Original Article
Mutation in the Gene Coding for Coagulation Factor V and the Risk of Myocardial Infarction, Stroke, and Venous Thrombosis in Apparently Healthy Men
N Engl J Med 1995; 332:912-917April 6, 1995
- Abstract
Background
A specific point mutation in the gene coding for coagulation factor V is associated with resistance to degradation by activated protein C, a recently described abnormality of coagulation that may be associated with an increased risk of venous thrombosis. Whether this mutation also predisposes patients to arterial thrombosis is unknown, as is the value of screening for the mutation in order to define the risk of venous thrombosis among unselected healthy people.
Methods
Among 14,916 apparently healthy men in the physicians' Health Study who provided base-line blood samples, 374 had myocardial infarctions, 209 had strokes, and 121 had deep venous thrombosis, pulmonary embolism, or both, during a mean follow-up of 8.6 years. We determined whether a mutation at nucleotide position 1691 of the factor V gene was present or absent in these 704 men and in an equal number of matched participants who remained free of vascular disease.
Results
The prevalence of heterozygosity for the mutation among men who had myocardial infarctions (6.1 percent, P = 0.9) or strokes (4.3 percent, P = 0.4) was similar to that among men who remained free of vascular disease (6.0 percent). However, the prevalence of the mutation was significantly higher among men who had venous thrombosis, pulmonary embolism, or both (11.6 percent, P = 0.02). In adjusted analyses, the relative risk of venous thrombosis among men with the mutation was 2.7 (95 percent confidence interval, 1.3 to 5.6; P = 0.008). This increased risk was seen with primary venous thrombosis (relative risk, 3.5; 95 percent confidence interval, 1.5 to 8.4; P = 0.004) but not with secondary venous thrombosis (relative risk, 1.7; 95 percent confidence interval, 0.6 to 5.3; P = 0.3), and it was most apparent among older men. Specifically, the prevalence of the mutation among men over the age of 60 in whom primary venous thrombosis developed was 25.8 percent (relative risk, 7.0; 95 percent confidence interval, 2.6 to 19.1; P < 0.001).
Conclusions
In a large cohort of apparently healthy men, the presence of a specific point mutation in the factor V gene was associated with an increased risk of venous thrombosis, particularly primary venous thrombosis. The presence of the mutation was not associated with an increased risk of myocardial infarction or stroke. This mutation appears to be the most common inherited factor thus far recognized that predisposes patients to venous thrombosis.
Media in This Article
Figure 2
Adjusted Relative Risk Associated with Primary and Secondary Deep venous Thrombosis or Pulmonary Embolism in Study Subjects with the Factor V Mutation.Figure 1
Prevalence of Heterozygosity for the factor V Mutation among 1408 Apparently Healthy Men in the Physicians' Health Study.Article Activity
- Article
A point mutation in which adenine is substituted for guanine at nucleotide 1691 in the gene coding for coagulation factor V has recently been reported to be associated with resistance to degradation by activated protein C.1-4 In selected referral patients evaluated in retrospective case–control studies, this functional abnormality of hemostasis appears to be associated with an increased risk of venous thromboembolism.5-9 Resistance to activated protein C has been described in 7 percent of a Swedish control group,6 whereas the G1691A mutation in the factor V gene is present in 3 to 5 percent of the Dutch population.2,7 Among selected young patients with venous thrombosis but no underlying cancer, the prevalence of resistance to activated protein C has ranged from 20 percent to 60 percent.2,6,8 Thus, the available data suggest that this newly described genetic abnormality of coagulation may be substantially more frequent than all other known inherited predispositions to thrombosis.10,11
It is unknown whether the mutation in the factor V gene predisposes healthy people to venous thrombosis. Furthermore, whether resistance to activated protein C is associated with arterial thrombosis is unknown, although several factors associated with coagulation, fibrinolysis, or both, including fibrinogen,12-14 factor VII,13 fibrin degradation products,15,16 tissue plasminogen activator,17,18 and plasminogen-activator inhibitor,19,20 have all been associated with an increased risk of myocardial infarction, stroke, or both. We therefore investigated whether resistance to activated protein C, as assessed by the presence of the G1691A mutation in the factor V gene, was associated with the occurrence of thrombosis in the coronary and cerebral arterial circulations, as well as in venous vessels.
Methods
We evaluated the presence of the G1691A mutation in the coagulation factor V gene and the risk of thrombosis by studying prospectively collected DNA samples from a cohort of apparently healthy men participating in the Physicians' Health Study,21 a randomized, double-blind, placebo-controlled trial of aspirin and beta carotene for the primary prevention of cardiovascular disease and cancer. The details of the Physicians' Health Study have been presented elsewhere21; in brief, 22,071 predominantly white U.S. male physicians 40 to 84 years old who were free of prior myocardial infarction, stroke, transient ischemic attack, and cancer were randomly assigned in a two-by-two factorial design to one of four treatments: 325 mg of aspirin (Bufferin, Bristol-Myers Squibb), given on alternate days; 50 mg of beta carotene (Lurotin, BASF), given on alternate days; both; and neither. Six months after randomization and once a year thereafter, these physicians were sent questionnaires on which they were asked to assess risk factors and disease outcomes; follow-up has been completed for all deaths and for 99.7 percent of all reported morbid events.
At the time of enrollment, all potentially eligible men were assigned to receive aspirin as an active drug and placebo manufactured to resemble beta carotene during an 18-week run-in period in order to identify those with potentially good compliance for long-term follow-up. During the run-in period, all participants were asked to provide base-line EDTA-anticoagulated samples of whole blood and to return them to the laboratory in a cold pack by overnight courier. On arrival in the laboratory, the specimens were divided into aliquots and stored at -80°C. Of the 22,071 physicians randomized, 14,916 returned base-line blood samples (68 percent).
For all reported cases of fatal or nonfatal myocardial infarction, stroke, deep venous thrombosis, or pulmonary embolism occurring after randomization, the hospital records were requested. These records, as well as death certificates and autopsy reports, were reviewed by an end-points committee of physicians who used standardized criteria to confirm or reject the diagnosis of each reported event. A diagnosis of myocardial infarction was considered to be confirmed if the reported event met the World Health Organization criteria for myocardial infarction, which include symptoms plus either elevations of cardiac-enzyme levels or diagnostic changes on the electrocardiogram.22 In the case of a fatal myocardial infarction, we also accepted diagnoses based on autopsy findings and deaths confirmed by the medical records as due to coronary heart disease (codes 411 to 414 of the International Classification of Diseases). A diagnosis of stroke was considered to be confirmed if the patient had a new focal neurologic deficit and if the symptoms and signs persisted for more than 24 hours. Computed tomographic scans were available for more than 95 percent of the confirmed strokes. A diagnosis of deep venous thrombosis was considered to be confirmed when there was documentation of a positive venographic study or a positive ultrasonographic study. Reported cases of deep venous thrombosis that were documented by impedance plethysmography or Doppler examination but not by ultrasonography were not considered confirmed. A diagnosis of pulmonary embolism was considered to be confirmed when a positive angiogram or a completed ventilation–perfusion scan showed at least two segmental perfusion defects without ventilation defects. Venous thrombosis associated with cancer or occurring postoperatively was classified as a secondary event. All other venous thromboses were classified as primary events.
According to the study's nested case–control design, each physician who provided an adequate sample of whole blood at base line and had a confirmed myocardial infarction, stroke, deep venous thrombosis, or pulmonary embolism after randomization was matched to one control. The controls were participating physicians, each of whom had provided a base-line sample of whole blood and reported no cardiovascular disease at the time the arterial or venous event occurred in the case patient. The controls were selected at random from among participants who met the matching criteria of age (within one year of the age of the case patient), smoking habits (current smoker, former smoker, or person who never smoked), and time since randomization (in six-month intervals).
For each case patient and each control, the whole blood collected and stored at base line was thawed and underwent DNA extraction. A commercially available process was used that was based on the absorption of DNA to a silica membrane after lysis with a proprietary agent (Diagen) and proteinase K in the presence of a high salt concentration and 33 percent isopropanol. Genotype assays using the polymerase-chain-reaction (PCR) technique were performed in a second laboratory, where the investigators and laboratory personnel were unaware of each subject's status as a case patient or control. Extracted DNA samples from the case patients and controls were analyzed in pairs, with the sequence varied at random within the pairs to avoid systematic bias.
The samples in each pair were handled together and in an identical manner throughout the processing and analysis. In brief, the G1691A mutation in exon 10 (nucleotides 1487 to 1701) was detected by the loss of a cleavage site for MnlI. A 267-base-pair (bp) fragment spanning the exon–intron junction was amplified from genomic DNA as described by Bertina et al.2; an additional sequence from intron 10 was obtained by sequencing the product from 24 samples. Subsequently, an optimized 5' primer (5'ACCCACAGAAAATGATGCCCAG3', nucleotides 1566 to 1587) and a new 3' primer (5'TGCCCCATTATTTAGCCAGGAG3', nucleotides -66 to -87 of intron 10) were used to amplify a 223-bp fragment from genomic DNA samples. The PCR conditions were as follows: 75 to 150 ng of DNA in 15 μl of TRIS–EDTA buffer (10 mM TRIS and 0.1 mM EDTA; pH 8.0) under 50 μl of mineral oil was heated in a Hybaid thermal cycler to 96°C for 60 seconds and 95°C for 180 seconds, and then held at 80°C for 10 minutes while 35 μl of amplification solution was added that contained 5 μl of 20 mM solution of each of the deoxynucleoside triphosphates (adenosine triphosphate, cytidine triphosphate, thymidine triphosphate, and guanosine triphosphate), 200 ng of each primer, 0.1 μl of 1.0 M magnesium chloride, and 0.5 U of Taq polymerase (Promega). Thirty cycles of 93°C for 60 seconds, 50°C for 30 seconds, and 72°C for 90 seconds were followed by a final 10 minutes at 72°C. Aliquots (10 μl) were digested for 12 hours at 37°C with 1 U MnlI (New England Biolabs) after the addition of 2.5 μl of 5× digest buffer (1× digest buffer is 50 mmol sodium chloride, 10 mmol TRIS–hydrochloric acid, 10 mmol magnesium chloride, and 1 mmol dithiothreitol; pH 7.9). The fragments (measuring 37, 82, and 104 bp for the 1691G allele, and 82 and 141 bp for 1691A) were then separated on 2 percent agarose gels and visualized with ethidium bromide. The presence of the G1691A mutation was confirmed in each instance by a second amplification and restriction-enzyme digestion.
In addition to providing blood samples before randomization, the participating physicians also reported their base-line cardiovascular risk factors, which included the matching variables of age and smoking status, as well as their height, weight, systolic and diastolic blood pressure, history of any hypercholesterolemia, parental history of any myocardial infarction before the age of 60, the presence of any diabetes mellitus, and the frequency of vigorous exercise. The body-mass index was calculated as the weight in kilograms divided by the square of the height in meters.
Statistical Analysis
Means and proportions for base-line cardiovascular risk factors and for the presence of the factor V mutation were computed for the case patients and controls. The significance of any difference in means was tested by the paired Student t-test, whereas the significance of any difference in proportions was tested by the chi-square statistic. Logistic-regression analyses were performed to estimate relative risks and 95 percent confidence intervals. Adjusted relative risks were calculated further by logistic-regression models that controlled for the matching variables of age and smoking status as well as for the presence of hypertension, diabetes, hypercholesterolemia, any family history of myocardial infarction before the age of 60, body-mass index, and frequency of exercise. All regression analyses controlled for the treatment assignments, and all P values are two-tailed.
Results
The base-line characteristics of men in whom myocardial infarction, stroke, or venous thrombosis developed during follow-up and those who remained free of cardiovascular disease are shown in Table 1Table 1
Base-Line Clinical Characteristics of 1408 Apparently Healthy Men Participating in the Physicians' Health Study, According to the Development of Cardiovascular Disease during Follow-up.. As expected, the subjects who had myocardial infarction or stroke during follow-up had a higher prevalence of conventional atherosclerotic risk factors at base line than did the control subjects.Among the 704 men who remained free of cardiovascular disease during follow-up, 662 (94.0 percent) were found to be homozygous for the 1691G allele, whereas 42 (6.0 percent) were heterozygous for both the 1691G and the 1691A alleles. No 1691A homozygotes were observed. Thus, the observed frequency of the 1691G allele was 97.0 percent (95 percent confidence interval, 96.0 to 97.8) and that of the 1691A allele 3.0 percent (95 percent confidence interval, 2.2 to 4.1). The observed distribution of genotypes was consistent with that predicted by the Hardy–Weinberg equilibrium.
