycles); and 72°C for 5 minutes (1 cycle). Amplifications were performed in a Perkin–Elmer 480 Thermocycler (Perkin–Elmer Cetus, Norwalk, Conn.) with ramp times of 1 second between steps. Amplification products were visualized on 2 percent agarose gel containing ethidium bromide and were scored for the presence or absence of the 233-bp fragment. PCR products with a band in the expected 233-bp region were transferred to nitrocellulose paper and subjected to Southern blot hybridization with a 25-bp internal oligomer end-labeled with [γ-33P]deoxycytidine triphosphate.16 PCR reactions were considered positive only if the PCR products specifically hybridized in the expected 233-bp region. Significance testing, with exact confidence intervals, was performed with Epi-Info (USD, Stone Mountain, Ga.).
Representative amplification products from each form of Kaposi's sarcoma were purified on gel and cloned into pCRII vector with the TA cloning system (Invitrogen, San Diego, Calif.). Both sense and antisense strands of the cloned KS330233 product were sequenced by standard methods.16
Results
Demographic Data
Sarcoma tissue was available from 11 patients with AIDS-associated Kaposi's sarcoma, 6 patients with classic Kaposi's sarcoma, and 4 HIV-seronegative homosexual men with Kaposi's sarcoma (Table 1Table 1
Demographic and Clinical Characteristics of 21 Patients with Kaposi's Sarcoma.).Among the patients with AIDS-associated Kaposi's sarcoma, the median age at the time of the diagnosis was 34 years (range, 26 to 52). All the patients with AIDS-associated Kaposi's sarcoma were homosexual or bisexual men, except for Patient 1, who reported no history of sexual relations with men, intravenous drug use, or receipt of blood products and was assumed to have been infected with HIV through heterosexual activities. Of the six patients with classic Kaposi's sarcoma, five were men and one was a woman; their median age was 65 years (range, 54 to 82). None of the five men reported a history of sexual relations with men or intravenous drug use, and all were HIV-seronegative at the time of the biopsy. The HIV-seronegative homosexual men had a median age of 41 years (range, 39 to 58) and were also HIV-seronegative at the time of the biopsy. The patients with AIDS-associated Kaposi's sarcoma had depressed CD4+ T-cell counts (median count, 87 cells per cubic millimeter; range, 14 to 201), whereas the HIV-seronegative homosexual men with Kaposi's sarcoma and the patients with classic Kaposi's sarcoma had normal counts.
One of the patients with classic Kaposi's sarcoma was of Arabic ancestry and had been born in Lebanon (Patient 17), two were of Russian Jewish ancestry (Patients 12 and 13), and two were of Italian ancestry (Patients 14 and 15). Among the homosexual men with Kaposi's sarcoma, only one (Patient 19) was of Italian ancestry. All the other patients were of Northern European or Hispanic ancestry.
PCR Analysis of KS330233
Tissue samples from the three groups of patients with Kaposi's sarcoma and control samples were randomly distributed and blindly tested in three batches (Figure 1Figure 1
Example of KS330233 PCR Amplifications from the First Batch of Tissue Samples from Patients with Kaposi's Sarcoma and Controls.). Of the 11 samples from the patients with AIDS-associated Kaposi's sarcoma, 9 were initially positive for KS330233 and 1 (the sample from Patient 6) was positive on repeated blind testing (Table 1); only 1 sample (from patient 3) was negative for KS330233 with PCR performed blindly on two separate DNA samples. Tissue samples from all six patients with classic Kaposi's sarcoma and all four HIV-seronegative homosexual men with Kaposi's sarcoma were positive for KS330233. KS330233 was found in samples of uninvolved skin from 3 of 14 patients with Kaposi's sarcoma (Table 1). In comparison, 13 of these 14 patients had lesions that were positive for KS330233 (unmatched odds ratio, 48; 95 percent confidence interval, 3.6 to 2201).Control specimens included 10 samples of peripheral-blood mononuclear cells from healthy HIV-seronegative donors and 11 skin samples from patients without Kaposi's sarcoma (Table 2Table 2
PCR Analysis of KS330233 in DNA Samples from Patients with Kaposi's Sarcoma and Controls.). Only 1 of the 21 control specimens, a skin sample, was positive for KS330233, as compared with 20 of the 21 sarcoma specimens (odds ratio, 400; 95 percent confidence interval, 19 to 17,300). After unblinding, repeated PCR examination of the single positive control sample was negative, suggesting the possibility of a false positive result initially.DNA Sequencing Studies
PCR products from representative samples of the three forms of Kaposi's sarcoma (tissue specimens obtained from Patients 1, 2, 4, 12, 13, 16, and 19) were cloned and sequenced (Figure 2Figure 2
DNA Sequences for KS330233 PCR Products Amplified from Tissue Samples Obtained from Seven Patients with Kaposi's Sarcoma.). Five KS330233 products (in samples from Patients 1, 4, 13, 16, and 19), representing all three forms of Kaposi's sarcoma, differed from the prototypic sequence originally derived from a genomic library made from a Kaposi's sarcoma lesion16 at a single base-pair position (47) coding for a proline-to-leucine substitution. PCR products from lesions in one patient with AIDS-associated Kaposi's sarcoma (Patient 2) and one with classic Kaposi's sarcoma (Patient 12) had a second genotype with five base-pair substitutions (at positions 46, 47, 69, 146, and 153). Base-pair substitutions at positions 46 and 47 code for a proline-to-isoleucine substitution and a base-pair substitution at position 146 codes for an aspartate-to-glycine substitution, as compared with the prototypic sequence. The remaining base-pair substitutions do not involve amino acid substitutions. The high degree of sequence conservation among PCR products suggests that the same herpesvirus-like agent is present in all three forms of Kaposi's sarcoma.Discussion
Epidemiologic evidence strongly suggests that both the AIDS-associated and non–AIDS-associated forms of Kaposi's sarcoma have infectious courses.3 Chang et al. derived unique DNA sequences from a lesion in a patient with AIDS-associated Kaposi's sarcoma; these sequences are homologous to but distinct from portions of three gammaherpesvirus genes found in two separate locations.16 Subsequent sequencing studies of a 21-kilobase insert derived from a genomic library of a lesion in a patient with Kaposi's sarcoma have confirmed its colinearity with members of the gammaherpesvirus subfamily (unpublished data). These sequences thus appear to mark a new human herpesvirus, although isolation and identification of the virus are pending. This agent has been given the descriptive name Kaposi's sarcoma–associated herpesvirus (KSHV); a formal designation has not yet been made.16
In our blinded evaluation, the KS330233 sequence was specifically associated with Kaposi's sarcoma lesions from both patients with HIV infection and those without infection. This PCR product is a highly sensitive and highly specific marker for the presence of KSHV sequences in DNA from patients with AIDS-associated Kaposi's sarcoma. DNA from patients with other common human herpesviruses, such as Epstein–Barr virus and cytomegalovirus, does not amplify KS330233.16 Detection of these sequences in patients with AIDS-associated Kaposi's sarcoma, patients with classic Kaposi's sarcoma, and HIV-seronegative homosexual men with Kaposi's sarcoma suggests that these three forms of Kaposi's sarcoma are not distinct and that KSHV is an etiologic agent in Kaposi's sarcoma. Although an interaction between endogenous growth factors and HIV Tat protein has been hypothesized to play a part in the pathogenesis of Kaposi's sarcoma,20,21 our findings indicate that coincident HIV infection is not necessary for the development of the Kaposi's sarcoma phenotype.
Sequence analysis of KS330233 PCR products demonstrates that the genome in all three forms of Kaposi's sarcoma is the same, within expected limits of strain variation. Random errors of Taq polymerase incorporation are unlikely to result in these conserved genotype patterns. No relation was seen between the different types of Kaposi's sarcoma and these divergent genotypes at this locus. The KS330233 PCR product was not detected initially in two samples of lesions from patients with AIDS-associated Kaposi's sarcoma but was detected in one of these samples on repeated blind examination. The inability to detect the amplifiable product in the other sample may have been due to either sequence polymorphism at the PCR priming site or the absence of infection with KSHV.
The variable detection of KS330233 in samples of normal skin from patients with Kaposi's sarcoma confirms previous studies16 indicating that KS330233 is not a portion of the human genome and is also consistent with an exogenous infectious process. These findings indicate that the agent may disseminate to tissue that is phenotypically normal, in both patients with AIDS and those without AIDS. It is possible that the agent is latent in this tissue, given the high sensitivity of PCR in detecting herpesvirus DNA.22
Despite the detection of KS330233 in association with all three forms of Kaposi's sarcoma, our study has several important methodologic limitations. The tissue specimens were obtained from punch biopsies, which limited the amount of DNA available for testing. We were therefore unable to perform confirmatory Southern hybridization directly on the DNA samples. Although Southern hybridization is a less sensitive test for specific DNA sequences, it is also less likely to have false positive results. Of the 21 control samples tested, 1 was initially positive for KS330233 by PCR but negative on repeated examination. As a conservative assumption, this sample was considered to be positive, but it was probably falsely positive. Alternatively, the positive result may reflect the prevalence of skin infection with KSHV in persons at low risk for Kaposi's sarcoma. the variability of sequenced PCR products from Kaposi's sarcoma DNA, however, indicates that our results are not due to carryover PCR contamination or contaminating DNA sequences. Recent reports have confirmed our findings in HIV-seronegative persons with classic Kaposi's sarcoma.23-25
The presence of KSHV sequences in both patients with AIDS-associated Kaposi's sarcoma and HIV-seronegative homosexual men with Kaposi's sarcoma is consistent with epidemiologic data suggesting that the etiologic agent is sexually transmitted.1 These sequences are also found in lesions from women and heterosexual men with Kaposi's sarcoma, however, so male homosexual activity is not the exclusive mode of transmission. Although additional studies are needed to determine the modes of transmission, our study provides evidence that this herpesvirus-like agent has an etiologic role in the development of Kaposi's sarcoma in both people with HIV infection and those without infection.
Supported by a grant (U64CCU210852-01) from the Centers for Disease Control and Prevention (to Dr. Moore) and by a Pilot Study Award from the Columbia–Presbyterian Medical Center Office of Clinical Trials (to Dr. Chang). Drs. Moore and Chang have applied for a patent for the DNA sequences and their potential applications.
We are indebted to Dawn Stelter and Daniela Peruzzi for technical assistance, to Drs. Michael Shelanksi and Zena Stein for advice on the experimental design, and to Jan Garbarek for assistance in the preparation of the manuscript.
Source Information
From the Division of Epidemiology, School of Public Health (P.S.M.), and the Department of Pathology, College of Physicians and Surgeons (Y.C.), Columbia University, New York. Tissue DNA specimens were prepared and provided by Dr. Yao-Qi Huang, Dr. Jian J. Li, and Dr. Alvin Friedman-Kien of the Departments of Microbiology and Dermatology, New York University School of Medicine, New York.
Address reprint requests to Dr. Moore at the Division of Epidemiology, PH18, Columbia University, 630 W. 168th St., New York, NY 10032.
- References
References
1
Beral V ,Peterman TA ,Berkelman RL ,Jaffe HW . Kaposi's sarcoma among persons with AIDS: a sexually transmitted infection? Lancet 1990;335:123-128
CrossRef | Web of Science | Medline2
Katz MH ,Hessol NA ,Buchbinder SP ,Hirozawa A ,O'Malley P ,Holmberg SD . Temporal trends of opportunistic infections and malignancies in homosexual men with AIDS. J Infect Dis 1994;170:198-202
CrossRef | Web of Science | Medline3
Peterman TA ,Jaffe HW ,Friedman-Kien AE ,Weiss RA . The aetiology of Kaposi's sarcoma. Cancer Surv 1991;10:23-37
Medline4
Archibald CP ,Schechter MT ,Le TN ,Craib KJP ,Montaner JSG ,O'Shaughnessy MV . Evidence for a sexually transmitted cofactor for AIDS-related Kaposi's sarcoma in a cohort of homosexual men. Epidemiology 1992;3:203-209
CrossRef | Web of Science | Medline5
Beral V ,Bull D ,Darby S , et al. Risk of Kaposi's sarcoma and sexual practices associated with faecal contact in homosexual or bisexual men with AIDS. Lancet 1992;339:632-635
CrossRef | Web of Science | Medline6
Beral V ,Bull D ,Jaffe H , et al. Is risk of Kaposi's sarcoma in AIDS patients in Britain increased if sexual partners came from United States or Africa? BMJ 1991;302:624-625[Erratum, BMJ 1991;302:752.]