No statistically significant differences in the prevalence of the factor V mutation were found between the men who had myocardial infarction (6.1 percent, P = 0.9) or stroke (4.3 percent, P = 0.4) during follow-up and the men who remained free of cardiovascular disease (6.0 percent). In contrast, the mutation was significantly more prevalent among men in whom deep venous thrombosis, pulmonary embolism, or both developed during follow-up (11.6 percent, P = 0.02) (Figure 1Figure 1
Prevalence of Heterozygosity for the factor V Mutation among 1408 Apparently Healthy Men in the Physicians' Health Study.).Table 2Table 2
Relative Risk of Myocardial Infarction, Stroke, and Venous Thrombosis Associated with the Presence of the Factor V Mutation. shows the crude and adjusted relative risks of myocardial infarction, stroke, and venous thrombosis that were associated with the presence of the factor V mutation. The adjusted relative risk of myocardial infarction or stroke among heterozygous subjects was 1.3 (95 percent confidence interval, 0.7 to 2.2; P = 0.4). Restricting this analysis to subjects with stroke of clear thromboembolic origin did not materially alter the results. Specifically, the prevalence of the mutation among men with either myocardial infarction or thromboembolic stroke was 5.4 percent (adjusted relative risk, 1.0; 95 percent confidence interval, 0.6 to 1.7; P = 0.9). No association was found between the presence of the factor V mutation and the risk of myocardial infarction or stroke in analyses of subgroups restricted to men 60 years of age or less. Similarly, no association was found among nonsmokers, those with no family history of coronary disease, those with no evidence of hypercholesterolemia, those free of hypertension, or those with all these characteristics (Table 3Table 3
Relative Risk of Myocardial Infarction and Stroke Associated with the Presence of the Factor V Mutation among Subjects without the Usual Coronary Risk Factors.).The adjusted relative risk of deep venous thrombosis, pulmonary embolism, or both among heterozygous subjects was 2.7 (95 percent confidence interval, 1.3 to 5.6; P = 0.008) (Table 2). To explore further the relation between the factor V mutation and the risk of future venous thromboembolism, we repeated these analyses in the 63 subjects with primary venous thrombosis and in the 58 subjects in whom the venous thrombosis was determined to be secondary. In this analysis, the increase in the risk of deep venous thrombosis, pulmonary embolism, or both that was associated with the presence of the mutation appeared to be due principally to primary venous thrombosis (adjusted relative risk, 3.5; 95 percent confidence interval 1.5 to 8.4; P = 0.004) rather than secondary venous thrombosis (adjusted relative risk, 1.7; 95 percent confidence interval, 0.6 to 5.3; P = 0.3) (Figure 2Figure 2
Adjusted Relative Risk Associated with Primary and Secondary Deep venous Thrombosis or Pulmonary Embolism in Study Subjects with the Factor V Mutation.). These effects were most apparent among older men. As shown in Table 4Table 4
Relative Risk of Venous Thrombosis or Pulmonary Embolism Associated with the Presence of the Factor V Mutation among Subjects over the Age of 60., the prevalence of the factor V mutation among men over the age of 60 years in this cohort who subsequently had any venous thrombosis was 17.9 percent (relative risk, 3.3; 95 percent confidence interval, 1.5 to 7.5; P = 0.004). Among men over the age of 60 years who had primary venous thrombosis, the prevalence of the mutation was 25.8 percent (relative risk, 5.3; 95 percent confidence interval, 2.1 to 13.3; P<0.001). In analyses of heterozygous men older than 60 that were adjusted for smoking status, history of hypertension, hypercholesterolemia, body-mass index, diabetes, and family history of coronary disease, the relative risk of any venous thrombosis was 4.0 (95 percent confidence interval, 1.6 to 9.7; P = 0.003) and that of primary deep venous thrombosis was 7.0 (95 percent confidence interval, 2.6 to 19.1; P<0.001).Discussion
Recent investigations into the protein C system have led to major new insights into the process of thrombus formation. In 1993 Dahlback and colleagues5 described resistance to activated protein C, which appeared to be a characteristic of selected patients with venous thromboembolism, particularly those who had positive family histories and were relatively young at presentation.2-9 In rapid succession, studies directed by Bertina2,7 and Dahlback,5,6 as well as the Leiden Thrombophilia Study,7 found that the cofactor responsible for resistance to activated protein C was a previously unrecognized form of coagulation factor V that had normal procoagulant activity but was resistant to degradation by activated protein C. Almost immediately thereafter, these and other researchers reported that resistance to activated protein C is almost always associated with the substitution of a single base at nucleotide 1691 of the gene coding for coagulation factor V, which leads to the replacement of arginine by glutamine.2-4 The presence of arginine in this position is essential for the proteolytic inactivation of factor V by activated protein C.
We have described a large-scale epidemiologic assessment of the factor V mutation in a healthy population of predominantly white men followed prospectively for the occurrence of cardiovascular disease, in particular arterial and venous thrombosis. With regard to arterial thrombosis, there appeared to be no association between the presence of the factor V mutation and the risk of myocardial infarction, stroke from all causes, or thromboembolic stroke over a follow-up period of 8.6 years. Furthermore, there was no association between the factor V mutation and myocardial infarction among younger men or men without risk factors for cardiovascular disease. In contrast, the adjusted relative risk of deep venous thrombosis, pulmonary embolism, or both among men with the mutation was 2.7 times that among men without the mutation (95 percent confidence interval, 1.3 to 5.6; P = 0.008). For events unrelated to recent surgery or cancer, the presence of the mutant allele was associated with a threefold increase in risk (adjusted relative risk, 3.5; 95 percent confidence interval, 1.5 to 8.4; P = 0.004). Among older men in whom primary venous thrombosis developed, the prevalence of the mutation exceeded 25 percent, conferring an adjusted risk of primary venous thromboembolism that was 7.0 times higher than that of men homozygous for the wild-type allele (95 percent confidence interval, 2.6 to 19.1; P<0.001).
Unlike previous studies of resistance to activated protein C, which relied on limited kindreds, patients known to have recurrent idiopathic thromboembolism, or patients referred for the evaluation and treatment of venous thromboembolism,3-9 the current study was based on a large cohort of apparently healthy men who were prospectively followed for the development of cardiovascular disease. Therefore, these findings are not subject to many types of epidemiologic bias that can influence analyses based on case reports, case series, cross-sectional surveys, and retrospective studies of selected referral populations.23 Furthermore, the current study assessed the factor V mutation directly by molecular genetic analysis rather than by relying on functional assays to determine the presence of resistance to activated protein C. Thus, in addition to permitting a prospective evaluation of the relation between the factor V mutation and the risk of venous and arterial thrombosis, these data allowed the frequencies of the wild-type and mutant alleles in a predominantly white North American male population to be estimated precisely. On the basis of the observed data, the allelic frequency of the factor V mutation is 3.0 percent (95 percent confidence interval, 2.2 to 4.1 percent), and the prevalence of the heterozygous state in the population is 6.0 percent (95 percent confidence interval, 4.3 to 8.0 percent). These data provide strong evidence that genetic resistance to activated protein C is the most common inherited predisposition to thrombosis recognized to date.10,11
It is important that the factor V mutation is prevalent among men over the age of 60 who have a first episode of venous thrombosis, because most earlier studies have suggested that thrombosis associated with inherited abnormalities of hemostasis typically presents at a young age (<40 years). Although the association between inherited coagulation defects and thrombosis may be modified by age, it is also possible that age-specific differences between the subjects in our study and those in most previous studies reflect the fact that the referral populations examined in most earlier retrospective analyses did not include adequate numbers of older patients. For example, the mean age of patients with deep venous thrombosis in earlier reports of resistance to activated protein C ranged from 34 to 46 years — far lower than the mean age of 65 reported in community-based surveys of patients presenting with first venous thromboemboli.24 In our prospective study of apparently healthy men, the mean age at the time of the first deep venous thrombosis, pulmonary embolism, or both was 63.2 years. Our finding that the mutation in the factor V gene is an important risk factor for venous thrombosis in older subjects is consistent with observations from the Leiden Thrombophilia Study7 about the prevalence of resistance to activated protein C among patients as old as 70.
From a clinical and public health perspective, these data have important implications. It has been estimated that pulmonary embolism is the primary cause of 50,000 to 100,000 deaths annually in the United States and that it is a contributing cause in tens of thousands of other deaths.25-27 Among older persons hospitalized with pulmonary embolism, 21 percent die during that hospitalization and another 39 percent die over the next 12 months.24,28 Among older patients presenting with deep venous thrombosis, recurrence rates approach 30 percent and one-year mortality exceeds 20 percent.28,29 Thus, the knowledge that 6 percent of the U.S. male population is genetically at increased risk for venous thromboembolism raises the possibility that these people should be identified and treated differently from people without the factor V mutation. For example, it is not known whether patients with the mutation should be treated with more prolonged or more intense anticoagulation after a thrombotic episode or whether they require more aggressive prophylactic regimens in high-risk clinical situations, such as elective hip surgery. Thus, randomized trials to determine whether different anticoagulant regimens are needed by patients with the factor V mutation should be considered seriously. Such studies should ideally include enough women and members of minority groups for associations between the factor V mutation and thrombosis to be evaluated in these populations.
Supported by grants (HL-26490, HL-34595, HL-14147, CA-34944, CA-42182, and CA-40360) from the National Institutes of Health. Dr. Ridker is the recipient of a Clinician Scientist Award from the American Heart Association, Dallas. Dr. Lindpaintner is the recipient of a Research Career Development Award from the National Heart, Lung, and Blood Institute.
We are indebted to Kirsten Williams and Robert Cannon for their technical assistance.
Source Information
From the Divisions of Preventive Medicine (P.M.R., C.H.H.) and Cardiovascular Disease (P.M.R., K.L.) and the Channing Laboratory (M.J.S.), Department of Medicine, Brigham and Women's Hospital, Harvard Medical School; the Department of Cardiology, Children's Hospital (K.L.); the Department of Ambulatory Care and Prevention, Harvard Medical School (C.H.H.); the Departments of Nutrition (M.J.S.) and Epidemiology (M.J.S., C.H.H.), Harvard School of Public Health — all in Boston; and the Cardiovascular (P.R.E.) and Laboratory Medicine (J.P.M.) Divisions, Washington University School of Medicine, St. Louis.
Address reprint requests to Dr. Ridker at 900 Commonwealth Ave. E., Boston, MA 02215-1204.
- References
References
1
Dahlback B ,Hildebrand B . Inherited resistance to activated protein C is corrected by anticoagulant cofactor activity found to be a property of factor V. Proc Natl Acad Sci U S A 1994;91:1396-1400
CrossRef | Web of Science | Medline2
Bertina RM ,Koeleman BPC ,Koster T , et al. Mutation in blood coagulation factor V associated with resistance to activated protein C. Nature 1994;369:64-67
CrossRef | Web of Science | Medline3
Voorberg J ,Roelse J ,Koopman R , et al. Association of idiopathic venous thromboembolism with single point-mutation at Arg506 of factor V. Lancet 1994;343:1535-1536
CrossRef | Web of Science | Medline4
Zoller B ,Dahlback B . Linkage between inherited resistance to activated protein C and factor V gene mutation in venous thrombosis. Lancet 1994;343:1536-1538
CrossRef | Web of Science | Medline5
Dahlback B ,Carlsson M ,Svensson PJ . Familial thrombophilia due to a previously unrecognized mechanism characterized by poor anticoagulant response to activated protein C: prediction of a cofactor to activated protein C. Proc Natl Acad Sci U S A 1993;90:1004-1008
CrossRef | Web of Science | Medline6
Svensson PJ ,Dahlback B . Resistance to activated protein C as a basis for venous thrombosis. N Engl J Med 1994;330:517-522
Full Text | Web of Science | Medline7
Koster T ,Rosendaal FR ,de Ronde H ,Briet E ,Vandenbroucke JP ,Bertina RM . Venous thrombosis due to poor anticoagulant response to activated protein C: Leiden Thrombophilia Study. Lancet 1993;342:1503-1506
CrossRef | Web of Science | Medline8
Griffin JH ,Evatt B ,Wideman C ,Fernandez JA . Anticoagulant protein C pathway defective in majority of thrombophilic patients. Blood 1993;82:1989-1993
Web of Science | Medline9
Halbmayer WM ,Haushofer A ,Schon R ,Fischer M . The prevalence of poor anticoagulant response to activated protein C (APC resistance) among patients suffering from stroke or venous thrombosis and among healthy subjects. Blood Coagul Fibrinolysis 1994;5:51-57
CrossRef | Web of Science | Medline10
Miletich JP ,Prescott SM ,White R ,Majerus PW ,Bovill EG . Inherited predisposition to thrombosis. Cell 1993;72:477-480
CrossRef | Web of Science | Medline11
Heijboer H ,Brandjes DPM ,Buller HR ,Sturk A ,ten Cate JW . Deficiencies of coagulation-inhibiting and fibrinolytic proteins in outpatients with deep-vein thrombosis. N Engl J Med 1990;323:1512-1516
Full Text | Web of Science | Medline12
Wilhelmsen L ,Svardsudd K ,Korsan-Bengtsen K ,Larsson B ,Welin L ,Tibblin G . Fibrinogen as a risk factor for stroke and myocardial infarction. N Engl J Med 1984;311:501-505
Full Text | Web of Science | Medline13
Meade TW ,Mellows S ,Brozovic M , et al. Haemostatic function and ischaemic heart disease: principal results of the Northwick Park Heart Study. Lancet 1986;2:533-537
CrossRef | Web of Science | Medline14
Kannel WB ,Wolf PA ,Castelli WP ,D'Agostino RB . Fibrinogen and risk of cardiovascular disease: the Framingham Study. JAMA 1987;258:1183-1186
CrossRef | Web of Science | Medline15
Fowkes FGR ,Lowe GDO ,Housley E , et al. Cross-linked fibrin degradation products, progression of peripheral arterial disease, and risk of coronary heart disease. Lancet 1993;342:84-86
CrossRef | Web of Science | Medline16
Ridker PM ,Hennekens CH ,Cerskus A ,Stampfer MJ . Plasma concentration of cross-linked fibrin degradation product (D-dimer) and the risk of future myocardial infarction among apparently healthy men. Circulation 1994;90:2236-2240
Web of Science | Medline17
Ridker PM ,Vaughan DE ,Stampfer MJ ,Manson JE ,Hennekens CH . Endogenous tissue-type plasminogen activator and risk of myocardial infarction. Lancet 1993;341:1165-1168
CrossRef | Web of Science | Medline18
Ridker PM ,Hennekens CH ,Stampfer MJ ,Manson JE ,Vaughan DE . Prospective study of endogenous tissue plasminogen activator and risk of stroke. Lancet 1994;343:940-943
CrossRef | Web of Science | Medline19
Hamsten A ,Wiman B ,de Faire U ,Blomback M . Increased plasma levels of a rapid inhibitor of tissue plasminogen activator in young survivors of myocardial infarction. N Engl J Med 1985;313:1557-1563
Full Text | Web of Science | Medline20
Hamsten A ,de Faire U ,Walldius G , et al. Plasminogen activator inhibitor in plasma: risk factor for recurrent myocardial infarction. Lancet 1987;2:3-9
CrossRef | Web of Science | Medline21
Steering Committee of the Physicians' Health Study Research Group
Full Text | Web of Science | Medline22
World Health Organization. Ischemic heart disease registers: report of the Fifth work Group, including a second revision of the operating protocol, Copenhagen, Denmark, April 26–29, 1971. Copenhagen, Denmark: World Health Organization, Regional Office for Europe, 1971.