CrossRef | Web of Science | Medline7
Friedman-Kien AE ,Saltzman BR . Clinical manifestations of classical, endemic African, and epidemic AIDS-associated Kaposi's sarcoma. J Am Acad Dermatol 1990;22:1237-1250
CrossRef | Web of Science | Medline8
DiGiovanna JJ ,Safai B . Kaposi's sarcoma: retrospective study of 90 cases with particular emphasis on the familial occurrence, ethnic background and prevalence of other diseases. Am J Med 1981;71:779-783
CrossRef | Web of Science | Medline9
Bendsoe N ,Dictor M ,Blomberg J ,Agren S ,Merk K . Increased incidence of Kaposi sarcoma in Sweden before the AIDS epidemic. Eur J Cancer 1990;26:699-702
CrossRef | Web of Science | Medline10
Giraldo G ,Beth E ,Henle W , et al. Antibody patterns to herpesviruses in Kaposi's sarcoma. II. Serological association of American Kaposi's sarcoma with cytomegalovirus. Int J Cancer 1978;22:126-131
CrossRef | Web of Science | Medline11
Giraldo G ,Beth E ,Kourilsky FM , et al. Antibody patterns to herpesviruses in Kaposi's sarcoma: serological association of European Kaposi's sarcoma with cytomegalovirus. Int J Cancer 1975;15:839-848
CrossRef | Web of Science | Medline12
Friedman-Kien AE ,Saltzman BR ,Cao YZ , et al. Kaposi's sarcoma in HIV-negative homosexual men. Lancet 1990;335:168-169
CrossRef | Web of Science | Medline13
Ambinder RF ,Newman C ,Hayward GS , et al. Lack of association of cytomegalovirus with endemic African Kaposi's sarcoma. J Infect Dis 1985;156:193-197
CrossRef | Web of Science14
Kestens L ,Melbye M ,Biggar RJ , et al. Endemic African Kaposi's sarcoma is not associated with immunodeficiency. Int J Cancer 1985;36:49-54
CrossRef | Web of Science | Medline15
Penn I . Kaposi's sarcoma in organ transplant recipients: report of 20 cases. Transplantation 1979;27:8-11
CrossRef | Web of Science | Medline16
Chang Y ,Cesarman E ,Pessin MS , et al. Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma. Science 1994;266:1865-1869
CrossRef | Web of Science | Medline17
Lisitsyn N ,Lisitsyn N ,Wigler M . Cloning the differences between two complex genomes. Science 1993;259:946-951
CrossRef | Web of Science | Medline18
Cesarman E ,Chang Y ,Moore PS ,Said JW ,Knowles DM . Kaposi's sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas. N Engl J Med 1995;332:1186-1191
Full Text | Web of Science | Medline19
Nicolaides A ,Huang Y-Q ,Li JJ ,Zhang WG ,Friedman-Kien AE . Gene amplification and multiple mutations of the K-ras oncogene in Kaposi's sarcoma. Anticancer Res 1994;14:921-926
Web of Science | Medline20
Ensoli B ,Gendelman R ,Markham P , et al. Synergy between basic fibroblast growth factor and HIV-1 Tat protein in induction of Kaposi's sarcoma. Nature 1994;371:674-680
CrossRef | Web of Science | Medline21
Huang Y-Q ,Li JJ ,Moscatelli D , et al. Expression of Int-2 oncogene in Kaposi's sarcoma lesions. J Clin Invest 1993;91:1191-1197
CrossRef | Web of Science | Medline22
Gan YJ ,Sullivan JL ,Sixbey JW . Detection of cell-free Epstein-Barr virus DNA in serum during acute infectious mononucleosis. J Infect Dis 1994;170:436-439
CrossRef | Web of Science | Medline23
Su I-J ,Hsu Y-S ,Chang Y-C ,Wang I-W . Herpesvirus-like DNA sequence in Kaposi's sarcoma from AIDS and non-AIDS patients in Taiwan. Lancet 1995;345:722-723
CrossRef | Web of Science | Medline24
Huang Y-Q ,Li JJ ,Kaplan MH , et al. Human herpesvirus-like nucleic acid in various forms of Kaposi's sarcoma. Lancet 1995;345:759-761
CrossRef | Web of Science | Medline25
Dupin N ,Grandadam M ,Calvez V , et al. Herpesvirus-like DNA sequences in patients with Mediterranean Kaposi's sarcoma. Lancet 1995;345:761-762
CrossRef | Web of Science | Medline
- Citing Articles (320)
Citing Articles
1
Sahar Kohanim, Anthony B. Daniels, Nancy Huynh, James Chodosh. (2012) Local Treatment of Kaposi Sarcoma of the Conjunctiva. International Ophthalmology Clinics 51:4, 183-192
CrossRef2
Betsy Foxman. 2012. Applications of Molecular Tools to Infectious Disease Epidemiology. , 23-39.
CrossRef3
Mary Cianfrocca, Sandra Lee, Jamie Roenn, Michelle A. Rudek, Bruce J. Dezube, Susan E. Krown, Joseph A. Sparano. (2011) Pilot study evaluating the interaction between paclitaxel and protease inhibitors in patients with human immunodeficiency virus-associated Kaposi’s sarcoma: an Eastern Cooperative Oncology Group (ECOG) and AIDS Malignancy Consortium (AMC) trial. Cancer Chemotherapy and Pharmacology 68:4, 827-833
CrossRef4
Alfredo Morabia. (2011) Until the lab takes it away from epidemiology. Preventive Medicine 53:4-5, 217-220
CrossRef5
Deepa Reddy, Ronald Mitsuyasu. (2011) HIV-associated multicentric Castleman disease. Current Opinion in Oncology 23:5, 475-481
CrossRef6
Erika León Vázquez, Kenneth M. Kaye. (2011) Rapid and quantitative assessment of KSHV LANA-mediated DNA replication. Archives of Virology 156:8, 1323-1333
CrossRef7
Leo Jeng, Adan Rios, Mary D. Ruppe. (2011) Kaposi Sarcoma in the Setting of Cushing Disease. Endocrine Practice 17:4, e87-e91
CrossRef8
Antonio D’Antonio, Maria Addesso, Domenico Memoli, Pina Liguori, Roberto Cuomo, Amedeo Boscaino, Oscar Nappi. (2011) Lymph node-based disease and HHV-8/KSHV infection in HIV seronegative patients: report of three new cases of a heterogeneous group of diseases. International Journal of Hematology 93:6, 795-801
CrossRef9
S. E. Krown, D. P. Dittmer, E. Cesarman. (2011) Pilot Study of Oral Valganciclovir Therapy in Patients With Classic Kaposi Sarcoma. Journal of Infectious Diseases 203:8, 1082-1086
CrossRef10
Jinjong Myoung, Don Ganem. (2011) Active lytic infection of human primary tonsillar B cells by KSHV and its noncytolytic control by activated CD4+ T cells. Journal of Clinical Investigation 121:3, 1130-1140
CrossRef11
Kevin Shiley, Emily Blumberg. (2011) Herpes Viruses in Transplant Recipients: HSV, VZV, Human Herpes Viruses, and EBV. Hematology/Oncology Clinics of North America 25:1, 171-191
CrossRef12
Christian Eaton, Russell Dorer, David M. Aboulafia. (2011) Human Herpesvirus-8 Infection Associated with Kaposi Sarcoma, Multicentric Castleman's Disease, and Plasmablastic Microlymphoma in a Man with AIDS: A Case Report with Review of Pathophysiologic Processes. Pathology Research International 2011, 1-6
CrossRef13
Bryan Corrin, Andrew G. Nicholson. 2011. Tumours. , 531-705.
CrossRef14
Michael Osita Emina, Stella E. Odjimogho. (2010) Ocular Problems in HIV and AIDS Patients in Nigeria. Optometry and Vision Science 87:12, 979-984
CrossRef15
Nicholas Bexfield, Paul Kellam. (2010) Metagenomics and the molecular identification of novel viruses. The Veterinary Journal
CrossRef16
M. Byun, A. Abhyankar, V. Lelarge, S. Plancoulaine, A. Palanduz, L. Telhan, B. Boisson, C. Picard, S. Dewell, C. Zhao, E. Jouanguy, S. Feske, L. Abel, J.-L. Casanova. (2010) Whole-exome sequencing-based discovery of STIM1 deficiency in a child with fatal classic Kaposi sarcoma. Journal of Experimental Medicine 207:11, 2307-2312
CrossRef17
Klaus-Martin Schulte, Nadia Talat. (2010) Castleman's disease—a two compartment model of HHV8 infection. Nature Reviews Clinical Oncology 7:9, 533-543
CrossRef18
Adele Caterino-de-Araujo, Rolanda Carmen Rafael Manuel, Rosana Del Bianco, Elizabeth Santos-Fortuna, Mariana Cavalheiro Magri, Joyce Matie Kinoshita Silva, Rui Bastos. (2010) Seroprevalence of human herpesvirus 8 infection in individuals from health care centers in Mozambique: Potential for endemic and epidemic Kaposi's sarcoma. Journal of Medical Virology 82:7, 1216-1223
CrossRef19
Kevin Shiley, Emily Blumberg. (2010) Herpes Viruses in Transplant Recipients: HSV, VZV, Human Herpes Viruses, and EBV. Infectious Disease Clinics of North America 24:2, 373-393
CrossRef20
Young C. Shin, Leandro R. Jones, Julieta Manrique, William Lauer, Angela Carville, Keith G. Mansfield, Ronald C. Desrosiers. (2010) Glycoprotein gene sequence variation in rhesus monkey rhadinovirus. Virology 400:2, 175-186
CrossRef21
Siamak Moayedi. (2010) Head, Neck and Ophthalmologic Manifestations of HIV in the Emergency Department. Emergency Medicine Clinics of North America 28:2, 265-271
CrossRef22
Don Ganem. (2010) KSHV and the pathogenesis of Kaposi sarcoma: listening to human biology and medicine. Journal of Clinical Investigation 120:4, 939-949
CrossRef23
E. Calonje. 2010. Soft-Tissue Tumours and Tumour-like Conditions. , 1-62.
CrossRef24
J. C. Sterling. 2010. Virus Infections. , 1-81.
CrossRef25
Meghan Dubina, Gary Goldenberg. (2009) Viral-Associated Nonmelanoma Skin Cancers: A Review. The American Journal of Dermatopathology 31:6, 561-573
CrossRef26
Colleen Pelser, Carmelo Dazzi, Barry I. Graubard, Carmela Lauria, Francesco Vitale, James J. Goedert. (2009) Risk of Classic Kaposi Sarcoma with Residential Exposure to Volcanic and Related Soils in Sicily. Annals of Epidemiology 19:8, 597-601
CrossRef27
Danielle M. P. Cronin, Roger A. Warnke. (2009) Castleman Disease. Advances in Anatomic Pathology 16:4, 236-246
CrossRef28
Gülsüm Emel Pamuk, Erkan Aydogdu, Burhan Turgut, Muzaffer Demir. (2009) The simultaneous diagnosis of Kaposi sarcoma and MDS RAEB-II in a human immunodeficiency virus-negative patient. Annals of Hematology 88:4, 389-391
CrossRef29
Anna Patrikidou, Kostas Vahtsevanos, Martha Charalambidou, Rosalia-Maria Valeri, Persefoni Xirou, Kostas Antoniades, David W. Eisele. (2009) Non-AIDS Kaposi's sarcoma in the head and neck area. Head & Neck 31:2, 260-268
CrossRef30
LAWRENCE M. WEISS. 2009. Soft Tissues. , 1717-1783.
CrossRef31
Francesca Cottoni, Simona Ceccarelli, Maria Vittoria Masala, Maria Antonietta Montesu, Rosanna Satta, Caterina Pirodda, Sabrina Rotolo, Luigi Frati, Cinzia Marchese, Antonio Angeloni. (2009) Overexpression of the fibroblast growth factor receptor 2-IIIc in Kaposi's sarcoma. Journal of Dermatological Science 53:1, 65-68
CrossRef32
Harry W. Haverkos. (2008) Multifactorial etiology of Kaposi’s sarcoma: a hypothesis. Journal of Biosciences 33:5, 643-651
CrossRef33
A Chadburn, E M Hyjek, W Tam, Y Liu, T Rengifo, E Cesarman, D M Knowles. (2008) Immunophenotypic analysis of the Kaposi sarcoma herpesvirus (KSHV; HHV-8)-infected B cells in HIV+ multicentric Castleman disease (MCD). Histopathology 53:5, 513-524
CrossRef34
Xuefeng Sun, Bing Han. (2008) Multicentric Castleman’s disease presenting with multiple nodes in lungs: a case report and literature review. International Journal of Hematology 88:3, 278-282
CrossRef35
Alain Bestawros, Mohamed-Rachid Boulassel, René P. Michel, Jean-Pierre Routy. (2008) HHV-8 linked to Kaposi's sarcoma, Castleman's disease and primary effusion lymphoma in a HIV-1-infected man. Journal of Clinical Virology 42:2, 179-181
CrossRef36
Olivier Choussy, Christophe Van Haverbeke, Emmanuel Babin, Arnaud Francois, Anne Bénédicte Duval-Modeste, Daniele Dehesdin. (2008) Unusual presentation of oropharyngeal Kaposi's sarcoma. Head & Neck 30:3, 411-415
CrossRef37
Oscar Lin, Maureen F. Zakowski. 2008. Cytology of Soft Tissue, Bone, and Skin. , 471-513.
CrossRef38
Adolfo Contreras, Armen Mardirossian, Jørgen Slots. (2008) Herpesviruses in HIV-periodontitis. Journal of Clinical Periodontology 28:1, 96
CrossRef39
Nam-Hyuk Cho, Young-Ki Choi, Joong-Kook Choi. (2008) Multi-transmembrane protein K15 of Kaposi's sarcoma-associated herpesvirus targets Lyn kinase in the membrane raft and induces NFAT/AP1 activities. Experimental and Molecular Medicine 40:5, 565
CrossRef40
Stefan Duensing, Patrick S. Moore, Julie Parsonnet. 2007. Infectious Agents and Cancer. .