23
Hennekens CH, Buring JE. Epidemiology in medicine. Boston: Little, Brown, 1987.
24
Anderson FA Jr ,Wheeler HB ,Goldberg RJ , et al. A population-based perspective of the hospital incidence and case-fatality rates of deep vein thrombosis and pulmonary embolism: the Worcester DVT Study. Arch Intern Med 1991;151:933-938
CrossRef | Web of Science | Medline25
Hirsh J, Genton E, Hull R. Venous thromboembolism. New York: Grune & Stratton, 1981.
26
Dalen JE ,Alpert JS . Natural history of pulmonary embolism. Prog Cardiovasc Dis 1975;17:257-270
CrossRef | Web of Science27
Goldhaber SZ, ed. Pulmonary embolism and deep venous thrombosis. Philadelphia: W.B. Saunders, 1985.
28
Kniffin WD Jr ,Baron JA ,Barrett J ,Birkmeyer JD ,Anderson FA Jr . The epidemiology of diagnosed pulmonary embolism and deep venous thrombosis in the elderly. Arch Intern Med 1994;154:861-866
CrossRef | Web of Science | Medline29
Prandoni P ,lensing AWA ,Buller HR , et al. Deep-vein thrombosis and the incidence of subsequent symptomatic cancer. N Engl J Med 1992;327:1128-1133
Full Text | Web of Science | Medline
- Citing Articles (315)
Citing Articles
1
Michael Allon, Li Zhang, Ivan D. Maya, Molly S. Bray, Jose R. Fernandez. (2012) Association of Factor V Gene Polymorphism With Arteriovenous Graft Failure. American Journal of Kidney Diseases
CrossRef2
James M. Hunt, Todd M. Bull. (2011) Clinical Review of Pulmonary Embolism: Diagnosis, Prognosis, and Treatment. Medical Clinics of North America 95:6, 1203-1222
CrossRef3
K. WINCKERS, B. SIEGERINK, C. DUCKERS, L. F. MAURISSEN, G. TANS, E. CASTOLDI, H. M. H. SPRONK, H. TEN CATE, A. ALGRA, T. M. HACKENG, F. R. ROSENDAAL. (2011) Increased tissue factor pathway inhibitor activity is associated with myocardial infarction in young women: results from the RATIO study. Journal of Thrombosis and Haemostasis 9:11, 2243-2250
CrossRef4
Loredana Vaccarino, Giusi Irma Forte, Marisa Palmeri, Gabriella Misiano, Elisa Porcellini, Martina Chiappelli, Letizia Scola, Calogero Caruso, Federico Licastro, Domenico Lio. (2011) Role of prothrombotic polymorphisms in successful or unsuccessful aging. Biogerontology 12:5, 445-450
CrossRef5
Giusi Irma Forte, Loredana Vaccarino, Marisa Palmeri, Angelo Branzi, Claudio M. Caldarera, Letizia Scola, Calogero Caruso, Federico Licastro, Domenico Lio. (2011) Analysis of polymorphisms Leiden Factor V G1691A and prothrombin G20210A as risk factors for acute myocardial infarction. Biogerontology 12:5, 485-490
CrossRef6
B. Fuentes, J. Gallego, A. Gil-Nuñez, A. Morales, F. Purroy, J. Roquer, T. Segura, J. Tejada, A. Lago, E. Díez-Tejedor. (2011) Guía para el tratamiento preventivo del ictus isquémico y AIT (I). Actuación sobre los factores de riesgo y estilo de vida. Neurología
CrossRef7
Weixian Xu, Tracy Y. Wang, Richard C. Becker. (2011) Hematologic Diseases: From Within the Heart. Revista Española de Cardiología (English Edition) 64:7, 606-613
CrossRef8
Weixian Xu, Tracy Y. Wang, Richard C. Becker. (2011) Enfermedades hematológicas: desde dentro del corazón. Revista Española de Cardiología 64:7, 606-613
CrossRef9
Karim D. Mahmoud, Ryan J. Lennon, Henry H. Ting, Charanjit S. Rihal, David R. Holmes. (2011) Circadian Variation in Coronary Stent Thrombosis. JACC: Cardiovascular Interventions 4:2, 183-190
CrossRef10
Sara Sedano-Balbás, Mark Lyons, Brendan Cleary, Margaret Murray, Geraldine Gaffney, Majella Maher. (2011) Acquired Activated Protein C Resistance, Thrombophilia and Adverse Pregnancy Outcomes: A Study Performed in an Irish Cohort of Pregnant Women. Journal of Pregnancy 2011, 1-9
CrossRef11
Kay W. P. Ng, Pei K. Loh, Vijay K. Sharma. (2011) Role of Investigating Thrombophilic Disorders in Young Stroke. Stroke Research and Treatment 2011, 1-9
CrossRef12
Jody Lynn Kujovich. (2011) Factor V Leiden thrombophilia. Genetics in Medicine 13:1, 1-16
CrossRef13
Mojca Stegnar. (2010) Thrombophilia screening – at the right time, for the right patient, with a good reason. Clinical Chemistry and Laboratory Medicine 48:S1, S105-S113
CrossRef14
Ángel López-Cuenca, Francisco Marín, Vanessa Roldán, Rocío González-Conejero, Diana Hernández-Romero, Mariano Valdés, Gregory Y. H. Lip. (2010) Genetic polymorphisms and atrial fibrillation: Insights into the prothrombotic state and thromboembolic risk. Annals of Medicine 42:8, 562-575
CrossRef15
M. Blondon, G. Le Gal, M. Righini. (2010) Stratégie diagnostique et intérêt comparatif des scores cliniques pour le diagnostic d’embolie pulmonaire. La Revue de Médecine Interne 31:11, 742-749
CrossRef16
Lonneke M. L. De Lau, Frank W. G. Leebeek, Moniek P. M. De Maat, Peter J. Koudstaal, Diederik W. J. Dippel. (2010) Reviews: A review of hereditary and acquired coagulation disorders in the aetiology of ischaemic stroke. International Journal of Stroke 5:5, 385-394
CrossRef17
J. Heinz. (2010) Internistische Untersuchungen beim nichtarteriitischen retinalen Arterienverschluss. Der Ophthalmologe 107:9, 806-813
CrossRef18
G. Adler, M. Parczewski, E. Czerska, B. Łoniewska, M. Kaczmarczyk, J. Gumprecht, W. Grzeszczak, A. Szybińska, M. Mossakowska, A. Ciechanowicz. (2010) An age-related decrease in factor V Leiden frequency among Polish subjects. Journal of Applied Genetics 51:3, 337-341
CrossRef19
Makoto Ikejiri, Hideo Wada, Yuko Sakamoto, Naohiko Ito, Junji Nishioka, Kaname Nakatani, Akihiro Tsuji, Norikazu Yamada, Mashio Nakamura, Masaaki Ito, Tsutomu Nobori. (2010) The association of protein S Tokushima-K196E with a risk of deep vein thrombosis. International Journal of Hematology 92:2, 302-305
CrossRef20
Lonneke ML de Lau, Frank WG Leebeek, Moniek PM de Maat, Peter J Koudstaal, Diederik WJ Dippel. (2010) Screening for coagulation disorders in patients with ischemic stroke. Expert Review of Neurotherapeutics 10:8, 1321-1329
CrossRef21
Moataz Dowaidar, Ahmad Settin. (2010) Risk of Myocardial Infarction Related to Factor V Leiden Mutation: A Meta-Analysis. Genetic Testing and Molecular Biomarkers 14:4, 493-498
CrossRef22
Zohreh Rahimi, Hadi Mozafari, Ali Shahriari-Ahmadi, Kamran Alimogaddam, Ardeshir Ghavamzadeh, Mozafar Aznab, Kamran Mansouri, Mansour Rezaei, Abbas Parsian. (2010) Deep venous thrombosis and thrombophilic mutations in western Iran: association with factor V Leiden. Blood Coagulation & Fibrinolysis 21:5, 385-388
CrossRef23
P. Tatarskyy, A. Kucherenko, L. Livshits. (2010) Allelic polymorphism of F2, F5 and MTHFR genes in population of Ukraine. Cytology and Genetics 44:3, 129-133
CrossRef24
Susanna Moskau, Kerstin Smolka, Alexander Semmler, Dirk Schweichel, Ursula Harbrecht, Jens Müller, Christoph Pohl, Thomas Klockgether, Michael Linnebank. (2010) Common genetic coagulation variants are not associated with ischemic stroke in a case-control study. Neurological Research 32:5, 519-522
CrossRef25
D. GREEN, C. CHAN, J. KANG, K. LIU, P. SCHREINER, N. S. JENNY, R. P. TRACY. (2010) Longitudinal assessment of fibrinogen in relation to subclinical cardiovascular disease: the CARDIA study. Journal of Thrombosis and Haemostasis 8:3, 489-495
CrossRef26
Karim Valji, Michael Linenberger. (2009) Chasing Clot: Thrombophilic States and the Interventionalist. Journal of Vascular and Interventional Radiology 20:11, 1403-1416
CrossRef27
Julia Warner Gargano, Claudia B. Holzman, Patricia K. Senagore, M. Lynne Reuss, Dorothy R. Pathak, Karen H. Friderici, Katherine Jernigan, Rachel Fisher. (2009) Polymorphisms in thrombophilia and renin-angiotensin system pathways, preterm delivery, and evidence of placental hemorrhage. American Journal of Obstetrics and Gynecology 201:3, 317.e1-317.e9
CrossRef28
Lara N. Roberts, Raj K. Patel, Roopen Arya. (2009) Venous thromboembolism and ethnicity. British Journal of Haematology 146:4, 369-383
CrossRef29
Carolina I. Pestana, Argimiro Torres, Susana Blanco, María J. Rojas, Carlos Méndez, José L. López, Norma B. de Bosch, Antonietta Porco. (2009) Factor V Leiden and the Risk of Venous Thrombosis, Myocardial Infarction, and Stroke: A Case–Control Study in Venezuela. Genetic Testing and Molecular Biomarkers 13:4, 537-542
CrossRef30
Bernard Khor, Elizabeth M. Van Cott. (2009) Laboratory Evaluation of Hypercoagulability. Clinics in Laboratory Medicine 29:2, 339-366
CrossRef31
Zohreh Rahimi, Hamid Nomani, Hadi Mozafari, Asad Vaisi-Raygani, Hamid Madani, Shohreh Malek-Khosravi, Abbas Parsian. (2009) Factor V G1691A, prothrombin G20210A and methylenetetrahydrofolate reductase polymorphism C677T are not associated with coronary artery disease and type 2 diabetes mellitus in western Iran. Blood Coagulation & Fibrinolysis 20:4, 252-256
CrossRef32
Maria Topalidou, Smaragda Effraimidou, Dimitrios Farmakiotis, Emmanuil Papadakis, Georgia Papaioannou, Ioannis Korantzis, Vassilia Garipidou. (2009) Low protein Z levels, but not the intron F G79A polymorphism, are associated with unexplained pregnancy loss. Thrombosis Research 124:1, 24-27
CrossRef33
Sabine Steiner, Roela Sadushi, Andrea Bartok, Alexandra Hammer, Peter Quehenberger, Christine Mannhalter, Renate Koppensteiner, Erich Minar, Christoph W. Kopp. (2009) Association of periprocedural neurological deficit in carotid stenting with increased anticardiolipin antibodies. Thrombosis Research 123:6, 827-831
CrossRef34
Yann De Bast, Laurent Dahin. (2009) May-Thurner syndrome will be completed?. Thrombosis Research 123:3, 498-502
CrossRef35
Shelonitda S. Rose, Yaqoob Ali, Amit Kumar, Teri Jo Bekos, Parvin Saidi. (2009) Deep Venous Thrombosis Caused by Inferior Vena Cava Atresia and Hereditary Thrombophilia. The American Journal of the Medical Sciences 337:1, 67-70
CrossRef36
Wendell W. Weber. (2008) Pharmacogenetics: From Description to Prediction. Clinics in Laboratory Medicine 28:4, 499-511
CrossRef37
Saskia Middeldorp, Astrid van Hylckama Vlieg. (2008) Does thrombophilia testing help in the clinical management of patients?. British Journal of Haematology 143:3, 321-335
CrossRef38
Rebbeca A. Grysiewicz, Kurian Thomas, Dilip K. Pandey. (2008) Epidemiology of Ischemic and Hemorrhagic Stroke: Incidence, Prevalence, Mortality, and Risk Factors. Neurologic Clinics 26:4, 871-895
CrossRef39
Congning Shi, Xixiong Kang, Yajie Wang, Yali Zhou. (2008) The coagulation factor V Leiden, MTHFRC677T variant and eNOS 4ab polymorphism in young Chinese population with ischemic stroke. Clinica Chimica Acta 396:1-2, 7-9
CrossRef40
Christina M. Scifres, George A. Macones. (2008) The utility of thrombophilia testing in pregnant women with thrombosis: fact or fiction?. American Journal of Obstetrics and Gynecology 199:4, 344.e1-344.e7
CrossRef41
S. Sedano, G. Gaffney, G. Mortimer, M. Lyons, B. Cleary, M. Murray, M. Maher. (2008) Activated Protein C Resistance (APCR) and Placental Fibrin Deposition. Placenta 29:9, 833-837
CrossRef42
Judith Maria Leitner, Christine Mannhalter, Bernd Jilma. (2008) Genetic variations and their influence on risk and treatment of venous thrombosis. Pharmacogenomics 9:4, 423-437
CrossRef43