CrossRef41
Marluísa de Oliveira Guimarães Ishak, Rosimar Neris Martins, Paula Renata Lima Machado, Lia Lobato Batista de Souza, Luiz Fernando Almeida Machado, Vânia Nakauth Azevedo, Harutaka Katano, Tetsutaro Sata, Hideki Hasegawa, Antonio Carlos Rosário Vallinoto, Ricardo Ishak. (2007) High diversity of HHV-8 molecular subtypes in the Amazon region of Brazil: Evidence of an ancient human infection. Journal of Medical Virology 79:10, 1537-1544
CrossRef42
Liviu Feller, Neil H. Wood, Johan Lemmer. (2007) HIV-associated Kaposi sarcoma: pathogenic mechanisms. Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology, and Endodontology 104:4, 521-529
CrossRef43
Jian-Chao Zong, Henry Kajumbula, William Boto, Gary S. Hayward. (2007) Evaluation of global clustering patterns and strain variation over an extended ORF26 gene locus from Kaposi's sarcoma herpesvirus. Journal of Clinical Virology 40:1, 19-25
CrossRef44
Jian-Chao Zong, Ravit Arav-Boger, Donald J. Alcendor, Gary S. Hayward. (2007) Reflections on the interpretation of heterogeneity and strain differences based on very limited PCR sequence data from Kaposi's sarcoma-associated herpesvirus genomes. Journal of Clinical Virology 40:1, 1-8
CrossRef45
N. G. Stavrianeas, A. C. Katoulis, A. I. Kanelleas, E. Toumbis-Ioannou, E. Bozi, V. Anyfantakis, E. Papadorvid. (2007) Kaposi's sarcoma as a K
bner phenomenon in a patient with bullous pemphigoid and sarcoidosis. Clinical and Experimental Dermatology 32:5, 579-581
CrossRef46
Ryan R Fortna, Jacqueline M Junkins-Hopkins. (2007) A Case of Lobular Capillary Hemangioma (Pyogenic Granuloma), Localized to the Subcutaneous Tissue, and a Review of the Literature. The American Journal of Dermatopathology 29:4, 408-411
CrossRef47
D Bubman, I Guasparri, E Cesarman. (2007) Deregulation of c-Myc in primary effusion lymphoma by Kaposi's sarcoma herpesvirus latency-associated nuclear antigen. Oncogene 26:34, 4979-4986
CrossRef48
Bennie H. Jeng, Gary N. Holland, Careen Y. Lowder, William F. Deegan, Michael B. Raizman, David M. Meisler. (2007) Anterior Segment and External Ocular Disorders Associated with Human Immunodeficiency Virus Disease. Survey of Ophthalmology 52:4, 329-368
CrossRef49
Emma Guttman-Yassky, Rinat Abada, Zipi Kra-Oz, Judith Sattinger, Alex Perelman, Reuven Bergman, Ronit Sarid. (2007) Relationship between human herpesvirus 8 loads and disease stage in classic Kaposi sarcoma patients. Diagnostic Microbiology and Infectious Disease 57:4, 387-392
CrossRef50
Elisa Martró, Anna Esteve, Thomas F. Schulz, Julie Sheldon, Gemma Gambús, Rafael Muñoz, Denise Whitby, Jordi Casabona. (2007) Risk factors for human Herpesvirus 8 infection and AIDS-associated Kaposi's sarcoma among men who have sex with men in a European multicentre study. International Journal of Cancer 120:5, 1129-1135
CrossRef51
Brenna Kelley-Clarke, Mary E. Ballestas, Takashi Komatsu, Kenneth M. Kaye. (2007) Kaposi's sarcoma herpesvirus C-terminal LANA concentrates at pericentromeric and peri-telomeric regions of a subset of mitotic chromosomes. Virology 357:2, 149-157
CrossRef52
Elizabeth E. Brown, Denise Whitby, Francesco Vitale, Vickie Marshall, Georgina Mbisa, Christine Gamache, Carmela Lauria, Anthony J. Alberg, Diego Serraino, Paola Cordiali-Fei, Angelo Messina, James J. Goedert. (2006) Virologic, hematologic, and immunologic risk factors for classic Kaposi sarcoma. Cancer 107:9, 2282-2290
CrossRef53
Jean L. Urquhart, Alison Uzieblo, Sabine Kohler. (2006) Detection of HHV-8 in Pyogenic Granuloma-like Kaposi Sarcoma. The American Journal of Dermatopathology 28:4, 317-321
CrossRef54
Capucine Picard, Fethi Mellouli, Renan Duprez, Gaëlle Chédeville, Bénédicte Neven, Sylvie Fraitag, Jean Delaunay, Françoise Deist, Alain Fischer, Stéphane Blanche, Christine Bodemer, Antoine Gessain, Jean-Laurent Casanova, Mohamed Bejaoui. (2006) Kaposi’s sarcoma in a child with Wiskott-Aldrich syndrome. European Journal of Pediatrics 165:7, 453-457
CrossRef55
Joao Carlos Regazzi Avelleira, Omar Lupi, Adele Caterino-de-Araujo, Elizabeth de los Santos-Fortuna. (2006) Seroprevalence of HHV-8 infection in the pediatric population of two university hospitals in Rio de Janeiro, Brazil. International Journal of Dermatology 45:4, 381-383
CrossRef56
Don Ganem. (2006) KSHV INFECTION AND THE PATHOGENESIS OF KAPOSI'S SARCOMA. Annual Review of Pathology: Mechanisms of Disease 1:1, 273-296
CrossRef57
Assimina Zavitsanou, Vana Sypsa, Maria Petrodaskalaki, Mina Psichogiou, Antigoni Katsoulidou, John Boletis, Valsamakis Hadjiconstantinou, Dimitris Karalis, Victoria Kalapothaki, Angelos Hatzakis. (2006) Human Herpesvirus 8 Infection in Hemodialysis Patients. American Journal of Kidney Diseases 47:1, 167-170
CrossRef58
Dorjbal Dorjsuren, Angela Burnette, Glenn N. Gray, Xulin Chen, Weimin Zhu, Paula E. Roberts, Michael J. Currens, Robert H. Shoemaker, Robert P. Ricciardi, Shizuko Sei. (2006) Chemical library screen for novel inhibitors of Kaposi's sarcoma-associated herpesvirus processive DNA synthesis. Antiviral Research 69:1, 9-23
CrossRef59
Henry Y Dong, David T Scadden, Laurence de Leval, Zuoqin Tang, Peter G Isaacson, Nancy L Harris. (2005) Plasmablastic Lymphoma in HIV-Positive Patients. The American Journal of Surgical Pathology 29:12, 1633-1641
CrossRef60
Elisabetta Tanzi, Alessandra Zappa, Fausta Caramaschi, Antonella Amendola, Donatella Lasagna, Luciana Gatti, Valeria Ascoli, Giovanni Rezza, Alessandro R. Zanetti. (2005) Human herpesvirus type 8 infection in an area of Northern Italy with high incidence of classical Kaposi's sarcoma. Journal of Medical Virology 76:4, 571-575
CrossRef61
Dagna, Lorenzo, Broccolo, Francesco, Paties, Carlo T., Ferrarini, Marina, Sarmati, Loredana, Praderio, Luisa, Sabbadini, Maria Grazia, Lusso, Paolo, Malnati, Mauro S., . (2005) A Relapsing Inflammatory Syndrome and Active Human Herpesvirus 8 Infection. New England Journal of Medicine 353:2, 156-163
Full Text62
G. Gambassi, R. Semeraro, V. Suma, A. Sebastio, R. Antonelli Incalzi. (2005) Aggressive Behavior of Classical Kaposi's Sarcoma and Coexistence With Angiosarcoma. The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 60:4, 520-523
CrossRef63
G. Verucchi, L. Calza, F. Trevisani, A. Zambruni, M. Tadolini, R. Giuliani, R. Manfredi, P. Andreone, F. Chiodo, M. Bernardi. (2005) Human herpesvirus-8-related Kaposi's sarcoma after liver transplantation successfully treated with cidofovir and liposomal daunorubicin. Transplant Infectious Disease 7:1, 34-37
CrossRef64
Charles L.M. Olweny, Margaret Borok, Ivy Gudza, Jennifer Clinch, Mary Cheang, Clem F. Kiire, Lorraine Levy, David Otim-Oyet, Joseph Nyamasve, Harvey Schipper. (2005) Treatment of AIDS-associated Kaposi's sarcoma in Zimbabwe: Results of a randomized quality of life focused clinical trial. International Journal of Cancer 113:4, 632-639
CrossRef65
Fatemeh Pak, Pawan Pyakural, Parviz Kokhaei, Ephata Kaaya, A. A. Pourfathollah, Galina Selivanova, Peter Biberfeld. (2005) HHV-8/KSHV during the development of Kaposi's sarcoma: evaluation by polymerase chain reaction and immunohistochemistry. Journal of Cutaneous Pathology 32:1, 21-27
CrossRef66
Brian Tomkowicz, Satya P. Singh, Derhsing Lai, Anjali Singh, Sundarasamy Mahalingham, Jeymohan Joseph, Shiv Srivastava, Alagarsamy Srinivasan. (2005) Mutational Analysis Reveals an Essential Role for the LXXLL Motif in the Transformation Function of the Human Herpesvirus-8 Oncoprotein, Kaposin. DNA and Cell Biology 24:1, 10-20
CrossRef67
Oumkaltoum Hbid, Lamia Belloul, Noura Fajali, Nadia Ismaili, Renan Duprez, Myriam Tanguy, Hakima Benomar, El Hassane Tahri, Antoine Gessain, Michel Huerre. (2005) Kaposiʼs sarcoma in Morocco: a pathological study with immunostaining for human herpesvirus-8 LNA-1. Pathology 37:4, 288-295
CrossRef68
W. Klaskala, B.P. Brayfield, C. Kankasa, G. Bhat, J.T. West, C.D. Mitchell, Charles Wood. (2005) Epidemiological characteristics of human herpesvirus-8 infection in a large population of antenatal women in Zambia. Journal of Medical Virology 75:1, 93-100
CrossRef69
Chun Lu, Yi Zeng, Zan Huang, Li Huang, Chao Qian, Guixia Tang, Di Qin. (2005) Human Herpesvirus 6 Activates Lytic Cycle Replication of Kaposi's Sarcoma-Associated Herpesvirus. The American Journal of Pathology 166:1, 173-183
CrossRef70
Wen-Hui Tsai, Yuan-Ming Lee, Benjamin Ing-Tiau Kuo, Chi Kuan Ho, Pen-Tung Liao, Ming-Der Liu, Yu Ru Kou, Hui-Chi Hsu. (2005) Increased Seroprevalence of. Acta Haematologica 114:2, 95-98
CrossRef71
Yi-Fen Wang, Yu-Fang Hsieh, Chin-Lin Lin, Jing-Li Lin, Chang-Yu Chen, Yee-Hsuan Chiou, Miao-Chen Chou. (2004) Staurosporine-induced G2/M arrest in primary effusion lymphoma BCBL-1 cells. Annals of Hematology 83:12, 739-744
CrossRef72
Abeltje M. Polstra, Marion Cornelissen, Jaap Goudsmit, Antoinette C. van der Kuyl. (2004) Retrospective, longitudinal analysis of serum human herpesvirus-8 viral DNA load in AIDS-related kaposi's sarcoma patients before and after diagnosis. Journal of Medical Virology 74:3, 390-396
CrossRef73
Amy Chadburn, Elizabeth Hyjek, Susan Mathew, Ethel Cesarman, Jonathan Said, Daniel M Knowles. (2004) KSHV-Positive Solid Lymphomas Represent an Extra-Cavitary Variant of Primary Effusion Lymphoma. The American Journal of Surgical Pathology 28:11, 1401-1416
CrossRef74
Jackson Orem, Mwanda W Otieno, Scot C Remick. (2004) AIDS-associated cancer in developing nations. Current Opinion in Oncology 16:5, 468-476
CrossRef75
Bhavna H Chohan, Heather Taylor, Rosemary Obrigewitch, Ludo Lavreys, Barbra A Richardson, Kishorchandra N Mandaliya, Job J Bwayo, Joan K Kreiss, Rhoda Ashley Morrow. (2004) Human herpesvirus 8 seroconversion in Kenyan women by enzyme-linked immunosorbent assay and immunofluorescence assay. Journal of Clinical Virology 30:2, 137-144
CrossRef76
Nicolas Regamey, Viviane Hess, Jakob Passweg, Christoph Hess, Jürg Steiger, Peter Erb, Gieri Cathomas, Michael Tamm. (2004) INFECTION WITH HUMAN HERPESVIRUS 8 AND TRANSPLANT-ASSOCIATED GAMMOPATHY. Transplantation 77:10, 1551-1554
CrossRef77
Angela Hong, Stewart Davies, Graham Stevens, C. Soon Lee. (2004) Cyclin D1 Overexpression in AIDS-related and Classic Kaposi Sarcoma. Applied Immunohistochemistry & Molecular Morphology26-30
CrossRef78
Paolo De Paoli. (2004) Human herpesvirus 8: an update. Microbes and Infection 6:3, 328-335
CrossRef79
Edith N. Nnoruka. (2003) Epidemic (human immunodeficiency virus-related) Kaposi's sarcoma in West African women. International Journal of Dermatology 42:10, 794-799
CrossRef80
Cool, Carlyne D., Rai, Pradeep R., Yeager, Michael E., Hernandez-Saavedra, Daniel, Serls, Amanda E., Bull, Todd M., Geraci, Mark W., Brown, Kevin K., Routes, John M., Tuder, Rubin M., Voelkel, Norbert F., . (2003) Expression of Human Herpesvirus 8 in Primary Pulmonary Hypertension. New England Journal of Medicine 349:12, 1113-1122
Full Text81
Giulio Alessandri, Simona Fiorentini, Stefano Licenziati, Monica Bonafede, Paolo Monini, Barbara Ensoli, Arnaldo Caruso. (2003) CD8 + CD28 - T Lymphocytes from HIV-1-Infected Patients Secrete Factors That Induce Endothelial Cell Proliferation and Acquisition of Kaposi's Sarcoma Cell Features. Journal of Interferon & Cytokine Research 23:9, 523-531
CrossRef82
Scott M DeWire, Eric S Money, Stuart P Krall, Blossom Damania. (2003) Rhesus monkey rhadinovirus (RRV): construction of a RRV-GFP recombinant virus and development of assays to assess viral replication. Virology 312:1, 122-134
CrossRef83
Amy Rock Wohl, Sharon Lu, Jane Turner, Andrea Kovacs, Mallory Witt, Kathleen Squires, William Towner, Victor Beer. (2003) Risk of Opportunistic Infection in the HAART Era Among HIV-Infected Latinos Born in the United States Compared to Latinos Born in Mexico and Central America. AIDS Patient Care and STDs 17:6, 267-275
CrossRef84
Susan E Krown. (2003) Therapy of AIDS-associated Kaposi's sarcoma: targeting pathogenetic mechanisms. Hematology/Oncology Clinics of North America 17:3, 763-783
CrossRef85
Thomas B. Campbell, Margaret Borok, Irene E. White, Ivy Gudza, Buxton Ndemera, Albert Taziwa, Adriana Weinberg, Lovemore Gwanzura. (2003) Relationship of Kaposi Sarcoma (KS)–Associated Herpesvirus Viremia and KS Disease in Zimbabwe. Clinical Infectious Diseases 36:9, 1144-1151
CrossRef86
P. Cattani, F. Cerimele, D. Porta, R. Graffeo, S. Ranno, S. Marchetti, R. Ricci, N. Capodicasa, L. Fuga, R. Amico, G. Cherchi, M. Gazzilli, S. Zanetti, G. Fadda. (2003) Age-specific seroprevalence of Human Herpesvirus 8 in Mediterranean regions. Clinical Microbiology and Infection 9:4, 274-279
CrossRef87
Enrico Cassai, Monica Galvan, Leonardo Trombelli, Antonella Rotola. (2003) HHV-6, HHV-7, HHV-8 in gingival biopsies from chronic adult periodontitis patients. A case-control study. Journal of Clinical Periodontology 30:3, 184-191
CrossRef88
FM Buonaguro, ML Tornesello, L Buonaguro, RA Satriano, E Ruocco, G Castello, V Ruocco. (2003) Kaposi's sarcoma: aetiopathogenesis, histology and clinical features. Journal of the European Academy of Dermatology and Venereology 17:2, 138-154
CrossRef89
KYLE T. BERNSTEIN, LISA P. JACOBSON, FRANK J. JENKINS, DAVID VLAHOV, HAROUTUNE K. ARMENIAN. (2003) Factors Associated With Human Herpesvirus Type 8 Infection in an Injecting Drug User Cohort. Sexually Transmitted Diseases 30:3, 199-204
CrossRef90
Hal B. Jenson. (2003) Human herpesvirus 8 infection. Current Opinion in Pediatrics 15:1, 85-91
CrossRef91
Pallavi P. Kumar, Richard F. Little, Robert Yarchoan. (2003) Update on Kaposi’s sarcoma: A gammaherpesvirus-induced malignancy. Current Infectious Disease Reports 5:1, 85-92
CrossRef92
Dimas E. Hernandez, Bernard Masquelier, Omidres Perez, Margarita Oliver, Herve J. A. Fleury. (2003) Human Herpesvirus 8 Variants in Venezuelan Patients with AIDS‐Related Kaposi Sarcoma. Clinical Infectious Diseases 36:3, 385-386
CrossRef93
Luca Morelli, Teresa Pusiol, Francesco Piscioli, Heinz Höfler, Gregor Weirich, Martin Werner, Antonello Domenico Cabras. (2003) Herpesvirus 8-Associated Penile Kaposiʼs Sarcoma in an HIV-Negative Patient. The American Journal of Dermatopathology 25:1, 28-31
CrossRef94
Francesca Curreli, Monica A Robles, Alvin E Friedman-Kien, Ornella Flore. (2003) Detection and quantitation of Kaposi's sarcoma-associated herpesvirus (KSHV) by a single competitive-quantitative polymerase chain reaction. Journal of Virological Methods 107:2, 261-267
CrossRef95
Zongdong Li, Langxing Pan, Ethel Cesarman, Daniel M. Knowles. (2003) Alterations of mRNA Splicing in Primary Effusion Lymphomas. Leukemia & Lymphoma 44:5, 833-840
CrossRef96
Josune Mitxelena, Pablo Gomez-Ullate, Antonio Aguirre, Gurutze Rubio, Ildefonso Lampreabe, Jose Luis Diaz-Perez. (2003) Kaposi's sarcoma in renal transplant patients: experience at the Cruces Hospital in Bilbao. International Journal of Dermatology 42:1, 18-22
CrossRef97
Stacia M. Desantis, Chou-pong Pau, Lennox K. Archibald, Okey C. Nwanyanwu, Peter N. Kazembe, Hamish Dobbie, William R. Jarvis, Janine Jason. (2002) Demographic and immune correlates of human herpesvirus 8 seropositivity in Malawi, Africa. International Journal of Infectious Diseases 6:4, 266-271
CrossRef98
Baruch Brenner, Alina Weissmann-Brenner, Erica Rakowsky, Sara Weltfriend, Eyal Fenig, Rachel Friedman-Birnbaum, Aaron Sulkes, Shai Linn. (2002) Classical Kaposi sarcoma. Cancer 95:9, 1982-1987
CrossRef99
Guy Boivin, St
CrossRef100
H. F. Rabenau, N. I. Szép, W. Preiser, H. W. Doerr. (2002) HHV-8 Seroprävalenz in ausgewählten (Risiko)-Kollektiven im Raum Frankfurt am Main/HHV-8 Seroprevalence in Selected (Risk)-Groups in the Area of Frankfurt am Main. LaboratoriumsMedizin 26:9-10, 466-473
CrossRef101
Christine E. Koval, Francis Gigliotti, Diana Nevins, Lisa M. Demeter. (2002) Immune Reconstitution Syndrome after Successful Treatment of Pneumocystis carinii Pneumonia in a Man with Human Immunodeficiency Virus Type 1 Infection. Clinical Infectious Diseases 35:4, 491-493
CrossRef102
Jacques Baillargeon, Charles T. Leach, Jian-Hong Deng, Shou-Jiang Gao, Hal B. Jenson. (2002) High prevalence of human herpesvirus 8 (HHV-8) infection in south Texas children. Journal of Medical Virology 67:4, 542-548
CrossRef103
PATRICIA MUÑOZ, PATRICIA ALVAREZ, FERNANDO DE ORY, FRANCISCO POZO, MARISA RIVERA, EMILIO BOUZA. (2002) Incidence and Clinical Characteristics of Kaposi Sarcoma After Solid Organ Transplantation in Spain. Medicine 81:4, 293-304
CrossRef104
Bruno Arcà, Carlo Costantini, Mario Coluzzi, Valeria Ascoli, Daniela Manno, Stefano Guzzinati, Sandro Tognazzo, Paola Zambon. (2002) La puntura di artropodi ematofagi quale possible cofattore nella trasmissione di HHV8 (Human Herpes Virus 8) e nell’espressione del sarcoma di Kaposi. Rendiconti Lincei 13:2, 71-88
CrossRef105
Webster-Cyriaque, Jennifer, . (2002) Development of Kaposi's Sarcoma in a Surgical Wound. New England Journal of Medicine 346:16, 1207-1210
Full Text106
David M. Aboulafia. (2002) HHV-8- and EBV-Associated Nonepidermotrophic Large B-Cell Lymphoma Presenting as a Foot Rash in a Man with AIDS. AIDS Patient Care and STDs 16:4, 139-145
CrossRef107
Susan E. Krown, Ping Li, Jamie H. Von Roenn, Josephine Paredes, Jie Huang, Marcia A. Testa. (2002) Efficacy of Low-Dose Interferon with Antiretroviral Therapy in Kaposi's Sarcoma: A Randomized Phase II AIDS Clinical Trials Group Study. Journal of Interferon & Cytokine Research 22:3, 295-303
CrossRef108
Brian Tomkowicz, Satya P. Singh, Maria Cartas, Alagarsamy Srinivasan. (2002) Human Herpesvirus-8 Encoded Kaposin: Subcellular Localization Using Immunofluorescence and Biochemical Approaches. DNA and Cell Biology 21:3, 151-162
CrossRef109
J. Paul Zoeteweij, Andrea S. Rinderknecht, David A. Davis, Robert Yarchoan, Andrew Blauvelt. (2002) Minimal reactivation of Kaposi's sarcoma-associated herpesvirus by corticosteroids in latently infected B cell lines. Journal of Medical Virology 66:3, 378-383
CrossRef110
Sarah Brenner, Aushrat Sasson, Ofer Sharon. (2002) Pemphigus and infections. Clinics in Dermatology 20:2, 114-118
CrossRef111
CHARLES T. LEACH, BRAD H. POLLOCK, KENNETH L. MCCLAIN, RICHARD T. PARMLEY, SHARON B. MURPHY, HAL B. JENSON. (2002) Human herpesvirus 6 and cytomegalovirus infections in children with human immunodeficiency virus infection and cancer. The Pediatric Infectious Disease Journal 21:2, 125-132
CrossRef112
Edward Kachur, Lee-Cyn Ang, Joseph F. Megyesi. (2002) Castleman???s Disease and Spinal Cord Compression: Case Report. Neurosurgery 50:2, 399-403
CrossRef113
Edward Kachur, Lee-Cyn Ang, Joseph F. Megyesi. (2002) Castleman’s Disease and Spinal Cord Compression: Case Report. Neurosurgery 50:2, 399-403
CrossRef114
Jianchao Zong, Dolores M Ciufo, Raphael Viscidi, Lee Alagiozoglou, Stephen Tyring, Peter Rady, Jan Orenstein, William Boto, Henry Kalumbuja, Nino Romano, Mads Melbye, Gyeong H Kang, Chris Boshoff, Gary S Hayward. (2002) Genotypic analysis at multiple loci across Kaposi's sarcoma herpesvirus (KSHV) DNA molecules: clustering patterns, novel variants and chimerism. Journal of Clinical Virology 23:3, 119-148
CrossRef115
Sundar Santhanam, Marios Decatris, Ken O??Byrne. (2002) Potential of Interferon-?? in Solid Tumours. BioDrugs 16:5, 349-372
CrossRef116
Sylvie Euvrard, Jean Kanitakis, Alain Claudy. (2002) Neoplastic Skin Diseases in Organ Transplant Recipients. American Journal of Cancer 1:2, 109-120
CrossRef117
N. Kato, K. Isu, H. Kikuta. (2002) Absence of human herpesvirus 8/Kaposi's sarcoma-associated herpesvirus in a case of benign lymphangioendothelioma associated with periosteal haemangioma.. British Journal of Dermatology 146:1, 157-158
CrossRef118
Payzula Dilnur, Harutaka Katano, Zhen Hau Wang, Yasuhiro Osakabe, Motoshige Kudo, Tetsutaro Sata, Yoshiro Ebihara. (2001) Classic type of Kaposi's sarcoma and human herpesvirus 8 infection in Xinjiang, China. Pathology International 51:11, 845-852
CrossRef119
Marlys H. Witte, Michael J. Bernas, Clifford P. Martin, Charles L. Witte. (2001) Lymphangiogenesis and lymphangiodysplasia: From molecular to clinical lymphology. Microscopy Research and Technique 55:2, 122-145
CrossRef120
Jacques Baillargeon, Jian-Hong Deng, Evelyn Hettler, Chantal Harrison, James J Grady, Laura G Korte, James Alexander, Eduardo Montalvo, Hal B Jenson, Shou-Jiang Gao. (2001) Seroprevalence of Kaposi's Sarcoma-Associated Herpesvirus Infection among Blood Donors from Texas. Annals of Epidemiology 11:7, 512-518
CrossRef121
K.C. Sato-Matsumura, T. Matsumura, M. Nabeshima, H. Katano, T. Sata, H. Koizumi. (2001) Serological and immunohistochemical detection of human herpesvirus 8 in Kaposi's sarcoma after immunosuppressive therapy for bullous pemphigoid.. British Journal of Dermatology 145:4, 633-637
CrossRef122
Tetsuji Suda, Harutaka Katano, Georges Delsol, Chihiro Kakiuchi, Tomoko Nakamura, Mami Shiota, Tetsutaro Sata, Masaki Higashihara, Shigeo Mori. (2001) HHV-8 infection status of AIDS-unrelated and AIDS-associated multicentric Castleman's disease. Pathology International 51:9, 671-679
CrossRef123
Dominique Challine, Francoise Roudot-Thoraval, Turiaf Sarah, Liliane Laperche, Bruno Boisson, Stephanie Mauberquez, Fabienne Dubernet, Pierrette Rigot, Francois Lefrere, Bernard Mercier, Yvon Brossard, Francois Rouet, Robert Girot, Pascale Loiseau, Daniele Girard, Jacky Claquin, Bernard Loty, Joelle Lerable, Martine Mariotti, Jean-Michel Pawlotsky, Jean-Jacques Lefrere. (2001) Seroprevalence of human herpes virus 8 antibody in populations at high or low risk of transfusion, graft, or sexual transmission of viruses. Transfusion 41:9, 1120-1125
CrossRef124
Bekele Afessa. (2001) Pleural effusions and pneumothoraces in AIDS. Current Opinion in Pulmonary Medicine 7:4, 202-209
CrossRef125
Kimberly E Foreman, Jacques Friborg, Bala Chandran, Harutaka Katano, Tetsutaro Sata, Maria Mercader, Gary J Nabel, Brian J Nickoloff. (2001) Injection of human herpesvirus-8 in human skin engrafted on SCID mice induces Kaposi's sarcoma-like lesions. Journal of Dermatological Science 26:3, 182-193
CrossRef126
Sepkowitz, Kent A., . (2001) AIDS — The First 20 Years. New England Journal of Medicine 344:23, 1764-1772
Full Text127
E. Byrd Quinlivan, Rui Xue Wang, Paul W. Stewart, Chulaluk Kolmoltri, Nicolas Regamey, Peter Erb, Pietro L. Vernazza, . (2001) Longitudinal sero-reactivity to human herpesvirus 8 (KSHV) in the Swiss HIV Cohort 4.7 years before KS. Journal of Medical Virology 64:2, 157-166
CrossRef128
David M Aboulafia. (2001) Kaposi’s sarcoma. Clinics in Dermatology 19:3, 269-283
CrossRef129