Parham Eshtehardi, Masoud Eslami, Davood Akhlagh Moayed. (2008) Simultaneous subacute coronary drug-eluting stent thrombosis in two different vessels of a patient with factor V Leiden mutation. Journal of Cardiovascular Medicine 9:4, 410-413
CrossRef44
B. Dahlback. (2008) Advances in understanding pathogenic mechanisms of thrombophilic disorders. Blood 112:1, 19-27
CrossRef45
Birgit Linnemann, Marc Schindewolf, Dimitrios Zgouras, Matthias Erbe, Marie Jarosch-Preusche, Edelgard Lindhoff-Last. (2008) Are patients with thrombophilia and previous venous thromboembolism at higher risk to arterial thrombosis?. Thrombosis Research 121:6, 743-750
CrossRef46
Bahadır Ercan, Lülüfer Tamer, Nehir Sucu, Hasan Pekdemir, Ahmet Çamsarı, Uğur Atik. (2008) Factor VLeiden and Prothrombin G20210A Gene Polymorphisms in Patients with Coronary Artery Disease. Yonsei Medical Journal 49:2, 237
CrossRef47
Rendrik F. Franco, Saskia Middeldorp, Johan R. Meinardi, Elisabeth C. M. Van Pampus, Pieter H. Reitsma. (2008) Factor XIII Val34Leu and the risk of venous thromboembolism in factor V Leiden carriers. British Journal of Haematology 111:1, 118
CrossRef48
Ida Martinelli, Paolo Bucciarelli, Maurizio Margaglione, Valerio De Stefano, Giancarlo Castaman, Pier Mannuccio Mannucci. (2008) The risk of venous thromboembolism in family members with mutations in the genes of factor V or prothrombin or both. British Journal of Haematology 111:4, 1223
CrossRef49
Asli Nar Demirer, Mehmet Alikasifoglu, Ergul Tuncbilek, Sema Karakus, Tomris Erbas. (2008) Factor V Leiden mutation and type 1 diabetes mellitus. Blood Coagulation & Fibrinolysis 19:1, 70-74
CrossRef50
H Yekta Gurlertop, Fuat Gundogdu, Ibrahim Pirim, Yahya Islamoglu, Nilnur Egerci, Serdar Sevimli, Fuat Erdem, Huseyin Senocak. (2007) Association between factor V Leiden mutation and coronary artery disease in the northeast region of Turkey. Blood Coagulation & Fibrinolysis 18:8, 719-722
CrossRef51
Jan P. Vandenbroucke, Erik von Elm, Douglas G. Altman, Peter C. Gøtzsche, Cynthia D. Mulrow, Stuart J. Pocock, Charles Poole, James J. Schlesselman, Matthias Egger. (2007) Strengthening the Reporting of Observational Studies in Epidemiology (STROBE). Epidemiology 18:6, 805-835
CrossRef52
M. COPPENS, J. A. VAN MOURIK, C. M. ECKMANN, H. R. BÜLLER, S. MIDDELDORP. (2007) Current practise of testing for inherited thrombophilia. Journal of Thrombosis and Haemostasis 5:9, 1979-1981
CrossRef53
Robert Belv??s, Amparo Santamar??a, Joan Mart??-F??bregas, Rub??n G Leta, Dolores Cocho, Montserrat Borrell, Jordi Fontcuberta, Josep L Mart??-Vilalta. (2007) Patent foramen ovale and prothrombotic markers in young stroke patients. Blood Coagulation & Fibrinolysis 18:6, 537-542
CrossRef54
T. OHIRA, M. CUSHMAN, M. Y. TSAI, Y. ZHANG, S. R. HECKBERT, N. A. ZAKAI, W. D. ROSAMOND, A. R. FOLSOM. (2007) ABO blood group, other risk factors and incidence of venous thromboembolism: the Longitudinal Investigation of Thromboembolism Etiology (LITE). Journal of Thrombosis and Haemostasis 5:7, 1455-1461
CrossRef55
Juan F. Yepes, Jennifer A. Sullivan, Ana L. Castellanos, Thomas P. Sollecito. (2007) Hypercoagulability syndromes: what the dentist needs to know. Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology, and Endodontology 104:1, 3-11
CrossRef56
Marianne S Andresen, Anette L Eilertsen, Ulrich Abildgaard, Per Morten Sandset. (2007) Hormone therapy and raloxifene reduce the coagulation inhibitor potential. Blood Coagulation & Fibrinolysis 18:5, 455-460
CrossRef57
S. Patiar, C. C. Kirwan, G. McDowell, N. J. Bundred, C. N. McCollum, G. J. Byrne. (2007) Prevention of venous thromboembolism in surgical patients with breast cancer. British Journal of Surgery 94:4, 412-420
CrossRef58
Gábor Vallus, Béla Dlustus, György Acsády, Zoltán Papp, Judit Skopál, Zoltán Nagy, Zoltán Prohászka, László Romics, István Karádi, Bálint Nagy. (2007) Factor V Leiden and apolipoprotein E genotypes in severe femoropopliteal atherosclerosis with restenosis. Clinica Chimica Acta 377:1-2, 256-260
CrossRef59
Mary Cushman, Barbara M. Alving. 2007. Risk Factors for Cardiovascular Disease and Arterial Thrombosis. , 371-378.
CrossRef60
J.D. Torres, H. Cardona, L. Álvarez, W. Cardona-Maya, S.A. Castañeda, F. Quintero-Rivera, A. Cadavid, G. Bedoya, L. Tobón. (2006) Inherited thrombophilia is associated with deep vein thrombosis in a Colombian population. American Journal of Hematology 81:12, 933-937
CrossRef61
E. GRANDONE, I. MARTINELLI, M. MARGAGLIONE, A. DRAGANI, G. DAVÌ. (2006) Platelet activation in subjects carrying factor V Leiden or factor II A20210 mutations. Journal of Thrombosis and Haemostasis 4:11, 2496-2498
CrossRef62
R. Belvis, A. Santamaria, J. Marti-Fabregas, D. Cocho, M. Borrell, J. Fontcuberta, J. L. Marti-Vilalta. (2006) Diagnostic yield of prothrombotic state studies in cryptogenic stroke. Acta Neurologica Scandinavica 114:4, 250-253
CrossRef63
N.A. Limdi, T.M. Beasley, D.B. Allison, C.A. Rivers, R.T. Acton. (2006) Racial differences in the prevalence of Factor V Leiden mutation among patients on chronic warfarin therapy. Blood Cells, Molecules, and Diseases 37:2, 100-106
CrossRef64
Yusuf Colak, Zeki Karasu, Nevin Oruc, Cenk Can, Zuhal Bal??m, UlusSalih Akarca, Fulya Gunsar, Galip Ersoz, Yaman Tokat, Yucel Batur. (2006) Hyperhomocysteinaemia and factor V Leiden mutation are associated with Budd???Chiari syndrome. European Journal of Gastroenterology & Hepatology 18:8, 917-920
CrossRef65
Andrea Gerhardt, Rüdiger E. Scharf, Barbara Mikat-Drozdzynski, Jan S. Krüssel, Hans-Georg Bender, Rainer B. Zotz. (2006) Maternal IVS1-401 T allele of the estrogen receptor α is an independent predictor of late fetal loss. Fertility and Sterility 86:2, 448-453
CrossRef66
Nean Matijevic, Kenneth K. Wu. (2006) Hypercoagulable states and strokes. Current Atherosclerosis Reports 8:4, 324-329
CrossRef67
Giovanni M. Cordeiro, Frances Eliott, C. Lynne McIntyre, Rosanne E. Casu, Robert J. Henry. (2006) Characterisation of single nucleotide polymorphisms in sugarcane ESTs. Theoretical and Applied Genetics 113:2, 331-343
CrossRef68
S. Vig, A. Chitolie, D. Bevan, J. Dormandy, M. M. Thompson, A. Halliday. (2006) The prevalence of thrombophilia in patients with symptomatic peripheral vascular disease. British Journal of Surgery 93:5, 577-581
CrossRef69
Gordon D. O. Lowe. (2006) Can haematological tests predict cardiovascular risk? The 2005 Kettle Lecture*. British Journal of Haematology 133:3, 232-250
CrossRef70
M Jaiprakash, Harsh Kumar, GS Chopra, DK Mishra. (2006) Hypercoagulable state. Medical Journal Armed Forces India 62:2, 141-145
CrossRef71
Z. J. JUN, T. PING, Y. LEI, L. LI, S. Y. MING, W. JING. (2006) Prevalence of factor V Leiden and prothrombin G20210A mutations in Chinese patients with deep venous thrombosis and pulmonary embolism. Clinical and Laboratory Haematology 28:2, 111-116
CrossRef72
R. Y. L. ZEE, N. R. COOK, S. CHENG, H. A. ERLICH, K. LINDPAINTNER, P. M. RIDKER. (2006) Multi-locus candidate gene polymorphisms and risk of myocardial infarction: a population-based, prospective genetic analysis. Journal of Thrombosis and Haemostasis 4:2, 341-348
CrossRef73
Massimo Franchini, Dino Veneri, Gian Luca Salvagno, Franco Manzato, Giuseppe Lippi. (2006) Inherited Thrombophilia. Critical Reviews in Clinical Laboratory Sciences 43:3, 249-290
CrossRef74
José Ramón González-Porras, Ramón García-Sanz, Ignacio Alberca, María Luz López, Ana Balanzategui, Oliver Gutierrez, Francisco Lozano, Jesús San Miguel. (2006) Risk of recurrent venous thrombosis in patients with G20210A mutation in the prothrombin gene or factor V Leiden mutation. Blood Coagulation & Fibrinolysis 17:1, 23-28
CrossRef75
Mirosław Prazanowski, Barbara Kur, Małgorzata Barańska, Waldemar Lutz, Bożena Piłacik, Zbigniew Kolaciński. (2006) The Leiden Mutation and Activated Protein C Resistance as Risk Factors for Disseminated Intravascular Coagulation in Acutely Poisoned Patients. Clinical Toxicology 44:1, 53-57
CrossRef76
S. Rubattu, R. Speranza, M. Ferrari, A. Evangelista, M. Beccia, R. Stanzione, G. E. Assenza, M. Volpe, M. Rasura. (2005) A role of TNF-alpha gene variant on juvenile ischemic stroke: a case-control study. European Journal of Neurology 12:12, 989-993
CrossRef77
Sachiko Kinoshita, Hiroko Iida, Sumiko Inoue, Kumiko Watanabe, Masako Kurihara, Yui Wada, Hiroko Tsuda, Dongchon Kang, Naotaka Hamasaki. (2005) Protein S and protein C gene mutations in Japanese deep vein thrombosis patients. Clinical Biochemistry 38:10, 908-915
CrossRef78
M. Aleksic, P. Jahn, J. Heckenkamp, K. Wielckens, J. Brunkwall. (2005) Comparison of the Prevalence of APC-resistance in Vascular Patients and in a Normal Population Cohort in Western Germany. European Journal of Vascular and Endovascular Surgery 30:2, 160-163
CrossRef79
Thomas G. Heffron, David Welch, Todd Pillen, Carlos Fasola, Doug Redd, Gregory A. Smallwood, Enrique Martinez, George Atkinson, Mark Guy, Changwoo Nam, Stuart Henry, Rene Romero. (2005) Low incidence of hepatic artery thrombosis after pediatric liver transplantation without the use of intraoperative microscope or parenteral anticoagulation. Pediatric Transplantation 9:4, 486-490
CrossRef80
Asif Mahmood, Jane Needham, Jeanne Prosser, Jason Mainwaring, Tim Trebble, Gillian Mahy, John Ramage. (2005) Prevalence of hyperhomocysteinaemia, activated protein C resistance and prothrombin gene mutation in inflammatory bowel disease. European Journal of Gastroenterology & Hepatology 17:7, 739-744
CrossRef81
Meral Kaykçoğlu, Can Hasdemir, Zuhal Eroğlu, Buket Kosova, Levent H Can, Muge Ildizli, Oguz Yavuzgil, Serdar Payzin, Cuneyt Turkoglu. (2005) Homozygous factor V Leiden mutation in two siblings presenting with acute myocardial infarction: a rare cause of myocardial infarction in the young. Blood Coagulation & Fibrinolysis 16:4, 281-286
CrossRef82
A. GERHARDT, T. W. GOECKE, M. W. BECKMANN, K. J. WAGNER, B. TUTSCHEK, R. WILLERS, H-G. BENDER, R. E. SCHARF, R. B. ZOTZ. (2005) The G20210A prothrombin-gene mutation and the plasminogen activator inhibitor (PAI-1) 5G/5G genotype are associated with early onset of severe preeclampsia. Journal of Thrombosis and Haemostasis 3:4, 686-691
CrossRef83
Paul A Kyrle, Sabine Eichinger. (2005) Deep vein thrombosis. The Lancet 365:9465, 1163-1174
CrossRef84
J. A. HEIT, J. L. SOBELL, H. LI, S. S. SOMMER. (2005) The incidence of venous thromboembolism among Factor V Leiden carriers: a community-based cohort study. Journal of Thrombosis and Haemostasis 3:2, 305-311
CrossRef85
Sonia Anand, Agnes Kliber, Marlys L. Koschinsky. (2005) Activated protein C resistance and low molecular weight lipoprotein (a): dual pathogens for atherothrombosis?. Thrombosis Research 115:6, 491-494
CrossRef86
Sanja Stankovic, Nada Majkic-Singh. (2005) Genetic aspects of ischemic stroke. Jugoslovenska medicinska biohemija 24:4, 225-239
CrossRef87
James Edwin Muntz. (2004) Treatment of Venous Thromboembolism in Orthopaedic Surgery. Techniques in Orthopaedics 19:4, 337-346