MALIN ENBOM, ANDERS STRAND, KERSTIN I. FALK, ANNIKA LINDE. (2001) Detection of Epstein-Barr Virus, but not Human Herpesvirus 8, DNA in Cervical Secretions From Swedish Women by Real-Time Polymerase Chain Reaction. Sex Transm Dis 28:5, 300-306
CrossRef130
CATHERINE DIAMOND, HANNE THIEDE, THOMAS PERDUE, DUNCAN MacKELLAR, LINDA A. VALLEROY, LAWRENCE COREY. (2001) Seroepidemiology of Human Herpesvirus 8 Among Young Men Who Have Sex With Men. Sex Transm Dis 28:3, 176-183
CrossRef131
Guntram Bezold, Gerald Messer, Ralf Uwe Peter, Michael J. Flaig, Christian A. Sander. (2001) Quantitation of human herpes virus 8 DNA in paraffin-embedded biopsies of HIV-associated and classical Kaposi's sarcoma by PCR. Journal of Cutaneous Pathology 28:3, 127-130
CrossRef132
Valeria Ascoli, Sabina Signoretti, Andrea Onetti-Muda, Edoardo Pescarmona, Carlo Della-Rocca, Francesco Nardi, Claudio Maria Mastroianni, Roberta Gastaldi, Alessandra Pistilli, Gianluca Gaidano, Antonino Carbone, Francesco Lo-Coco. (2001) Primary effusion lymphoma in HIV-infected patients with multicentric Castleman's disease. The Journal of Pathology 193:2, 200-209
CrossRef133
Maria J. Wawer, Sybil M. Eng, David Serwadda, Nelson K. Sewankambo, Noah Kiwanuka, Chuanjun Li, Ronald H. Gray. (2001) Prevalence of Kaposi Sarcoma-Associated Herpesvirus Compared With Selected Sexually Transmitted Diseases in Adolescents and Young Adults in Rural Rakai District, Uganda. Sex Transm Dis 28:2, 77-81
CrossRef134
H. Kuper, H.-O. Adami, D. Trichopoulos. (2001) Infections as a major preventable cause of human cancer. Journal of Internal Medicine 249:S741, 61-74
CrossRef135
Adolfo Contreras, Armen Mardirossian, Jorgen Slots. (2001) Herpesviruses in HIV-periodontitis. Journal of Clinical Periodontology 28:1, 96-102
CrossRef136
Michael J. Scolaro, Lucy B. Gunnill, Laura E. Pope, M.H. Khalil, David H. Katz, James E. Berg. (2001) The Antiviral Drug Docosanol as a Treatment for Kaposi's Sarcoma Lesions in HIV Type 1-Infected Patients: A Pilot Clinical Study. AIDS Research and Human Retroviruses 17:1, 35-43
CrossRef137
Vladimir Berthaud, Carlos Navarro. (2001) Fatal unrecognized cutaneous and systemic kaposi's sarcoma in an AIDS patient with acute cryptococcal meningoencephalitis. International Journal of Infectious Diseases 5:2, 101-106
CrossRef138
Shlomi Codish, Mahmoud Abu-Shakra, Samuel Ariad, Howard J. Zirkin, Tikva Yermiyahu, Nicolas Dupin, Chris Boshoff, Shaul Sukenik. (2000) Manifestations of three HHV-8-related diseases in an HIV-negative patient: Immunoblastic variant multicentric Castleman's disease, primary effusion lymphoma, and Kaposi's sarcoma. American Journal of Hematology 65:4, 310-314
CrossRef139
Paula G. O'Connor, David T. Scadden. (2000) AIDS ONCOLOGY. Infectious Disease Clinics of North America 14:4, 945-965
CrossRef140
Malin Enbom, Julie Sheldon, Evelyne Lennette, Thomas Schulz, Dharam V. Ablashi, Frank Neipel, Peter Biberfeld, Hans Carlberg, Per Ljungman, Anders Nilsson, Tommy S
CrossRef141
Bettina Rohrmus, Eva M Thoma-Greber, Johannes R Bogner, Martin Röcken. (2000) Outlook in oral and cutaneous Kaposi's sarcoma. The Lancet 356:9248, 2160
CrossRef142
Y.-J. Chen, P.-P. Shieh, J.-L. Shen. (2000) Orificial tuberculosis and Kaposi's sarcoma in an HIV-negative individual. Clinical dermatology . Concise report. Clinical and Experimental Dermatology 25:5, 393-397
CrossRef143
Duncan A. Clark, Paul D. Griffiths, Vincent C. Emery. (2000) Newer human herpesviruses in transplantation. Current Opinion in Organ Transplantation 5:3, 203-209
CrossRef144
Guy Boivin, Annie Gaudreau, Jean-Pierre Routy. (2000) Evaluation of the human herpesvirus 8 DNA load in blood and Kaposi's sarcoma skin lesions from AIDS Patients on highly active antiretroviral therapy. AIDS 14:13, 1907-1910
CrossRef145
Carlos Zala, Clawdia Ochoa, Alejandro Krolewiecki, Patricia Patterson, Pedro Cahn, Richard I. Crawford, Julio S. G. Montaner. (2000) Highly active antiretroviral therapy does not protect against Kaposi's sarcoma in HIV-infected individuals. AIDS 14:14, 2217
CrossRef146
D. Lang, A. Birkmann, F. Neipel, W. Hinderer, M. Rothe, M. Ernst, H.-H. Sonneborn. (2000) Generation of Monoclonal Antibodies Directed Against the Immunogenic Glycoprotein K8.1 of Human Herpesvirus 8. Hybridoma 19:4, 287-295
CrossRef147
E. Nagore, E. Ledesma, C. Collado, V. Oliver, A. Pérez-Pérez, A. Aliaga. (2000) Detection of Epstein-Barr virus and human herpesvirus 7 and 8 genomes in primary cutaneous T- and B-cell lymphomas. British Journal of Dermatology 143:2, 320-323
CrossRef148
Lijun Wu, Rolf Renne, Don Ganem, Bagher Forghani. (2000) Human herpesvirus 8 glycoprotein K8.1: expression, post-translational modification and localization analyzed by monoclonal antibody. Journal of Clinical Virology 17:2, 127-136
CrossRef149
Maria Mercader, Brunella Taddeo, Jeffery R. Panella, Bala Chandran, Brian J. Nickoloff, Kimberly E. Foreman. (2000) Induction of HHV-8 Lytic Cycle Replication by Inflammatory Cytokines Produced by HIV-1-Infected T Cells. The American Journal of Pathology 156:6, 1961-1971
CrossRef150
Lı́gia Camera Pierrotti, Laura Masami Sumita, Wilton Santos Freire, Hélio Hehl Caiaffa Filho, Vanda Akico Ueda Fick de Souza. (2000) Detection of human herpesvirus 8 DNA and antibodies to latent nuclear and lytic-phase antigens in serial samples from aids patients with Kaposi’s sarcoma. Journal of Clinical Virology 16:3, 247-251
CrossRef151
Sibylle Mittnacht, Chris Boshoff. (2000) Viral cyclins. Reviews in Medical Virology 10:3, 175-184
CrossRef152
Renee N. Shaw, Jack L. Arbiser, Margaret K. Offermann. (2000) Valproic acid induces human herpesvirus 8 lytic gene expression in BCBL-1 cells. AIDS 14:7, 899
CrossRef153
Sumitra Muralidhar, Gary Veytsmann, Bala Chandran, Dharam Ablashi, Jay Doniger, Leonard J Rosenthal. (2000) Characterization of the human herpesvirus 8 (Kaposi’s sarcoma-associated herpesvirus) oncogene, Kaposin (ORF K12). Journal of Clinical Virology 16:3, 203-213
CrossRef154
Jens Peter Klussmann, Andreas Müller, Mathias Wagner, Orlando Guntinas-Lichius, Markus Jungehuelsing, Theo Sloots, Dharam V. Ablashi, Gerhard R.F. Krueger. (2000) Human herpesvirus type 8 in salivary gland tumors. Journal of Clinical Virology 16:3, 239-246
CrossRef155
Guntram Bezold, Christian A. Sander, Michael J. Flaig, Ralf U. Peter, Gerald Messer. (2000) Lack of Detection of Human Herpesvirus (HHV)-8 DNA in Lesional Skin of German Pemphigus Vulgaris and Pemphigus Foliaceus Patients. Journal of Investigative Dermatology 114:4, 739-741
CrossRef156
Bernard Masquelier, Franck Boralevi, Patrick Merci??, Michel Dupon, Herv?? J. A. Fleury. (2000) Heterosexual transmission of Kaposi's sarcoma-associated herpes virus between two patients developing AIDS???Kaposi's sarcoma. AIDS 14:4, 471
CrossRef157
A Weissmann, S Linn, S Weltfriend, R Friedman-Birnbaum. (2000) Epidemiological study of classic Kaposi's sarcoma: a retrospective review of 125 cases from Northern Israel. Journal of the European Academy of Dermatology and Venereology 14:2, 91-95
CrossRef158
Li-Min Huang, Shen-Yi Huang, MaoYuan Chen, MiaoFen Chao, Chun-Yi Lu, Hwei-Fang Tien, Chin-Yun Lee, Kuan-Teh Jeang. (2000) Geographical differences in human herpesvirus 8 seroepidemiology: A survey of 1,201 individuals in Asia. Journal of Medical Virology 60:3, 290-293
CrossRef159
Elizabeth A Abel. (2000) Skin neoplasias including cutaneous lymphoma, melanoma, and others: unapproved treatments or indications. Clinics in Dermatology 18:2, 201-210
CrossRef160
M. Kadri Altunda?, ?smail
CrossRef161
Jose Iscovich, Paolo Boffetta, Silvia Franceschi, Esther Azizi, Ronit Sarid. (2000) Classic Kaposi sarcoma. Cancer 88:3, 500-517
CrossRef162
James T. Castle, Lester D. R. Thompson. (2000) Kaposi sarcoma of major salivary gland origin. Cancer 88:1, 15-23
CrossRef163
Israel Penn. (2000) Post-Transplant Malignancy. Drug Safety 23:2, 101-113
CrossRef164
H. Asou, T. Tasaka, J.W. Said, M. Daibata, N. Kamada, H.P. Koeffler. (2000) Co-infection of HHV-6 and HHV-8 is rare in primary effusion lymphoma. Leukemia Research 24:1, 59-61
CrossRef165
Bruce D. Gaynor, Todd P. Margolis, Emmett T. Cunningham. (2000) Advances in Diagnosis and Management of Herpetic Uveitis. International Ophthalmology Clinics 40:2, 85-109
CrossRef166
Thomas B. Campbell, Lisa Fitzpatrick, Samantha MaWhinney, Xing-quan Zhang, Robert T. Schooley. (1999) Human Herpesvirus 8 (Kaposi's Sarcoma–Associated Herpesvirus) Infection in Men Receiving Treatment for HIV-1 Infection. JAIDS Journal of Acquired Immune Deficiency Syndromes 22:4, 333
CrossRef167
Thomas B. Campbell, Lisa Fitzpatrick, Samantha MaWhinney, Xing-quan Zhang, Robert T. Schooley. (1999) Human Herpesvirus 8 (Kaposi's Sarcoma–Associated Herpesvirus) Infection in Men Receiving Treatment for HIV-1 Infection. Journal of Acquired Immune Deficiency Syndromes 22:4, 333
CrossRef168
William A. Blattner. (1999) Human Retroviruses: Their Role in Cancer. Proceedings of the Association of American Physicians 111:6, 563-572
CrossRef169
Frank Neipel, Jens-Christian Albrecht, Bernhard Fleckenstein. (1999) Human Herpesvirus 8: Is it a Tumor Virus?. Proceedings of the Association of American Physicians 111:6, 594-601
CrossRef170
Harutaka Katano, Tetsutaro Sata, Tetsuji Suda, Tomoko Nakamura, Natsuo Tachikawa, Hirofumi Nishizumi, Shinsaku Sakurada, Yukiko Hayashi, Morio Koike, Aikichi Iwamoto, Takeshi Kurata, Shigeo Mori. (1999) Expression and antigenicity of human herpesvirus 8 encoded ORF59 protein in AIDS-associated Kaposi's sarcoma. Journal of Medical Virology 59:3, 346-355
CrossRef171
Giuseppina D'Agostino, Eleonora Arico, Laura Santodonato, Massimo Venditti, Paola Sestili, Laura Masuelli, Anna Coletti, Andrea Modesti, Gaston Picchio, Donald E. Mosier, Maria Ferrantini, Filippo Belardelli. (1999) Type I consensus IFN (IFN-con1) Gene Transfer into KSHV/HHV-8-Infected BCBL-1 Cells Causes Inhibition of Viral Lytic Cycle Activation via Induction of Apoptosis and Abrogates Tumorigenicity in SCID Mice. Journal of Interferon & Cytokine Research 19:11, 1305-1316
CrossRef172
Angelo V. Marzano, Emilio Berti, Elvio Alessi. (1999) Primary cutaneous B-cell lymphoma with a dermatomal distribution. Journal of the American Academy of Dermatology 41:5, 884-886
CrossRef173
M. Sturzl, C. Hohenadl, C. Zietz, E. Castanos-Velez, A. Wunderlich, G. Ascherl, P. Biberfeld, P. Monini, P. J. Browning, B. Ensoli. (1999) Expression of K13/v-FLIP Gene of Human Herpesvirus 8 and Apoptosis in Kaposi's Sarcoma Spindle Cells. JNCI Journal of the National Cancer Institute 91:20, 1725-1733
CrossRef174
Craig B. Fowler. (1999) Benign and malignant neoplasms of the periodontium. Periodontology 2000 21:1, 33-83
CrossRef175
Murielle Mary-Krause, Eric Billaud. (1999) Impact of Kaposi‚s sarcoma in occurrence of opportunistic central nervous system disease. AIDS 13:14, 1985
CrossRef176
Michael Henry, Aumaid Uthman, Alexandra Geusau, Armin Rieger, Lucinda Furci, Adriano Lazzarin, Paolo Lusso, Erwin Tschachler. (1999) Infection of Circulating CD34+ Cells by HHV-8 in Patients with Kaposi's Sarcoma. Journal of Investigative Dermatology 113:4, 613-616
CrossRef177
G. Rezza, M. Andreoni, M. Dorrucci, P. Pezzotti, P. Monini, R. Zerboni, B. Salassa, V. Colangeli, L. Sarmati, E. Nicastri, M. Barbanera, R. Pristera, F. Aiuti, L. Ortona, B. Ensoli. (1999) Human Herpesvirus 8 Seropositivity and Risk of Kaposi's Sarcoma and Other Acquired Immunodeficiency Syndrome-Related Diseases. JNCI Journal of the National Cancer Institute 91:17, 1468-1474
CrossRef178
M. S. Reitz, L. S. Nerurkar, R. C. Gallo. (1999) Perspective on Kaposi's Sarcoma: Facts, Concepts, and Conjectures. JNCI Journal of the National Cancer Institute 91:17, 1453-1458
CrossRef179
S HSPECK, H WVIRGINIV. (1999) Host and viral genetics of chronic infection: a mouse model of gamma-herpesvirus pathogenesis. Current Opinion in Microbiology 2:4, 403-409
CrossRef180
Herbert W. Virgin, Samuel H. Speckt. (1999) Unraveling immunity to γ-herpesviruses: a new model for understanding the role of immunity in chronic virus infection. Current Opinion in Immunology 11:4, 371-379
CrossRef181
Harutaka Katano, Yuko Sato, Takeshi Kurata, Shigeo Mori, Tetsutaro Sata. (1999) High Expression of HHV-8-Encoded ORF73 Protein in Spindle-Shaped Cells of Kaposi's Sarcoma. The American Journal of Pathology 155:1, 47-52
CrossRef182
Ethel Cesarman, Daniel M. Knowles. (1999) The role of Kaposi's sarcoma-associated herpesvirus (KSHV/HHV-8) in lymphoproliferative diseases. Seminars in Cancer Biology 9:3, 165-174
CrossRef183
Scott J. Brodie, Corazon de la Rosa, John Greg Howe, Jill Crouch, William D. Travis, Kurt Diem. (1999) Pediatric AIDS-Associated Lymphocytic Interstitial Pneumonia and Pulmonary Arterio-Occlusive Disease. The American Journal of Pathology 154:5, 1453-1464
CrossRef184
Daniel J. Skiest. (1999) Cytomegalovirus Retinitis in the Era of Highly Active Antiretroviral Therapy (HAART). The American Journal of the Medical Sciences 317:5, 318
CrossRef185
Martin, Daniel F., Kuppermann, Baruch D., Wolitz, Richard A., Palestine, Alan G., Li, Hong, Robinson, Charles A., the Roche Ganciclovir Study Group. (1999) Oral Ganciclovir for Patients with Cytomegalovirus Retinitis Treated with a Ganciclovir Implant. New England Journal of Medicine 340:14, 1063-1070
Full Text186
Francisco Pozo, Antonio Tenorio. (1999) Detection and typing of lymphotropic herpesviruses by multiplex polymerase chain reaction. Journal of Virological Methods 79:1, 9-19
CrossRef187
Andrea Antinori, Luigi M. Larocca, Lucia Fassone, Paola Cattani, Daniela Capello, Antonella Cingolani, Giuseppe Saglio, Giovanni Fadda, Gianluca Gaidano, Luigi Ortona. (1999) HHV-8/KSHV is Not Associated with AIDS-Related Primary Central Nervous System Lymphoma. Brain Pathology 9:2, 199-208
CrossRef188
Julio C. Mendez, Gary W. Procop, Mark J. Espy, Thomas F. Smith, Christopher G. A. McGregor, Carlos V. Paya. (1999) RELATIONSHIP OF HHV8 REPLICATION AND KAPOSI'S SARCOMA AFTER SOLID ORGAN TRANSPLANTATION. Transplantation 67:8, 1200-1201
CrossRef189
Silvia Fossati, Vinicio Boneschi, Silvia Ferrucci, Lucia Brambilla. (1999) Human immunodeficiency virus negative Kaposi sarcoma and lymphoproliferative disorders. Cancer 85:7, 1611-1615
CrossRef190
Liangjin Zhu, Rong Wang, Alisa Sweat, Elliot Goldstein, Rebecca Horvat, Bala Chandran. (1999) Comparison of Human Sera Reactivities in Immunoblots with Recombinant Human Herpesvirus (HHV)-8 Proteins Associated with the Latent (ORF73) and Lytic (ORFs 65, K8.1A, and K8.1B) Replicative Cycles and in Immunofluorescence Assays with HHV-8-Infected BCBL-1 Cells. Virology 256:2, 381-392
CrossRef191
P. C. S. Tsang, L. P. Samaranayake. (1999) Oral manifestations of HIV infection in a group of predominantly ethnic Chinese. Journal of Oral Pathology & Medicine 28:3, 122-127
CrossRef192
F. Samaniego, J. L. Bryant, N. Liu, J. E. Karp, A. L. Sabichi, A. Thierry, Y. Lunardi-Iskandar, R. C. Gallo. (1999) Induction of Programmed Cell Death in Kaposi's Sarcoma Cells by Preparations of Human Chorionic Gonadotropin. JNCI Journal of the National Cancer Institute 91:2, 135-143
CrossRef193
Juno Min, David A. Katzenstein. (1999) Detection of Kaposi's Sarcoma-Associated Herpesvirus in Peripheral Blood Cells in Human Immunodeficiency Virus Infection: Association with Kaposi's Sarcoma, CD4 Cell Count, and HIV RNA Levels. AIDS Research and Human Retroviruses 15:1, 51-55
CrossRef194
Ellen G Feigal. (1999) AIDS-associated malignancies: research perspectives. Biochimica et Biophysica Acta (BBA) - Reviews on Cancer 1423:1, C1-C9
CrossRef195
Robert Robles, Denise Lugo, Lauren Gee, Mark A. Jacobson. (1999) Effect of Antiviral Drugs Used to Treat Cytomegalovirus End-Organ Disease on Subsequent Course of Previously Diagnosed Kaposi's Sarcoma in Patients With AIDS. Journal of Acquired Immune Deficiency Syndromes and Human Retrovirology 20:1, 34-38
CrossRef196
Christopher D. Hillyer, Krista V. Lankford, John D. Roback, Theresa W. Gillespie, Leslie E. Silberstein. (1999) Transfusion of the HIV-seropositive patient: Immunomodulation, viral reactivation, and limiting exposure to EBV (HHV-4), CMV (HHV-5), and HHV-6, 7, and 8. Transfusion Medicine Reviews 13:1, 1-17
CrossRef197
PALACIOS, UMBERT, CELADA. (1999) Correspondence. British Journal of Dermatology 140:1, 170-171
CrossRef198
Robert Strohal, Erwin Tschachler, Stefan Breyer, Aumed Uthman, Ingrid Simonitsch, Sigfried Tratting, Werner Scheithauer, Georg Stingl, Gabriela V. Kornek. (1998) Reactivation of Behcet's disease in the course of multicentric HHV8-positive Castleman's disease: long-term complete remission by a combined chemo/radiation and interferon-alpha therapy regimen. British Journal of Haematology 103:3, 788-790
CrossRef199
Tetsushi Yoshikawa, Masaru Ihira, Kyoko Suzuki, Sdao Suga, Yoshizo Asano. (1998) HUMAN HERPESVIRUS 8 IS NOT ASSOCIATED WITH KAWASAKI DISEASE. The Pediatric Infectious Disease Journal 17:12, 1179
CrossRef200
Ryo Ichinohasama, Ikuo Miura, Nao Kobayashi, Yoshiko Saitoh, John F. DeCoteau, Yuriko Saiki, Shigeo Mori, Marshall E. Kadin, Kiyoshi Ooya. (1998) Herpes Virus Type 8-Negative Primary Effusion Lymphoma Associated With PAX-5 Gene Rearrangement and Hepatitis C Virus. The American Journal of Surgical Pathology 22:12, 1528-1537
CrossRef201
Regamey, Nicolas, Tamm, Michael, Wernli, MarionWitschi, Anne, Thiel, Gilbert, Cathomas, Gieri, Erb, Peter, . (1998) Transmission of Human Herpesvirus 8 Infection from Renal-Transplant Donors to Recipients. New England Journal of Medicine 339:19, 1358-1363
Full Text202
Lisa Bobroski, Alexander U. Bagasra, Deepa Patel, P. Saikumari, Matthew Memoli, Maureen V. Abbey, Charles Wood, Carlos Sosa, Omar Bagasra. (1998) Localization of human herpesvirus type 8 (HHV-8) in the Kaposi's sarcoma tissues and the semen specimens of HIV-1 infected and uninfected individuals by utilizing in situ polymerase chain reaction. Journal of Reproductive Immunology 41:1-2, 149-160
CrossRef203
Francesca Pica, Antonio Volpi, Giovanni Barillari, Marzia Fraschetti, Ornella Franzese, Vincenzo Vullo, Enrico Garaci. (1998) Detection of high nerve growth factor serum levels in AIDS-related and -unrelated Kaposiʼs sarcoma patients. AIDS 12:15, 2025-2029
CrossRef204
José Iscovich, Paolo Boffetta, Regina Winkelmann, Paul Brennan, Esther Azizi. (1998) Classic Kaposiʼs sarcoma in Jews living in Israel, 1961–1989. AIDS 12:15, 2067-2072
CrossRef205
Jooryung Huh, Gyeong Hoon Kang, Gyungyub Gong, Sung Sook Kim, Jae Y Ro, Chul Woo Kim. (1998) Kaposi's sarcoma-associated herpesvirus in Kikuchi's disease. Human Pathology 29:10, 1091-1096
CrossRef206
Satoshi Mayama, Luis E. Cuevas, Julie Sheldon, Omar H. Omar, David H. Smith, Pious Okong, Bachendeka Silvel, C. Anthony Hart, Thomas F. Schulz. (1998) Prevalence and transmission of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) in Ugandan children and adolescents. International Journal of Cancer 77:6, 817-820
CrossRef207
Sara K. Ward, Henry H. Roenigk, Kenneth B. Gordon. (1998) DERMATOLOGIC MANIFESTATIONS OF GASTROINTESTINAL DISORDERS. Gastroenterology Clinics of North America 27:3, 615-636
CrossRef208
Ning Li, William K. Anderson, Jag Bhawan. (1998) Further confirmation of the association of human herpesvirus 8 with Kaposi's sarcoma. Journal of Cutaneous Pathology 25:8, 413-419
CrossRef209
Pfrommer, Tebbe, Tidona, WOlfer, Krengel, Zeichardt, Zouboulis, Orfanos. (1998) Progressive HHV-8-positive classic Kaposi's sarcoma: rapid response to interferon alpha-2a but persistence of HHV-8 DNA sequences in lesional skin. British Journal of Dermatology 139:3, 516-519
CrossRef210
Jones, Dan, Ballestas, Mary E., Kaye, Kenneth M., Gulizia, James M., Winters, Gayle L., Fletcher, Jonathan, Scadden, David T., Aster, Jon C., . (1998) Primary-Effusion Lymphoma and Kaposi's Sarcoma in a Cardiac-Transplant Recipient. New England Journal of Medicine 339:7, 444-449
Full Text211
Mads Melbye, Pamela M. Cook, Henrik Hjalgrim, Kamilla Begtrup, Guy R. Simpson, Robert J. Biggar, Peter Ebbesen, Thomas F. Schulz. (1998) Risk factors for Kaposi's-sarcoma-associated herpesvirus (KSHV/HHV-8) seropositivity in a cohort of homosexual men, 1981–1996. International Journal of Cancer 77:4, 543-548
CrossRef212
SECkin, Ozcan, DemiraG, Hizel, Haberal. (1998) The Koebner phenomenon in Kaposi's sarcoma in a renal transplant recipient. British Journal of Dermatology 139:2, 346-348
CrossRef213
Hans-Reinhard Brodt, Bernd S. Kamps, Eilke B. Helm, Helmut Schöfer, Paris Mitrou. (1998) Kaposiʼs sarcoma in HIV infection. AIDS 12:12, 1475-1481
CrossRef214
Giovanni Rezza, Evelyne T. Lennette, Massimo Giuliani, Patrizio Pezzotti, Federico Caprilli, Paolo Monini, Stefano Buttò, Gianluca Lodi, Aldo Di Carlo, Jay A. Levy, Barbara Ensoli. (1998) Prevalence and determinants of anti-lytic and anti-latent antibodies to human herpesvirus-8 among Italian individuals at risk of sexually and parenterally transmitted infections. International Journal of Cancer 77:3, 361-365
CrossRef215
Martin, Jeffrey N., Ganem, Donald E., Osmond, Dennis H., Page-Shafer, Kimberly A., Macrae, Don, Kedes, Dean H., . (1998) Sexual Transmission and the Natural History of Human Herpesvirus 8 Infection. New England Journal of Medicine 338:14, 948-954
Full Text216
Kamal G. Ishak, Karen E. Bijwaard, Hala R. Makhlouf, Jeffery K. Taubenberger, Jack H. Lichy, Zachary D. Goodman. (1998) Absence of human herpesvirus 8 DNA sequences in vascular tumors of the liver*. Liver 18:2, 124-127
CrossRef217
Eric D. Hsi, Kimberly E. Foreman, Joan Duggan, Serhan Alkan, Carol A. Kauffman, Herbert D. Aronow, Brian J. Nickoloff. (1998) Molecular and Pathologic Characterization of an AIDS-Related Body Cavity-Based Lymphoma, Including Ultrastructural Demonstration of Human Herpesvirus-8. The American Journal of Surgical Pathology 22:4, 493-499
CrossRef218
SUSAN E. KROWN. (1998) Interferon-α: Evolving Therapy for AIDS-Associated Kaposi's Sarcoma. Journal of Interferon & Cytokine Research 18:4, 209-214
CrossRef219
Elena A. Panyutich, Jonathan W. Said, Steven A. Miles. (1998) Infection of primary dermal microvascular endothelial cells by Kaposiʼs sarcoma-associated herpesvirus. AIDS 12:5, 467-472
CrossRef220
Page S. Herman, Marie R. Shogreen, Wain L. White. (1998) The Evaluation of Human Herpesvirus 8 (Kaposi's Sarcoma-Associated Herpesvirus) in Cutaneous Lesions of Kaposi's Sarcoma. The American Journal of Dermatopathology 20:1, 7-11
CrossRef221
Clay Smith, Scott Lilly, Karen P Mann, Elizabeth Livingston, Sarah Myers, H Kim Lyerly, G Diego Miralles. (1998) AIDS-related malignancies. Annals of Medicine 30:4, 323-344