CrossRef88
Brian S. Donahue. (2004) The Response to Activated Protein C After Cardiopulmonary Bypass: Impact of Factor V Leiden. Anesthesia & Analgesia1598-1603
CrossRef89
Jacob Schneiderman, Micha S. Feinberg, Ehud Schwammenthal, Alex Tenenbaum, Alex Garniak, Binyamina Morag, Raphael Walden, Eitan Heldenberg, Hana Fenigstein, Raphael Adar. (2004) Protruding aortic arch thrombus: Treatment with minimally invasive surgical approach. Journal of Vascular Surgery 40:6, 1083-1088
CrossRef90
A. Gonthier, J. Bogousslavsky. (2004) Infarctus cérébraux artériels d’origine hématologique : expérience lausannoise et revue de la littérature. Revue Neurologique 160:11, 1029-1039
CrossRef91
Michael K. Rosner, Timothy R. Kuklo, Rabih Tawk, Ross Moquin, Stephen L. Ondra. (2004) Prophylactic placement of an inferior vena cava filter in high-risk patients undergoing spinal reconstruction. Neurosurgical FOCUS 17:4, 1-6
CrossRef92
Otto R Hommes, Per S Sørensen, Franz Fazekas, Monika Maas Enriquez, Hans W Koelmel, Oscar Fernandez, Carlo Pozzilli, Paul O'Connor. (2004) Intravenous immunoglobulin in secondary progressive multiple sclerosis: randomised placebo-controlled trial. The Lancet 364:9440, 1149-1156
CrossRef93
Mariela F. Hendler, Susana S. Meschengieser, Alicia N. Blanco, Maria F. Alberto, Maria J. Salvi
, Laura Gennari, Maria A. Lazzari. (2004) Primary upper-extremity deep vein thrombosis: High prevalence of thrombophilic defects. American Journal of Hematology 76:4, 330-337
CrossRef94
Zeev Weiner, Ronit Beck-Fruchter, Amir Weiss, Yasir Hujirat, Eliezer Shalev, Stavit A. Shalev. (2004) Thrombophilia and stillbirth: possible connection by intrauterine growth restriction. BJOG: An International Journal of Obstetrics and Gynaecology 111:8, 780-783
CrossRef95
S Vig, A Chitolie, S Sleight, D Bevan, J Dormandy, M.M Thompson, A Halliday. (2004) Prevalence and Risk of Thrombophilia Defects in Vascular Patients. European Journal of Vascular and Endovascular Surgery 28:2, 124-131
CrossRef96
N. Amberger, F. Masuhr, J. M. Valdueza, B. Vetter, M. Weih. (2004) A negative personal and family history for venous thrombotic events is not sufficient to exclude thrombophilia in patients with cerebral venous thrombosis. European Journal of Neurology 11:8, 555-558
CrossRef97
Elizabeth M Van Cott, Michael Laposata, M Elizabeth Hartnett. (2004) Prothrombin gene mutation G20210A, homocysteine, antiphospholipid antibodies and other hypercoagulable states in ocular thrombosis. Blood Coagulation & Fibrinolysis 15:5, 393-397
CrossRef98
M. Van Der Neut Kolfschoten, R. J. Dirven, S. R. Poort, R. Van Wijk, H. L. Vos, F. R. Rosendaal, R. M. Bertina. (2004) Characterization of an immunologic polymorphism (D79H) in the heavy chain of factor V. Journal of Thrombosis and Haemostasis 2:6, 910-917
CrossRef99
Marcello De Cicco. (2004) The prothrombotic state in cancer: pathogenic mechanisms. Critical Reviews in Oncology/Hematology 50:3, 187-196
CrossRef100
J. A. Heit, M. A. Phelps, S. A. Ward, J. P. Slusser, T. M. Petterson, M. De Andrade. (2004) Familial segregation of venous thromboembolism. Journal of Thrombosis and Haemostasis 2:5, 731-736
CrossRef101
Fahri U
CrossRef102
Peter L. Nagy, Iris Schrijver, James L. Zehnder. (2004) Molecular Diagnosis of Hypercoagulable States. Laboratory Medicine 35:4, 214-221
CrossRef103
Armelle Poujol-Robert, Olivier Rosmorduc, Lawrence Serfaty, Florence Coulet, Raoul Poupon, Annie Robert. (2004) Genetic and Acquired Thrombotic Factors in Chronic Hepatitis C. The American Journal of Gastroenterology 99:3, 527-531
CrossRef104
Jason H. Cole, Laurence S. Sperling. (2004) Premature coronary artery disease: Clinical risk factors and prognosis. Current Atherosclerosis Reports 6:2, 121-125
CrossRef105
Vasantha Kondamudi, Rekha Reddy, Noah Kondamudi, Raymond Harvey, Maritza Delarosa. (2004) Sudden Painless Unilateral Vision Loss Caused by Branch Retinal Artery Occlusion: Implications for the Primary Care Physician. The American Journal of the Medical Sciences 327:1, 44-46
CrossRef106
Ashley Irish. (2004) Hypercoagulability in Renal Transplant Recipients. American Journal of Cardiovascular Drugs 4:3, 139-149
CrossRef107
A. Antovic, M. Blomback, K. Bremme, M. Van Rooijen, S. He. (2003) Increased hemostasis potential persists in women with previous thromboembolism with or without APC resistance. Journal of Thrombosis and Haemostasis 1:12, 2531-2535
CrossRef108
C. H. Van Ommen, H. Heijboer, E. J. Van Den Dool, B. A. Hutten, M. Peters. (2003) Pediatric venous thromboembolic disease in one single center: congenital prothrombotic disorders and the clinical outcome. Journal of Thrombosis and Haemostasis 1:12, 2516-2522
CrossRef109
Kathleen M Murphy, Karin D Berg. (2003) Mutation and single nucleotide polymorphism detection using temperature gradient capillary electrophoresis. Expert Review of Molecular Diagnostics 3:6, 811-818
CrossRef110
N. Mc Loone, B. Lee, J. Anderson, K. McKenna. (2003) Homozygous factor V Leiden mutation in a patient with traumatic leg ulceration. Clinical and Experimental Dermatology 28:6, 608-609
CrossRef111
(2003) Cardiovascular Genomics. New England Journal of Medicine 349:14, 1387-1388
Full Text112
Herbert H. Watzke. (2003) Clinical significance of gene-diagnosis for defects in coagulation factors and inhibitors. Wiener Klinische Wochenschrift 115:13-14, 475-481
CrossRef113
A Šrámek, M Kriek, FR Rosendaal. (2003) Decreased mortality of ischaemic heart disease among carriers of haemophilia. The Lancet 362:9381, 351-354
CrossRef114
D. Petrovic, T. Milanez, J. Kobal, D. Bregar, K. P. Potisk, B. Peterlin. (2003) Prothrombotic gene polymorphisms and atherothrombotic cerebral infarction. Acta Neurologica Scandinavica 108:2, 109-113
CrossRef115
Bea C. Tanis, Daisy G. M. Bloemenkamp, Maurice A. A. J. van den Bosch, Jeanet M. Kemmeren, Ale Algra, Yolanda van de Graaf, Frits R. Rosendaal. (2003) Prothrombotic coagulation defects and cardiovascular risk factors in young women with acute myocardial infarction. British Journal of Haematology 122:3, 471-478
CrossRef116
Guttmacher, Alan E., Collins, Francis S., , Nabel, Elizabeth G., . (2003) Cardiovascular Disease. New England Journal of Medicine 349:1, 60-72
Full Text117
TM Morgan, CS Coffey, HM Krumholz. (2003) Overestimation of genetic risks owing to small sample sizes in cardiovascular studies. Clinical Genetics 64:1, 7-17
CrossRef118
S Doix, M Mahrousseh, M Jolak, Y Laurent, J.L Lorenzini, C Binquet, M Zeller, Y Cottin, J.E Wolf. (2003) Facteur V Leiden et infarctus du myocarde : à propos d'un cas, revue systématique de la littérature et méta-analyse. Annales de Cardiologie et d'Angéiologie 52:3, 143-149
CrossRef119
Figen Batioglu, Leyla S. Atmaca, Halil Gurhan Karabulut, Derya Beyza Sayin. (2003) Factor V Leiden and prothrombin gene G20210A mutations in ocular Behcet disease. Acta Ophthalmologica Scandinavica 81:3, 283-285
CrossRef120
T. Ong, P. Trancos, J. Jagger. (2003) Deep veinous thrombosis following uneventful phacoemulsification. Journal of Cataract & Refractive Surgery 29:6, 1219-1221
CrossRef121
Pelle G. Lindqvist, Bjorn Dahlback. (2003) Reactions to awareness of activated protein C resistance carriership: a descriptive study of 270 women. Acta Obstetricia et Gynecologica Scandinavica 82:5, 467-470
CrossRef122
J. H. Mcintosh, D. Owens, C. A. Lee, S. Raut, T. W. Barrowcliffe. (2003) A modified thrombin generation test for the measurement of factor VIII concentrates. Journal of Thrombosis and Haemostasis 1:5, 1005-1011
CrossRef123
Geng Xu, Guo-dong Jin, Guo-sheng Fu, Ji Ma, Jiang Shan, Jian-an Wang. (2003) Polymorphisms in the genes for coagulation factor II, V, VII in patients undergoing coronary angiography. Journal of Zhejiang University SCIENCE A 4:3, 369-373
CrossRef124
Torben Bjerregaard Larsen, Henrik Toft Sørensen, Axel Skytthe, Søren Paaske Johnsen, James W. Vaupel, Kaare Christensen. (2003) Major Genetic Susceptibility for Venous Thromboembolism in Men: A Study of Danish Twins. Epidemiology 14:3, 328-332
CrossRef125
Theodore E Warkentin. (2003) Prothrombotic genetic risk factors and heparin-induced thrombocytopenia. Pharmacogenetics 13:5, 245-246
CrossRef126
Ridker, Paul M, Goldhaber, Samuel Z., Danielson, Ellie, Rosenberg, Yves, Eby, Charles S., Deitcher, Steven R., Cushman, Mary, Moll, Stephan, Kessler, Craig M., Elliott, C. Gregory, Paulson, Rolf, Wong, Turnly, Bauer, Kenneth A., Schwartz, Bruce A., Miletich, Joseph P., Bounameaux, Henri, Glynn, Robert J., . (2003) Long-Term, Low-Intensity Warfarin Therapy for the Prevention of Recurrent Venous Thromboembolism. New England Journal of Medicine 348:15, 1425-1434
Full Text127
Georg Endler, Christine Mannhalter. (2003) Polymorphisms in coagulation factor genes and their impact on arterial and venous thrombosis. Clinica Chimica Acta 330:1-2, 31-55
CrossRef128
Paolo Carraro. (2003) Guidelines for the Laboratory Investigation of Inherited Thrombophilias. Recommendations for the First Level Clinical Laboratories. Clinical Chemistry and Laboratory Medicine 41:3, 382-391
CrossRef129
Elizabeth M. Van Cott, MD, Michael Laposata, MD, PhD. (2003) Algorithms for Hypercoagulation Testing. Laboratory Medicine 34:3, 216-222
CrossRef130
Stephanie L Perry, Thomas L Ortel. (2003) Clinical and laboratory evaluation of thrombophilia. Clinics in Chest Medicine 24:1, 153-170
CrossRef131
John A Heit. (2003) Risk factors for venous thromboembolism. Clinics in Chest Medicine 24:1, 1-12
CrossRef132
Mark L. Moster. (2003) Coagulopathies and Arterial Stroke. Journal of Neuro-Ophthalmology 23:1, 63-71
CrossRef133
Bradley D Freeman, Timothy G Buchman, Barbara A Zehnbauer. (2003) Template-directed dye-terminator incorporation with fluorescence polarization detection for analysis of single nucleotide polymorphisms associated with cardiovascular and thromboembolic disease. Thrombosis Research 111:6, 373-379
CrossRef134
Kathleen M Murphy, Michael J Hafez, Juliet Philips, Kellie Yarnell, Kevin R Gutshall, Karin D Berg. (2003) Evaluation of Temperature Gradient Capillary Electrophoresis for Detection of the Factor V Leiden Mutation. Molecular Diagnosis 7:1, 35-40
CrossRef135
Sabine Steiner, Ramazanali Ahmadi, Andrea Willfort, Wilfried Lang, Kurt Huber, Erich Minar, Christoph W. Kopp. (2003) Hemostatic markers with bolus versus prolonged heparin after carotid artery stenting. Thrombosis Research 109:1, 23-29
CrossRef136
N. F. Dowling, H. Austin, A. Dilley, C. Whitsett, B. L. Evatt, W. C. Hooper. (2003) The epidemiology of venous thromboembolism in Caucasians and African-Americans: the GATE Study1. Journal of Thrombosis and Haemostasis 1:1, 80-87
CrossRef137
Seung Ho Hong. (2003) Genotype distribution of the mutations in the coagulation factor V gene in the Korean population: Absence of its association with coronary artery disease. Korean Journal of Biological Sciences 7:3, 255-259
CrossRef138
Dae-II Chang, Gregory del Zoppo. 2003. Coagulopathies and Stroke. , 729-732.