CrossRef222
M.A. Rubin, J.P. Parry, B. Singh. (1998) KAPOSI'S SARCOMA ASSOCIATED HERPESVIRUS DEOXYRIBONUCLEIC ACID SEQUENCES: LACK OF DETECTION IN PROSTATIC TISSUE OF HUMAN IMMUNODEFICIENCY VIRUS-NEGATIVE IMMUNOCOMPETENT ADULTS. The Journal of Urology 159:1, 146-148
CrossRef223
S.R Porter, L Di Alberti, N Kumar. (1998) Human herpes virus 8 (Kaposi’s sarcoma herpesvirus). Oral Oncology 34:1, 5-14
CrossRef224
Irene Potouridou, Andreas Katsambas, Vassiliki Pantazi, Melina Armenaka, Nikos Stavrianeas, John Stratigos. (1998) Classic Kaposi's sarcoma in two young heterosexual men. Journal of the European Academy of Dermatology and Venereology 10:1, 48-52
CrossRef225
JOAN N. BREUER-McHAM, GAILEN D. MARSHALL, DOROTHY E. LEWIS, MADELEINE DUVIC. (1998) Distinct Serum Cytokines in AIDS-Related Skin Diseases. Viral Immunology 11:4, 215-220
CrossRef226
Henrik Hjalgrim, Morten Frisch, Eero Pukkala, Hrafn Tulinius, Anders Ekbom, Michael Dictor, Frøydis Langmark, Sverrir Hardarson, Mads Melbye. (1997) Risk of second cancers in classical Kaposi's sarcoma. International Journal of Cancer 73:6, 840-843
CrossRef227
Margaret M. Kennedy, Sebastian B. Lucas, Robin Russell-Jones, David D. Howells, Steve J. Picton, Angela Bardon, Iain L. Comley, James O'D. McGee, John J. O'Leary. (1997) HHV8 and female Kaposi's sarcoma. The Journal of Pathology 183:4, 447-452
CrossRef228
Luca Di Alberti, Adriano Piatteli, Luciano Artese, Gianfranco Favia, Sushil Patel, Nicholas Saunders, Stephen R Porter, Crispian M Scully, Siew-Lin Ngui, Chong-Gee Teo. (1997) Human herpesvirus 8 variants in sarcoid tissues. The Lancet 350:9092, 1655-1661
CrossRef229
E B. Quinlivan, D Ye, R S. Wehbie, P W. Stewart, M Flepp, P L. Vernazza. (1997) Kaposiʼs sarcoma patients in the Swiss HIV Cohort Study with and without detectable human herpesvirus 8 in peripheral blood mononuclear cells. AIDS 11:15, 1893-1895
CrossRef230
Reinhold Munker, Taizo Tasaka, Dorothy Park, Carl W. Miller, H. Phillip Koeffler. (1997) HHV-8 (KSHV) does not establish latency in prostate cancer cell lines. The Prostate 33:4, 286-288
CrossRef231
G MIROWSKI, J BETTENCOURT, A HOOD. (1997) Oral infections in the immunocompromised host. Seminars in Cutaneous Medicine and Surgery 16:4, 249-256
CrossRef232
Ashlee V. Moses, Sally E. Williams, Joanne G. Strussenberg, Marika L. Heneveld, Rebecca A. Ruhl, Antony C. Bakke, Grover C. Bagby, Jay A. Nelson. (1997) HIV-1 induction of CD40 on endothelial cells promotes the outgrowth of AIDS-associated B-cell lymphomas. Nature Medicine 3:11, 1242-1249
CrossRef233
Jean Feuillard, Jean-Thierry Aubin, Laurent Poirel, Frédéric Davi, Michèle Kujas, Marie-Christine Rousselet, Régis Angonin, Martine Raphaël, Henri Agut. (1997) Detection rate and intratumoral virus load of human herpesvirus-8 in immunodeficiency-related B-cell lymphoid malignancies. Journal of Medical Virology 53:3, 277-281
CrossRef234
Marcelo G. Horenstein, Ethel Cesarman, Xiao Wang, Irina Linkov, Victor G. Prieto, Diane C. Louie. (1997) Cyclin D1 and retinoblastoma protein expression in Kaposi's sarcoma. Journal of Cutaneous Pathology 24:10, 585-589
CrossRef235
John L. Ziegler, Robert Newton, Edward Katongole-Mbidde, Sam Mbulataiye, Kevin De Cock, Henry Wabinga, Joshua Mugerwa, Elly Katabira, Harold Jaffe, D Max Parkin, Gillian Reeves, Robin Weiss, Valerie Beral. (1997) Risk factors for Kaposiʼs sarcoma in HIV-positive subjects in Uganda. AIDS 11:13, 1619-1626
CrossRef236
Sabine Kohler, Onsi W. Kamel, Pearl P. Chang, Bruce R. Smoller. (1997) Absence of human herpesvirus 8 and Epstein-Barr virus genome sequences in cutaneous epithelial neoplasms arising in immunosuppressed organ-transplant patients. Journal of Cutaneous Pathology 24:9, 559-563
CrossRef237
Irene Moysset, Josep Lloreta, Ana Miguel, Caterina Vadell, Teresa Ribalta, Teresa Estrach, Sergi Serrano. (1997) Thymoma associated with CD4+ lymphopenia, cytomegalovirus infection, and Kaposi's sarcoma. Human Pathology 28:10, 1211-1213
CrossRef238
ORNELLA FLORE, SHOU-JIANG GAO. (1997) Effect of DNA Synthesis Inhibitors on Kaposi's Sarcoma-Associated Herpesvirus Cyclin and Major Capsid Protein Gene Expression. AIDS Research and Human Retroviruses 13:14, 1229-1233
CrossRef239
Maria M. Medveczky, Elizabeth Horvath, Troy Lund, Peter G. Medveczky. (1997) In vitro antiviral drug sensitivity of the Kaposiʼs sarcoma-associated herpesvirus. AIDS 11:11, 1327-1332
CrossRef240
Israel Penn. (1997) KAPOSI'S SARCOMA IN TRANSPLANT RECIPIENTS. Transplantation 64:5, 669-673
CrossRef241
Bryan T.-Y Lin, Lawrence M Weiss. (1997) Primary plasmacytoma of lymph nodes. Human Pathology 28:9, 1083-1090
CrossRef242
Hideaki Kikuta, Osamu Itakura, Tadashi Ariga, Kunihiko Kobayashi. (1997) Detection of human herpesvirus 8 DNA sequences in peripheral blood mononuclear cells of children. Journal of Medical Virology 53:1, 81-84
CrossRef243
R. Gyulai, L. Kemeny, M. Kiss, S. Nagy, É. Áám, F. Nagy, A. Dobozy. (1997) Human herpesvirus 8 DNA sequences in angiosarcoma of the face. British Journal of Dermatology 137:3, 467-468
CrossRef244
Amy Chadburn, Ethel Cesarman, Roland G. Nador, Yi Fang Liu, Daniel M. Knowles. (1997) Kaposi's sarcoma-associated herpesvirus sequences in benign lymphoid proliferations not associated with human immunodeficiency virus. Cancer 80:4, 788-797
CrossRef245
Ashley T. Haase. (1997) Viral gene expression and pathogenesis in three emerging diseases: HIV and AIDS; HTLV-I and HAM/TSP; and HHV-8 and Kaposi's sarcoma. FEMS Immunology & Medical Microbiology 18:4, 301-305
CrossRef246
Peter C Doherty, Ralph A Tripp, Anne-Marie Hamilton-Easton, Rhonda D Cardin, David L Woodland, Marcia A Blackman. (1997) Tuning into immunological dissonance: an experimental model for infectious mononucleosis. Current Opinion in Immunology 9:4, 477-483
CrossRef247
Donald S Karcher, Serhan Alkan. (1997) Human herpesvirus-8-associated body cavity-based lymphoma in human immunodeficiency virus-infected patients: A unique B-cell neoplasm. Human Pathology 28:7, 801-808
CrossRef248
Louise A. Brooks, Andrew J. Wilson, Tim Crook. (1997) Kaposi's sarcoma-associated herpesvirus (KSHV)/human herpesvirus 8 (HHV8)—a new human tumour virus. The Journal of Pathology 182:3, 262-265
CrossRef249
Jean-Jacques Lefrère, Martine Mariotti, Robert Girot, Pascale Loiseau, Patrick Hervé. (1997) Transfusional risk of HHV-8 infection. The Lancet 350:9072, 217
CrossRef250
Gieri Cathomas, Michael Tamm, Christine E. McGandy, Peter H. Itin, Fred Gudat, Gilbert Thiel, Michael J. Mihatsch. (1997) TRANSPLANTATION-ASSOCIATED MALIGNANCIES. Transplantation 64:1, 175-178
CrossRef251
Y Endo. (1997) Molecular characteristics of malignant lymphomas in cats naturally infected with feline immunodeficiency virus. Veterinary Immunology and Immunopathology 57:3-4, 153-167
CrossRef252
INÊS DOURADO, OTONIEL MARTÍNEZ-MAZA, TADAMITSU KISHIMOTO, HIROMASA SUZUKI, ROGER DETELS. (1997) Interleukin 6 and AIDS-Associated Kaposi's Sarcoma: A Nested Case Control Study within the Multicenter AIDS Cohort Study. AIDS Research and Human Retroviruses 13:9, 781-788
CrossRef253
J Bouwes Bavinck. (1997) HPV infections and immunosuppression. Clinics in Dermatology 15:3, 427-437
CrossRef254
Susan Engelbrecht, Florette K. Treurnicht, Johann W. Schneider, H. Francois Jordaan, Jan G. Steytler, Peter A. B. Wranz, Estrelita J. van Rensburg. (1997) Detection of human herpes virus 8 DNA and sequence polymorphism in classical, epidemic, and iatrogenic Kaposi's sarcoma in South Africa. Journal of Medical Virology 52:2, 168-172
CrossRef255
E. BERTI, A.V MARZANO, I. DECLEVA, G. BESTETTI, M. PIZZUTO, L. POIREL, M. CAPRA, C. PARRAVICINI, M. CORBELLINO. (1997) Simultaneous onset of primary cutaneous B-cell lymphoma and human herpesvirus 8-associated Kaposi's sarcoma. British Journal of Dermatology 136:6, 924-929
CrossRef256
Lester F. Libow, Susan L. Fraser, Thomas J. Casey, Richard James. (1997) The development of Kaposi's sarcoma during immunosuppressive therapy for temporal arteritis. Journal of the European Academy of Dermatology and Venereology 8:3, 245-250
CrossRef257
Ulrike Serfling, Ansgar Lukowsky, Heike Audring, W. Sterry. (1997) Search for Kaposi's sarcoma-associated virus DNA in hemangioproliferative disorders and cutaneous malignant lymphoma. Journal of Cutaneous Pathology 24:5, 298-304
CrossRef258
(1997) Intralesional Human Chorionic Gonadotropin for Kaposi's Sarcoma. New England Journal of Medicine 336:16, 1187-1189
Full Text259
M. O'Reilly, C. Bergin, F. Mulcahy. (1997) AIDS-related malignancies in Ireland 1987–1994. Journal of the European Academy of Dermatology and Venereology 8:2, 116-120
CrossRef260
Enza Viviano, Francesco Vitale, Francesca Ajello, Anna Maria Perna, Maria Rosaria Villafrate, Filippa Bonura, Mario Aricò, Giovanni Mazzola, Nino Romano. (1997) Human herpesvirus type 8 DNA sequences in biological samples of HIV-positive and negative individuals in Sicily. AIDS 11:5, 607-612
CrossRef261
Ronit Sarid, Takaaki Sato, Roy A. Bohenzky, James J. Russo, Yuan Chang. (1997) Kaposi's sarcoma-associated herpesvirus encodes a functional Bcl-2 homologue. Nature Medicine 3:3, 293-298
CrossRef262
Winston Cavert. (1997) VIRAL INFECTIONS IN HUMAN IMMUNODEFICIENCY VIRUS DISEASE. Medical Clinics of North America 81:2, 411-426
CrossRef263
Kari-Josef Kallen, Karl-Hermann Meyer zum Büschenfelde, Stefan Rose-John. (1997) The therapeutic potential of interleukin-6 hyperagonists and antagonists. Expert Opinion on Investigational Drugs 6:3, 237-266
CrossRef264
Susan E. Krown. (1997) ACQUIRED IMMUNODEFICIENCY SYNDROME–ASSOCIATED KAPOSI'S SARCOMA. Medical Clinics of North America 81:2, 471-494
CrossRef265
David J Blackbourn, John Ambroziak, Evelyne Lennette, Melanie Adams, Bineetha Ramachandran, Jay A Levy. (1997) Infectious human herpesvirus 8 in a healthy North American blood donor. The Lancet 349:9052, 609-611
CrossRef266
Frank Hartmann, Michael Pfreundschuh. (1997) Onkologie ’96. Medizinische Klinik 92:2, 83-100
CrossRef267
Mocarski, Edward S. Jr.. (1997) Propagating Kaposi's Sarcoma–Associated Herpesvirus. New England Journal of Medicine 336:3, 214-215
Full Text268
Foreman, Kimberly E., Friborg, Jacques Jr., Kong, Wing-pui, Woffendin, Clive, Polverini, Peter J., Nickoloff, Brian J., Nabel, Gary J., . (1997) Propagation of a Human Herpesvirus from AIDS-Associated Kaposi's Sarcoma. New England Journal of Medicine 336:3, 163-171
Full Text269
J. D. Lundgren. (1997) Kaposi's Sarcoma and its Management in AIDS Patients: Recommendations from a Scandinavian Study Group. Scandinavian Journal of Infectious Diseases 29:1, 3-12
CrossRef270
Thomas L. Benfield, Karen K. Dodt, Jens D. Lundgren. (1997) Human Herpes Virus-8 DNA in Bronchoalveolar Lavage Samples from Patients with AIDS-associated Pulmonary Kaposi's Sarcoma. Scandinavian Journal of Infectious Diseases 29:1, 13-16
CrossRef271
G Nasti, E Vaccher, D Errante, U Tirelli. (1997) Malignant tumors and AIDS. Biomedicine & Pharmacotherapy 51:6-7, 243-251
CrossRef272
C.P. Cottrill, D.M. Bottomley, R.H. Phillips. (1997) Cancer and HIV infection. Clinical Oncology 9:6, 365-380
CrossRef273
Fabienne Montmayeur, Stanislaw Krajewski, Fran??oise Bejui-Thivolet, Daniel Schlaifer, Georges Delsol, John C. Reed, Pierre Brousset. (1997) In Vivo Patterns of Apoptosis-Regulating Protein Expression in Kaposi's Sarcoma. Applied Immunohistochemistry 5:2, 104-110