CrossRef139
S Rosenstingl, M Ruivard, E Melon, A Schaeffer, M Gouault-Heilmann. (2002) Thrombophlébite cérébrale : étude rétrospective de vingt-sept cas. La Revue de Médecine Interne 23:12, 973-982
CrossRef140
W.Craig Hooper, Robert C. Holman, John A. Heit, Nathaniel Cobb. (2002) Venous thromboembolism hospitalizations among American Indians and Alaska Natives. Thrombosis Research 108:5-6, 273-278
CrossRef141
S. F. Van Buren, J. A. Heit, J. M. Panneton, J. H. Donohue. (2002) Iliac Arterial Thrombosis After Inguinal Hernia Repair. Mayo Clinic Proceedings 77:12, 1361-1363
CrossRef142
R. Grossmann, U. Geisen, G. Merati, W. Müllges, C. M. Schambeck, U. Walter, S. Schwender. (2002) Genetic risk factors in young adults with ‘cryptogenic’ ischemic cerebrovascular disease. Blood Coagulation & Fibrinolysis 13:7, 583-590
CrossRef143
PETER BRYANT-GREENWOOD. (2002) Molecular Diagnostics in Obstetrics and Gynecology. Clinical Obstetrics and Gynecology 45:3, 605-621
CrossRef144
Brian S. Donahue. (2002) Thrombosis after Deep Hypothermic Circulatory Arrest with Antifibrinolytic Therapy: Is Factor V Leiden the Smoking Gun?. Anesthesiology 97:3, 760-761
CrossRef145
Marco Ruggeri, Heinz Gisslinger, Alberto Tosetto, Claudia Rintelen, Christine Mannhalter, Ingrid Pabinger, Navide Heis, Giancarlo Castaman, Edoardo Missiaglia, Klaus Lechner, Francesco Rodeghiero. (2002) Factor V Leiden mutation carriership and venous thromboembolism in polycythemia vera and essential thrombocythemia. American Journal of Hematology 71:1, 1-6
CrossRef146
Miguel A. Canales, Rosario Arrieta, Ruben Gomez-Rioja, Jesus Diez, Victor Jimenez-Yuste, Fernando Hernandez-Navarro. (2002) Induction of a Hypercoagulability State and Endothelial Cell Activation by Granulocyte Colony-Stimulating Factor in Peripheral Blood Stem Cell Donors. Journal of Hematotherapy <html_ent glyph="@amp;" ascii="&"/> Stem Cell Research 11:4, 675-681
CrossRef147
C. Heleen van Ommen, Merel van Wijnen, Flip G. de Groot, Chantal M. A. M. van der Horst, Marjolein Peters. (2002) Postvaricella Purpura Fulminans Caused by Acquired Protein S Deficiency Resulting From Antiprotein S Antibodies: Search for the Epitopes. Journal of Pediatric Hematology/Oncology 24:5, 413-416
CrossRef148
Simm Liu, Christian Schmitz, Meir J. Stampfer, Frank Sacks, Charles H. Hennekens, Klaus Lindpaintner, Paul M. Ridker. (2002) A prospective study of TaqIB polymorphism in the gene coding for cholesteryl ester transfer protein and risk of myocardial infarction in middle-aged men. Atherosclerosis 161:2, 469-474
CrossRef149
M. van der Neut Kolfschoten, R. J. Dirven, G. Tans, J. Rosing, H. L. Vos, R. M. Bertina. (2002) The activated protein C (APC)-resistant phenotype of APC cleavage site mutants of recombinant factor V in a reconstituted plasma model. Blood Coagulation & Fibrinolysis 13:3, 207-215
CrossRef150
R. Zahn, H. Beeck, B. R. Winkelmann, K. Seidl, S. Schneider, P. Hellstern, J. Senges. (2002) Prospective cross-sectional study of haemostatic factors in patients with and without coronary artery disease. Blood Coagulation & Fibrinolysis 13:2, 81-87
CrossRef151
Johan R. Meinardi, Saskia Middeldorp, Pieter J. de Kam, Maria M. W. Koopman, Elisabeth C. M. van Pampus, Karly Hamulyak, Martin H. Prins, Harry R. Buller, Jan van der Meer. (2002) The incidence of recurrent venous thromboembolism in carriers of factor V Leiden is related to concomitant thrombophilic disorders. British Journal of Haematology 116:3, 625-631
CrossRef152
George R. Saade, Claire McLintock. (2002) Inherited thrombophilia and stillbirth. Seminars in Perinatology 26:1, 51-69
CrossRef153
THOMAS HILBERG, DIETER JESCHKE, HOLGER H. W. GABRIEL. (2002) Hereditary thrombophilia in elite athletes. Medicine and Science in Sports and Exercise 34:2, 218-221
CrossRef154
A. Undas, S. Bazan-Socha, J. Swadzba, J. Musial. (2002) Hereditary hemorrhagic telangiectasia, factor V Leiden and antiphospholipid syndrome: a case report. Blood Coagulation & Fibrinolysis 13:1, 53-56
CrossRef155
Rendrik F. Franco, Pieter H. Reitsma. (2001) Gene polymorphisms of the haemostatic system and the risk of arterial thrombotic disease. British Journal of Haematology 115:3, 491-506
CrossRef156
Gordon R. Bernard, E. Wesley Ely, Theressa J. Wright, Joseph Fraiz, Jerome E. Stasek, James A. Russell, Irvin Mayers, Brian A. Rosenfeld, Peter E. Morris, S. Betty Yan, Jeffery D. Helterbrand. (2001) Safety and dose relationship of recombinant human activated protein C for coagulopathy in severe sepsis. Critical Care Medicine 29:11, 2051-2059
CrossRef157
Kenneth Boockvar, Mark Lachs. (2001) Development of Definitions for Acute Illness in Nursing Home Residents Based on Chart-Recorded Physical Exam Findings. Journal of the American Medical Directors Association 2:6, 279-284
CrossRef158
J. C. Quincampoix, M. Legarff, C. Rittling, S. Andiva, P. Toulon. (2001) Modification of the ProC® Global assay using dilution of patient plasma in factor V-depleted plasma as a screening assay for factor V Leiden mutation. Blood Coagulation & Fibrinolysis 12:7, 569-576
CrossRef159
Pierre Toulon, Raphael Adda, Patricia Perez. (2001) Sensitivity of the ProC® Global Assay for Protein C Pathway Abnormalities. Thrombosis Research 104:2, 93-103
CrossRef160
Isobel D Walker, M Greaves, F. E Preston. (2001) Investigation and management of heritable thrombophilia. British Journal of Haematology 114:3, 512-528
CrossRef161
W Göpel, L Gortner, T Kohlmann, C Schultz, J Möller. (2001) Low prevalence of large intraventricular haemorrhage in very low birthweight infants carrying the factor V Leiden or prothrombin G20210A mutation. Acta Paediatrica 90:9, 1021-1024
CrossRef162
Ruud Lensen, Rogier M. Bertina, Jan P. Vandenbroucke, Frits R. Rosendaal. (2001) High factor VIII levels contribute to the thrombotic risk in families with factor V Leiden. British Journal of Haematology 114:2, 380-386
CrossRef163
Jacques E. Rossouw. (2001) Early risk of cardiovascular events after commencing hormone replacement therapy. Current Opinion in Lipidology 12:4, 371-375
CrossRef164
Norman M. Kaplan, Biff F. Palmer, Factor V Leiden:, Ray Lee. (2001) Southwestern Internal Medicine Conference. The American Journal of the Medical Sciences 322:2, 88-102
CrossRef165
E.S.K Sampram, B Lindblad. (2001) The Impact of Factor V Mutation on the Risk for Occlusion in Patients Undergoing Peripheral Vascular Reconstructions. European Journal of Vascular and Endovascular Surgery 22:2, 134-138
CrossRef166
Tsu-Shiu Hsu, Lung-An Hsu, Chi-Jen Chang, Chien-Feng Sun, Yu-Lin Ko, Chi-Tai Kuo, Cheng-Wen Chiang, Ying-Shiung Lee. (2001) Importance of Hyperhomocysteinemia as a Risk Factor for Venous Thromboembolism in a Taiwanese Population. A Case-Control Study. Thrombosis Research 102:5, 387-395
CrossRef167
Douglas R. Linfert, Gregory J. Tsongalis. (2001) Coexistence of the Methylenetetrahydrofolate Reductase Single-Nucleotide Polymorphism (C677T) in Patients With the Factor V Leiden or Prothrombin G20210A Polymorphisms. Diagnostic Molecular Pathology 10:2, 111-115
CrossRef168
A. Gurgey, I.C. Haznedaroglu, T. Egesel, Y. Buyukas?k, O.I. Ozcebe, N. Say?nalp, S.V. Dundar, Y. Bayraktar. (2001) Two common genetic thrombotic risk factors: Factor V Leiden and prothrombin G20210A in adult Turkish patients with thrombosis. American Journal of Hematology 67:2, 107-111
CrossRef169
Rudolf P. Wüthrich. (2001) Factor V Leiden mutation: potential thrombogenic role in renal vein, dialysis graft and transplant vascular thrombosis. Current Opinion in Nephrology and Hypertension 10:3, 409-414
CrossRef170
T. MARK JOHNSON, S. EL???DEFRAWY, W. G. HODGE, B. C. LEONARD, P. J. KERTES, S. A.M. TAYLOR, D. P. LILLICRAP. (2001) PREVALENCE OF FACTOR V LEIDEN AND ACTIVATED PROTEIN C RESISTANCE IN CENTRAL RETINAL VEIN OCCLUSION. Retina 21:2, 161-166
CrossRef171
Bradley W. Popovich, PhD, Richard D. Press, PhD, Richard D. Press, MD, PhD. (2001) Real-Time Polymerase Chain Reaction With Fluorescent Hybridization Probes for the Detection of Prevalent Mutations Causing Common Thrombophilic and Iron Overload Phenotypes. American Journal of Clinical Pathology 115:3, 439-447
CrossRef172
Wayne W. Grody, John H. Griffin, Annette K. Taylor, Bruce R. Korf, John A. Heit. (2001) American College of Medical Genetics Consensus Statement on Factor V Leiden Mutation Testing. Genetics in Medicine 3:2, 139-148
CrossRef173
Sabrina Pastacaldi, Rosangela Teixeira, Paolo Montalto, Keith Rolles, Andrew K. Burroughs. (2001) Hepatic artery thrombosis after orthotopic liver transplantation: A review of nonsurgical causes. Liver Transplantation 7:2, 75-81
CrossRef174
Pasquale Madonna, Umberto Piemontino, Valentino DeStefano, Rosina Albisinni, Anna Maria Cerbone, Giovanni Di Minno. (2001) Coexistence of Thrombophilic Gene Polymorphisms Among 559 Unrelated Consecutive Patients With a History of Thrombosis. Thrombosis Research 101:4, 317-319
CrossRef175
Robert Y.L Zee, Klaus Lindpaintner, Berthold Struk, Charles H Hennekens, Paul M Ridker. (2001) A prospective evaluation of the CD14 C(-260)T gene polymorphism and the risk of myocardial infarction. Atherosclerosis 154:3, 699-702
CrossRef176
Daniel Petrovič, M. Zorc, I. Keber, B. Peterlin. (2001) Joint effect of G1691A factor V point mutation and factor VII Arg/Gln353 gene polymorphism on the risk of premature coronary artery disease. Annales de Génétique 44:1, 33-36
CrossRef177
J.Shawn Miles, Joseph P Miletich, Samuel Z Goldhaber, Charles H Hennekens, Paul M Ridker. (2001) G20210A mutation in the prothrombin gene and the risk of recurrent venous thromboembolism. Journal of the American College of Cardiology 37:1, 215-218
CrossRef178