CrossRef274
Jean-Christophe Noel, Florence De Their, Michel Heenen, Isabelle Fayt, Daniel Abramowicz, Jean-Marc Doutrelepont. (1997) HHV-8 is associated with recurrent Kaposi's sarcoma in a renal transplant recipient. Transplant International 10:1, 81-82
CrossRef275
Christiane Schieferstein. (1997) Typenspezifische Herpes Simplex Virus-Antikörper: Vergleich verschiedener ELlSA-Testsysteme und eines Western blot. LaboratoriumsMedizin 21:2, 107-119
CrossRef276
Sylvia W. Wright, Richard A. Johnson. (1997) Human immunodeficiency virus in women: Mucocutaneous manifestations. Clinics in Dermatology 15:1, 93-111
CrossRef277
Robert J. Biggar, Philip S. Rosenberg, Timothy Coté, Multistate AIDS/ Cancer Match Study Group. (1996) Kaposi's sarcoma and non-Hodgkin's lymphoma following the diagnosis of AIDS. International Journal of Cancer 68:6, 754-758
CrossRef278
Dorothy A. White. (1996) PULMONARY COMPLICATIONS OF HIV-ASSOCIATED MALIGNANCIES. Clinics in Chest Medicine 17:4, 755-761
CrossRef279
Adriana Albini, Raffaella Soldi, Daniela Giunciuclio, Enrico Girauo, Roberto Benelli, Luca Primo, Douglas Noonan, Mariolina Salio, Giovanni Camussi, Wolfang Rock, Federico Bussolino. (1996) The angiogenesis induced by HIV–1 Tat protein is mediated by the Flk–1/KDR receptor on vascular endothelial cells. Nature Medicine 2:12, 1371-1375
CrossRef280
Bruce Polsky. (1996) TREATMENT OF HIV INFECTION AND ITS COMPLICATIONS. Clinics in Chest Medicine 17:4, 647-663
CrossRef281
Umberto Tirelli, Domenico Errante, Antonino Carbone, Annunziata Gloghini, Emanuela Vaccher. (1996) Malignant tumors in patients with HIV infection. Critical Reviews in Oncology/Hematology 24:3, 165-184
CrossRef282
Krishna V. Komanduri, Judith A. Luce, Michael S. McGrath, Brian G. Herndier, Valerie L. Ng. (1996) The Natural History and Molecular Heterogeneity of HIV-Associated Primary Malignant Lymphomatous Effusions. Journal of Acquired Immune Deficiency Syndromes and Human Retrovirology 13:3, 215-226
CrossRef283
Robert J. Biggar, Charles S. Rabkin. (1996) THE EPIDEMIOLOGY OF AIDS-RELATED NEOPLASMS. Hematology/Oncology Clinics of North America 10:5, 997-1010
CrossRef284
Louis Flamand, Robert A. Zeman, Joseph L. Bryant, Yanto Lunardi-Iskandar, Robert C. Gallo. (1996) Rapid Communication: Absence of Human Herpesvirus 8 DNA Sequences in Neoplastic Kaposi's Sarcoma Cell Lines. Journal of Acquired Immune Deficiency Syndromes and Human Retrovirology 13:2, 194-197
CrossRef285
Guy R Simpson, Thomas F Schulz, Denise Whitby, Pamela M Cook, Chris Boshoff, Lucille Rainbow, Mark R Howard, Shou-Jiang Gao, Roy A Bohenzky, Peter Simmonds, Christine Lee, Annemiek de Ruiter, Angelos Hatzakis, Richard S Tedder, Ian VD Weller, Robin A Weiss, Patrick S Moore. (1996) Prevalence of Kaposi's sarcoma associated herpesvirus infection measured by antibodies to recombinant capsid protein and latent immunofluorescence antigen. The Lancet 348:9035, 1133-1138
CrossRef286
Daniel M. Knowles. (1996) ETIOLOGY AND PATHOGENESIS OF AIDS-RELATED NON-HODGKIN'S LYMPHOMA. Hematology/Oncology Clinics of North America 10:5, 1081-1109
CrossRef287
D. S. Stein, N. M. H. Graham. (1996) Interaction of Herpes Viruses with HIV: Can Antiherpes Drugs Prolong Survival Among AIDS Patients?. Reviews in Medical Virology 6:3, 163-172
CrossRef288
Margaret K. Offermann, Jung-Chung Lin, Eng-Chun Mar, Renee Shaw, Jing Yang, Russell M. Medford. (1996) Antioxidant-Sensitive Regulation of Inflammatory-Response Genes in Kaposi's Sarcoma Cells. Journal of Acquired Immune Deficiency Syndromes and Human Retrovirology 13:1, 1-11
CrossRef289
A. F. Voevodin. (1996) Human Herpesvirus, Type 8. Early Days. Reviews in Medical Virology 6:3, 173-178
CrossRef290
Jean-Marc Doutrelepont, Luc De Pauw, Scott A. Gruber, David L. Dunn, Wajeh Qunibi, Paul Kinnaert, Pierre Vereerstraeten, Israel Penn, Daniel Abramowicz. (1996) RENAL TRANSPLANTATION EXPOSES PATIENTS WITH PREVIOUS KAPOSI'S SARCOMA TO A HIGH RISK OF RECURRENCE1. Transplantation 62:4, 463-466
CrossRef291
Dean H. Kedes, Eva Operskalski, Michael Busch, Robert Kohn, Jennifer Flood, Don Ganem. (1996) The seroepidemiology of human herpesvirus 8 (Kaposi's sarcoma–associated herpesvirus): Distribution of infection in KS risk groups and evidence for sexual transmission. Nature Medicine 2:8, 918-924
CrossRef292
Gao, Shou-Jiang, Kingsley, Lawrence, Hoover, Donald R., Spira, Thomas J., Rinaldo, Charles R., Saah, Alfred, Phair, John, Detels, Roger, Parry, Preston, Chang, Yuan, Moore, Patrick S., . (1996) Seroconversion to Antibodies against Kaposi's Sarcoma–Associated Herpesvirus–Related Latent Nuclear Antigens before the Development of Kaposi's Sarcoma. New England Journal of Medicine 335:4, 233-241
Full Text293
Mark A. Brown, Jeffrey P. Nadler. (1996) INFECTIONS IN HIV-INFECTED PATIENTS WITH MALIGNANCY. Infectious Disease Clinics of North America 10:2, 401-412
CrossRef294
R. McKenzie, S. E. Straus. (1996) Vaccine Therapy for Herpes Simplex Virus Infections: An Historical Perspective. Reviews in Medical Virology 6:2, 85-96
CrossRef295
M. CORBELLINO, L. POIREL, G. BESTETTI, M. PIZZUTO, J.T. AUBIN, M. CAPRA, C. BIFULCO, E. BERTI, H. AGUT, G. RIZZARDINI, M. GALLI, C. PARRAVICINI. (1996) Restricted Tissue Distribution of Extralesional Kaposi's Sarcoma-Associated Herpesvirus-Like DNA Sequences in AIDS Patients with Kaposi's Sarcoma. AIDS Research and Human Retroviruses 12:8, 651-657
CrossRef296
Miller, George, Rigsby, Michael O., Heston, Lee, Grogan, Elizabeth, Sun, Ren, Metroka, Craig, Levy, Jay A., Gao, Shou-Jiang, Chang, Yuan, Moore, Patrick, . (1996) Antibodies to Butyrate-Inducible Antigens of Kaposi's Sarcoma–Associated Herpesvirus in Patients with HIV-1 Infection. New England Journal of Medicine 334:20, 1292-1297
Full Text297
Corbellino, Mario, , Parravicini, Carlo, , Aubin, Jean Thierry, , Berti, Emilio, . (1996) Kaposi's Sarcoma and Herpesvirus-Like DNA Sequences in Sensory Ganglia. New England Journal of Medicine 334:20, 1341-1341
Full Text298
Mario Luppi, Patrizia Barozzi, Antonio Maiorana, Guido Collina, M. Grazia Ferrari, Roberto Marasca, Monica Morselli, Elena Rossi, Luca Ceccherini-Nelli, Giuseppe Torelli. (1996) Frequency and distribution of herpesvirus-like DNA sequences (KSHV) in different stages of classic Kaposi's sarcoma and in normal tissues from an Italian population. International Journal of Cancer 66:4, 427-431
CrossRef299
J.-C. Noel, P. Hermans, J. Andre, I. Fayt, Th. Simonart, A. Verhest, J. Haot, A. Burny. (1996) Herpesvirus-like DNA sequences and Kaposi's sarcoma: Relationship with epidemiology, clinical spectrum, and histologic features. Cancer 77:10, 2132-2136
CrossRef300
Monini, Paolo, de Lellis, Laura, Fabris, MarinaRigolin, Franco, Cassai, Enzo, . (1996) Kaposi's Sarcoma–Associated Herpesvirus DNA Sequences in Prostate Tissue and Human Semen. New England Journal of Medicine 334:18, 1168-1172
Full Text301
Alain Lafeuillade, Gilles Kaplanski, Thierry Allegre, Jean Pierre de Jaureguiberry. (1996) IL-6 and b-FGF Overproductions Precede Development of AIDS-Associated Kaposi's Sarcoma. Journal of Acquired Immune Deficiency Syndromes and Human Retrovirology 12:1, 95
CrossRef302
Habibul Ahsan, Alfred I. Neugut. (1996) High risk of Kaposi's sarcoma and central nervous system lymphoma in the same individuals: A finding related to acquired immunodeficiency syndrome. International Journal of Cancer 66:2, 176-178
CrossRef303
Yasuhiko Tomita, Norifumi Naka, Katsuyuki Aozasa, Ethel Cesarman, Daniel M. Knowles. (1996) Absence of Kaposi's-sarcoma-associated herpesvirus-like DNA sequences (KSHV) in angiosarcomas developing in body-activated and other sites. International Journal of Cancer 66:1, 141-142
CrossRef304
Natalie Sutkowski, David A. Thorley-Lawson, Brigitte T. Huber. (1996) The interplay of herpesviruses in AIDS: superantigen sharing. Trends in Microbiology 4:3, 89-91
CrossRef305
Rolf Renne, Weidong Zhong, Brian Herndier, Michael Mcgrath, Nancy Abbey, Dean Kedes, Don Ganem. (1996) Lytic growth of Kaposi's sarcoma–associated herpesvirus (human herpesvirus 8) in culture. Nature Medicine 2:3, 342-346
CrossRef306
Lajos Kemeny, Maria Kiss, Rolland Gyulai, Attila Dobozy, Eva Adam, Ference Nagy. (1996) Herpesvirus-Like Nucleic Acid Sequences in Patients with Eastern European Sporadic Kaposi's Sarcoma.. Journal of Investigative Dermatology 106:2, 381-381
CrossRef307
John F. Murray, M. D. (1996) PULMONARY COMPLICATIONS OF HIV INFECTION. Annual Review of Medicine 47:1, 117-126
CrossRef308
(1996) Body-Cavity–Based Lymphoma in an HIV-Seronegative Patient without Kaposi's Sarcoma–Associated Herpesvirus-Like DNA Sequences. New England Journal of Medicine 334:4, 272-273
Full Text309
H.W. Haverkos. (1996) Is Kaposi's sarcoma caused by new herpesvirus?. Biomedicine & Pharmacotherapy 50:6-7, 318-319
CrossRef310
Jean-Christophe Noel, Florence Thier, Michel Heenen, Isabelle Fayt, Daniel Abramowicz, Jean-Marc Doutrelepont. (1996) HHV-8 is associated with recurrent Kaposi's sarcoma in a renal transplant recipient. Transplant International 10:1, 81-82
CrossRef311
Umberto Tirelli, Domenico Errante, Antonino Carbone, Annunziata Gloghinf, Emanuela Vaccher. (1996) Malignant Lymphomas in Patients with HIV Infection. Leukemia & Lymphoma 22:3-4, 245-257
CrossRef312
Natsuo Tachikawa, Mieko Goto, Hiroyuki Gatanaga, Harutaka Katano, Shinichi Oka, Tomo Wakabayashi, Shigeo Mori, Aikichi Iwamoto. (1996) Herpesvirus-like DNA sequences in Japanese patients with AIDS-related kaposi's sarcoma. Journal of Infection and Chemotherapy 1:3, 190-192
CrossRef313
Eliane Gluckman, Nathalie Parquet, Catherine Scieux, Martine Deplanche, Richard Traineau, Philippe Betheau, Frédéric Morinet. (1995) KS-associated herpesvirus-like DNA sequences after allogeneic bone-marrow transplantation. The Lancet 346:8989, 1558-1559
CrossRef314
Volker Adams, Werner Kempf, Mirka Schmid, Beatrice Müller, Jakob Bnner, Günther Burg. (1995) Absence of herpesvirus-like DNA sequences in skin cancers of non-immunosuppressed patients. The Lancet 346:8991-8992, 1715-1716
CrossRef315
Chris Boshoff, Thomas F. Schulz, Margaret M. Kennedy, Andrew K. Graham, Cyril Fisher, Alero Thomas, J. O'D. McGee, Robin A. Weiss, John J. O'Leary. (1995) Kaposi's sarcoma-associated herpesvirus infects endothelial and spindle cells. Nature Medicine 1:12, 1274-1278
CrossRef316
S.G. Julio Montaner, Martin T Schechter. (1995) A year of transformation in HIV/AIDS. The Lancet 346, S12
CrossRef317
J.C. Lin, S.C. Lin, E.C. Mar, P.E. Pellett, F.R. Stamey, J.A. Stewart, T.J. Spira. (1995) Is Kaposi's-sarcoma-associated herpesvirus detectable in semen of HIV-infected homosexual men?. The Lancet 346:8990, 1601-1602
CrossRef318
Kaposi'S Sarcomas, Peter L. Rady, Angela Yen, Robert W. Martin, Ioan Nedelcu, Thomas K. Hughes, Stephen K. Tyring. (1995) Herpesvirus-like DNA sequences in classic Kaposi's Sarcomas. Journal of Medical Virology 47:2, 179-183
CrossRef319
(1995) Herpes-Like DNA Sequences, AIDS-Related Tumors, and Castleman's Disease. New England Journal of Medicine 333:12, 797-799
Full Text320
Roizman, Bernard, . (1995) New Viral Footprints in Kaposi's Sarcoma. New England Journal of Medicine 332:18, 1227-1228
Full Text
- Letters