N. M. Pecheniuk, T. P. Walsh, N. A. Marsh. (2000) DNA technology for the detection of common genetic variants that predispose to thrombophilia. Blood Coagulation and Fibrinolysis 11:8, 683-700
CrossRef179
Ida Martinelli, Paolo Bucciarelli, Maurizio Margaglione, Valerio De Stefano, Giancarlo Castaman, Pier Mannuccio Mannucci. (2000) The risk of venous thromboembolism in family members with mutations in the genes of factor V or prothrombin or both. British Journal of Haematology 111:4, 1223-1229
CrossRef180
Valeria Genoud, Mercedes Castañon, Joyce Annichino-Bizzacchi, Jorge Korin, Lucı́a Kordich. (2000) Prevalence of Three Prothrombotic Polymorphisms. Thrombosis Research 100:3, 127-131
CrossRef181
Lucia M. Procopciuc, C. Has, C. Drugan, Gh. Jebeleanu. (2000) Genetic analysis of factor V Leiden in a family with history of thrombosis and venous leg ulcers. Journal of Cellular and Molecular Medicine 4:4, 297-302
CrossRef182
Rendrik F. Franco, Saskia Middeldorp, Johan R. Meinardi, Elisabeth C. M. van Pampus, Pieter H. Reitsma. (2000) Factor XIII Val34Leu and the risk of venous thromboembolism in factor V Leiden carriers. British Journal of Haematology 111:1, 118-121
CrossRef183
(2000) Comparison of thrombotic risk between 85 homozygotes and 481 heterozygotes carriers of the factor V Leiden mutation: retrospective analysis from the Procare Study. Blood Coagulation and Fibrinolysis 11:6, 511-518
CrossRef184
Noha Irani-Hakime, Hala Tamim, Raghid Kreidy, Wassim Y. Almawi. (2000) The prevalence of factor V R506Q mutation-Leiden among apparently healthy Lebanese. American Journal of Hematology 65:1, 45-49
CrossRef185
Neil S Van de Water, John K French, Mayanna Lund, Thomas A Hyde, Harvey D White, Peter J Browett. (2000) Prevalence of factor v leiden and prothrombin variant g20210a in patients age <50 years with no significant stenoses at angiography three to four weeks after myocardial infarction. Journal of the American College of Cardiology 36:3, 717-722
CrossRef186
Iftikhar J. Kullo, Gerald T. Gau, A. Jamil Tajik. (2000) Inherited Thrombophilia, Hypercoagulability, and Risk Factors for Atherosclerosis. Mayo Clinic Proceedings 75:8, 871
CrossRef187
Hui-Kyung Jeon, Ho-Joong Youn, Ki-Dong Yoo, Ji-Won Park, Hee-Yeol Kim, Hyou-Young Rhim, Jang-Seong Chae, Jae-Hyung Kim, Kyu-Bo Choi, Soon-Jo Hong. (2000) Transthoracic Echocardiographic Demonstration of Massive Pulmonary Thrombus Caused by Protein C Deficiency. Journal of the American Society of Echocardiography 13:7, 682-684
CrossRef188
P. Toulon, W. M. Halbmeyer, G. Hafner, Y. Schmitt, B. Randgard, M. Odpadlik, C. Van Den Eynden, C. Wagner. (2000) Screening for abnormalities of the protein C anticoagulant pathway using the ProC Global assay. Results of a European multicenter evaluation. Blood Coagulation and Fibrinolysis 11:5, 447-454
CrossRef189
Sam Schulman. (2000) Duration of anticoagulants in acute or recurrent venous thromboembolism. Current Opinion in Pulmonary Medicine 6:4, 321-325
CrossRef190
A. Papa, V. De Stefano, A. Gasbarrini, P. Chiusolo, R. Cianci, I. Casorelli, K. Paciaroni, G. Cammarota, G. Leone, G. Gasbarrini. (2000) Prevalence of factor V Leiden and the G20210A prothrombin-gene mutation in inflammatory bowel disease. Blood Coagulation and Fibrinolysis 11:5, 499-503
CrossRef191
Tomoyuki Tsujikawa, Mitsuyo Urabe, Hiromichi Bamba, Akira Andoh, Masaya Sasaki, Shigeki Koyama, Yoshihide Fujiyama, Tadao Bamba. (2000) Haemorrhagic cerebral sinus thrombosis associated with ulcerative colitis: A case report of successful treatment by anticoagulant therapy. Journal of Gastroenterology and Hepatology 15:6, 688-692
CrossRef192
(2000) Investigation of patients with intermittent claudication. European Journal of Vascular and Endovascular Surgery 19, S54-S63
CrossRef193
Robert J. Wityk, Norman J. Beauchamp. (2000) DIAGNOSTIC EVALUATION OF STROKE. Neurologic Clinics 18:2, 357-378
CrossRef194
T.B. Larsen, B. Nørgaard-Pedersen, J.B. Lundemose, N. Rüdiger, M. Gaustadnes, I. Brandslund. (2000) Sudden Infant Death Syndrome, Childhood Thrombosis, and Presence of Genetic Risk Factors for Thrombosis. Thrombosis Research 98:4, 233-239
CrossRef195
Henrik Ekberg, Peter J. Svensson, Mecislovas Simanaitis, Bj??rn Dahlb??ck. (2000) FACTOR V R506Q MUTATION (ACTIVATED PROTEIN C RESISTANCE) IS AN ADDITIONAL RISK FACTOR FOR EARLY RENAL GRAFT LOSS ASSOCIATED WITH ACUTE VASCULAR REJECTION. Transplantation1577-1581
CrossRef196
Jennifer Wackel. (2000) Altered Coagulation: A Diagnosis for the Problem of Deep Vein Thrombosis. International Journal of Nursing Terminologies and Classifications 11:2, 69-79
CrossRef197
MONIQUE M.B. BRETELER. (2000) Vascular Involvement in Cognitive Decline and Dementia: Epidemiologic Evidence from the Rotterdam Study and the Rotterdam Scan Study. Annals of the New York Academy of Sciences 903:1 VASCULAR FACT, 457-465
CrossRef198
Pierre Toulon, Patricia Perez. (2000) SCREENING FOR RISK FACTORS FOR THROMBOSIS USING A NEW GENERATION OF ASSAYS DEVELOPED TO EVALUATE THE FUNCTIONALITY OF THE PROTEIN C ANTICOAGULANT PATHWAY. Hematology/Oncology Clinics of North America 14:2, 379-389
CrossRef199
Monique M.B Breteler. (2000) Vascular risk factors for Alzheimer’s disease:. Neurobiology of Aging 21:2, 153-160
CrossRef200
Gerhardt, Andrea, Scharf, Rüdiger Eberhard, Beckmann, Matthias Wilhelm, Struve, Sabine, Bender, Hans Georg, Pillny, Michael, Sandmann, Wilhelm, Zotz, Rainer Bernd, . (2000) Prothrombin and Factor V Mutations in Women with a History of Thrombosis during Pregnancy and the Puerperium. New England Journal of Medicine 342:6, 374-380
Full Text201
Gary C. Armitage, Yafei Wu, Hwa-Ying Wang, Julian Sorrell, Francesco S. di Giovine, Gordon W. Duff. (2000) Low Prevalence of a Periodontitis-Associated Interleukin-1 Composite Genotype in Individuals of Chinese Heritage. Journal of Periodontology 71:2, 164-171
CrossRef202
C. Kearon, M. Crowther, J. Hirsh. (2000) Management of Patients with Hereditary Hypercoagulable Disorders. Annual Review of Medicine 51:1, 169-185
CrossRef203
Paul M. Ridker. (2000) Inherited risk factors for venous thromboembolism: Implications for clinical practice. Clinical Cornerstone 2:4, 1-10
CrossRef204
(2000) Investigation of patients with intermittent claudication. Journal of Vascular Surgery 31:1, S62-S74
CrossRef205
Ekaterina V. Fomicheva, Svetlana P. Gukova, Valentina I. Larionova-Vasina, Yuri R. Kovalev, Eugene I. Schwartz. (2000) Gene–Gene Interaction in the RAS System in the Predisposition to Myocardial Infarction in Elder Population of St. Petersburg (Russia). Molecular Genetics and Metabolism 69:1, 76-80
CrossRef206
Marc R. Toglia, Thomas E. Nolan. (1999) Venous Thromboembolism During Pregnancy: A Current Review of Diagnosis and Management. Obstetrical & Gynecological Survey 54:Supplement, 29-41
CrossRef207
Zeev Blumenfeld, Benjamin Brenner. (1999) Thrombophilia-associated pregnancy wastage. Fertility and Sterility 72:5, 765-774
CrossRef208
SHEILA KONDAVEETI, MARTIN L. HIBBERD, ROBERT BOOY, SIMON NADEL, MICHAEL LEVIN. (1999) Effect of the Factor V Leiden mutation on the severity of meningococcal disease. The Pediatric Infectious Disease Journal 18:10, 893-896
CrossRef209
Thomas G. DeLoughery. (1999) Coagulation abnormalities and cardiovascular disease. Current Opinion in Lipidology 10:5, 443-448
CrossRef210
Veronique Le Cam-Duchez, Sophie Gandrille, David Tregouet, Martine Alhenc-Gelas, Joseph Emmerich, Jean-Noel Fiessinger, Jeanne-Yvonne Borg, Martine Aiach. (1999) Influence of three potential genetic risk factors for thrombosis in 43 families carrying the factor V Arg 506 to Gln mutation. British Journal of Haematology 106:4, 889-897
CrossRef211
C Fisher. (1999) Prevalence and outcome of activated protein C resistance in patients after peripheral arterial bypass grafts. Cardiovascular Surgery 7:5, 519-525
CrossRef212
Ribeaudeau, Senet, Cayuela, Fund, Paul, Robert, Scrobohaci, Dubertret. (1999) A prospective coagulation study including resistance to activated protein C and mutations in factors V and II in venous leg ulcers. British Journal of Dermatology 141:2, 259-263
CrossRef213
M A Marinella, K Greene. (1999) Bilateral thalamic infarction in a patient with factor V Leiden mutation.. Mayo Clinic Proceedings 74:8, 795-797
CrossRef214
E. Crétel, P. Cacoub, Z. Amoura, P. Hausfater, I. Elalamy, J. Richemond, J.C. Piette. (1999) Résistance à la protéine C activée et thrombose portale: deux nouveaux cas et revue de la littérature. La Revue de Médecine Interne 20:7, 602-606
CrossRef215
Paul M. Ridker. (1999) Duration and intensity of anticoagulation among patients with genetic predispositions to venous thrombosis. Current Cardiology Reports 1:2, 88-90
CrossRef216
P.-O. Hansson, E. Eriksson, L. Welin, H. Eriksson. (1999) Prevalence of APC resistance and its relationship to arterial and venous thromboembolism in a general population sample of elderly Swedish men: The Study of Men Born in 1913. Journal of Internal Medicine 245:6, 593-600
CrossRef217
Carsten Ranke, Hans-Joachim Trappe. (1999) Update Angiologie. Medizinische Klinik 94:5, 251-263
CrossRef218
G. Lande, V. Dantec, M. Trossaert, J.-F. Godin, H. Marec. (1999) Do inherited prothrombotic factors have a role in myocardial infarction with normal coronary arteriogram?. Journal of Internal Medicine 245:5, 554-555
CrossRef219
Wolfgang Göpel, Doris Kim, Ludwig Gortner. (1999) Prothrombotic mutations as a risk factor for preterm birth. The Lancet 353:9162, 1411-1412
CrossRef220
James G Donnelly, Gail A Rock. (1999) Genetic determinants of heritable venous thrombosis: genotyping methods for factor VLEIDEN A1691G, methylenetetrahydrofolate reductase C677T, prothrombin G20210A mutation, and algorithms for venous thrombosis investigations. Clinical Biochemistry 32:3, 223-228
CrossRef221
Gottfried Novacek, Wolfgang Miehsler, Stylianos Kapiotis, Reinhold Katzenschlager, Wolfgang Speiser, Harald Vogelsang. (1999) Thromboembolism and resistance to activated protein C in patients with inflammatory bowel disease. The American Journal of Gastroenterology 94:3, 685-690
CrossRef222
Howard Liebman, Douglas Sutherland, Nader Kashani. (1999) Reply. Gastroenterology 116:3, 779
CrossRef223
I.D. Walker. (1999) Factor V Leiden: should all women be screened prior to commencing the contraceptive pill?. Blood Reviews 13:1, 8-13
CrossRef224
Seemant Chaturvedi, Nishith Joshi, Jeffery Dzieczkowski. (1999) Activated protein C resistance in young African American patients with ischemic stroke. Journal of the Neurological Sciences 163:2, 137-139
CrossRef225
Anthonie WA Lensing, Paolo Prandoni, Martin H Prins, HR Büller. (1999) Deep-vein thrombosis. The Lancet 353:9151, 479-485
CrossRef226
Paul M Ridker, Meir J Stampfer. (1999) Assessment of genetic markers for coronary thrombosis: promise and precaution. The Lancet 353:9154, 687-688
CrossRef227
John H. Griffin, Kazuhisa Kojima, Carole L. Banka, Linda K. Curtiss, José A. Fernández. (1999) High-density lipoprotein enhancement of anticoagulant activities of plasma protein S and activated protein C. Journal of Clinical Investigation 103:2, 219-227
CrossRef228
Arthur L. Beaudet. (1999) Making Genomic Medicine a Reality. The American Journal of Human Genetics 64:1, 1-13
CrossRef229
Wolfgang Lalouschek, Susanne Aull, Wolfgang Serles, Peter Schnider, Christine Mannhalter, Ingrid Pabinger-Fasching, Lüder Deecke, Karl Zeiler. (1999) C677T MTHFR Mutation and Factor V Leiden Mutation in Patients with TIA/Minor Stroke. Thrombosis Research 93:2, 61-69
CrossRef230
Norihisa Kumasaka, Masahito Sakuma, Kunio Shirato. (1999) Incidence of Pulmonary Thromboembolism in Japan. Japanese Circulation Journal 63:6, 439-441
CrossRef231
Elizabeth M. Van Cott, Michael Laposata. (1998) LABORATORY EVALUATION OF HYPERCOAGULABLE STATES. Hematology/Oncology Clinics of North America 12:6, 1141-1166
CrossRef232
Zofnat Wiener-Megnagi, Izhar Ben-Shlomo, Yael Goldberg, Eliezer Shalev. (1998) Resistance to activated protein C and the Leiden mutation: High prevalence in patients with abruptio placentae. American Journal of Obstetrics and Gynecology 179:6, 1565-1567
CrossRef233
A. Piñar, R. Saenz, J. Rebollo, M. Gomez-Parra, F. Carrasco, J. M. Herrerias, M. Jimenez-Saenz. (1998) Portal and Mesenteric Vein Thrombosis in a Patient Heterozygous for a Mutation (Arg506 → Gln) in the Factor V Gen (Factor V Leiden). Journal of Clinical Gastroenterology 27:4, 361-363
CrossRef234
Michael R. DiSiena, Richard Intres, Daniel J. Carter. (1998) Factor V Leiden and Pulmonary Embolism in a Young Woman Taking an Oral Contraceptive. The American Journal of Forensic Medicine and Pathology 19:4, 362-367
CrossRef235
G. Lande, V. Dantec, M. Trossaert, J.-F. Godin, H. Le Marec. (1998) Do inherited prothrombotic factors have a role in myocardial infarction with normal coronary arteriogram?. Journal of Internal Medicine 244:6, 543-544
CrossRef236
S Becker, Ch Heller, F Gropp, I Scharrer, W Kreuz. (1998) Thrombophilic disorders in children with cerebral infarction. The Lancet 352:9142, 1756-1757
CrossRef237
Torben B. Larsen, Jens F. Lassen, Bjarne S. Dahler-Eriksen, Per Hyltoft Petersen, Ivan Brandslund. (1998) Effect of Anticoagulant Therapy on the Hypercoagulable State in Patients Carrying the Factor V Arg506Gln Mutation. Thrombosis Research 92:4, 157-162
CrossRef238
Ellis Senanu K. Sampram, Bengt Lindblad, Björn Dahlbäck. (1998) Activated protein C resistance in patients with peripheral vascular disease. Journal of Vascular Surgery 28:4, 624-629
CrossRef239
Howard A. Liebman, Nader Kashani, Douglas Sutherland, William McGehee, Lori Kam. (1998) The factor V Leiden mutation increases the risk of venous thrombosis in patients with inflammatory bowel disease. Gastroenterology 115:4, 830-834
CrossRef240
Guillaume S
CrossRef241
S. Javorschi, S. Richard-Harston, S. Labrouche, G. Manciet, G. Freyburger. (1998) Relative Influence of Age and Thrombotic History on Hemostatic Parameters. Thrombosis Research 91:5, 241-248
CrossRef242
Fernanda L. Andrade, Joyce M. Annichino-Bizzacchi, Sara T. O. Saad, Fernando F. Costa, Valder R. Arruda. (1998) Prothrombin mutant, factor V Leiden, and thermolabile variant of methylenetetrahidrofolate reductase among patients with sickle cell disease in Brazil. American Journal of Hematology 59:1, 46-50
CrossRef243
Michael Stepak, Jamie E. Siegel. (1998) Factor V Leiden: pathophysiology and clinical implications. Disease Management and Clinical Outcomes 1:5, 181-187
CrossRef244
Seemant Chaturvedi, Jeffery Dzieczkowski. (1998) Multiple hemostatic abnormalities in young adults with activated protein C resistance and cerebral ischemia. Journal of the Neurological Sciences 159:2, 209-212
CrossRef245
W. CRAIG HOOPER, BRUCE L. EVATT. (1998) The Role of Activated Protein C Resistance in the Pathogenesis of Venous Thrombosis. The American Journal of the Medical Sciences 316:2, 120-128
CrossRef246
Suzanne Cheng, Céline Pallaud, Michael A. Grow, Stephen J. Scharf, Henry A. Erlich, William Klitz, Clive R. Pullinger, Mary J. Malloy, John P. Kane, Gérard Siest, Sophie Visvikis. (1998) A Multilocus Genotyping Assay for Cardiovascular Disease. Clinical Chemistry and Laboratory Medicine 36:8, 561-566
CrossRef247
Mark K. Eskandari, Franklin A. Bontempo, Andrea Cortese Hassett, Hawazin Faruki, Michel S. Makaroun. (1998) Arterial thromboembolic events in patients with the factor V Leiden mutation. The American Journal of Surgery 176:2, 122-125
CrossRef248
Goldhaber, Samuel Z., . (1998) Pulmonary Embolism. New England Journal of Medicine 339:2, 93-104
Full Text249
Maria I. Bokarewa, Katarina Bremme. (1998) Production of phospholipid antibodies in selected thrombophilic women differing in genotype at the 506 site of factor V. European Journal of Haematology 61:1, 21-26
CrossRef250
Leon Speroff. (1998) Oral contraceptives and arterial and venous thrombosis: A clinician’s formulation. American Journal of Obstetrics and Gynecology 179:1, S25-S36
CrossRef251
Takafumi Seki, Hiroshi Okayama, Tomoko Kumagai, Norihisa Kumasaka, Masahito Sakuma, Shogen Isoyama, Kunio Shirato, Hideo Odaka. (1998) Arg506Gln mutation of the coagulation factor V gene not detected in Japanese pulmonary thromboembolism. Heart and Vessels 13:4, 195-198
CrossRef252
S.Terence Dunn, Courtney R. Roberts, Eliot Schechter, William E. Moore, Elisa T. Lee, June E. Eichner. (1998) Role of Factor V Leiden Mutation in Patients with Angiographically Demonstrated Coronary Artery Disease. Thrombosis Research 91:2, 91-99
CrossRef253
S.Terence Dunn, Stephan Trong. (1998) Evaluation of Role of Factor V Leiden Mutation in Fatal Pulmonary Thromboembolism. Thrombosis Research 91:1, 7-14
CrossRef254
S. Baranovskaya, S. Kudinov, E. Fomicheva, V. Vasina, D. Solovieva, V. Khavinson, E. Schwartz. (1998) Age as a Risk Factor for Myocardial Infarction in Leiden Mutation Carriers. Molecular Genetics and Metabolism 64:2, 155-157
CrossRef255
Kendall P. Crookston, Ruth Henderson, Wayne L. Chandler. (1998) False negative factor V Leiden assay following allogeneic stem cell transplant. British Journal of Haematology 100:3, 600-602
CrossRef256
M. Weih, S. Mehraein, J. M. Valdueza, K. M. Einhäupl, B. Vetter, A. E. Kulozik, S. Ziemer, J. Koscielny. (1998) Increased rate of factor V Leiden mutation in patients with cerebral venous thrombosis. Journal of Neurology 245:3, 149-152
CrossRef257
Uttam C Garg, Donna K Arnett, Greg Evans, John H Eckfeldt. (1998) No Association between Factor V Leiden Mutation and Coronary Heart Disease or Carotid Intima Media Thickness. Thrombosis Research 89:6, 289-293
CrossRef258
Torben B Larsen, Jens F Lassen, Ivan Brandslund, Lene Byriel, Gert Bruun Petersen, Bent Nørgaard-Pedersen. (1998) The Arg506Gln Mutation (FV Leiden) Among a Cohort of 4188 Unselected Danish Newborns. Thrombosis Research 89:5, 211-215
CrossRef259
THOMAS HILBERG, GEORG MOESSMER, MANFRED HARTARD, DIETER JESCHKE. (1998) APC resistance in an elite female athlete. Medicine & Science in Sports & Exercise 30:2, 183,184
CrossRef260
Daiva Rastenyt
, Jaakko Tuomilehto, Cinzia Sarti. (1998) Genetics of stroke—a review. Journal of the Neurological Sciences 153:2, 132-145
CrossRef261
Maria T. Sifontes, Rachelle Nuss, Stephen P. Hunger, Jill Waters, Linda J. Jacobson, Marilyn Manco-Johnson. (1998) Activated protein C resistance and the factor V Leiden mutation in children with thrombosis. American Journal of Hematology 57:1, 29-32
CrossRef262
Jeff P. Gregg, Akemi J. Yamane, Wayne W. Grody. (1997) Prevalence of the factor V-Leiden mutation in four distinct American ethnic populations. American Journal of Medical Genetics 73:3, 334-336
CrossRef263
Kenneth K. Wu. (1997) Hemostatic tests in the prediction of atherothrombotic disease. International Journal of Clinical & Laboratory Research 27:2-4, 145-152
CrossRef264
C.J. Glueck, Robert N. Fontaine, Arun Gupta, Mahmood Alasmi. (1997) Myocardial infarction in a 35-year-old man with homocysteinemia, high plasminogen activator inhibitor activity, and resistance to activated protein C. Metabolism 46:12, 1470-1472
CrossRef265
Lawrence M Gelbert, Richard E Gregg. (1997) Will genetics really revolutionize the drug discovery process?. Current Opinion in Biotechnology 8:6, 669-674
CrossRef266
G. D. O. Lowe. (1997) Prediction of postoperative venous thrombosis using haemostasis tests. International Journal of Clinical & Laboratory Research 27:2-4, 153-157
CrossRef267
James L. Zehnder, Renee C. Benson, Suzanne Cheng. (1997) A Microplate Allele-Specific Oligonucleotide Hybridization Assay for Detection of Factor V Leiden. Diagnostic Molecular Pathology 6:6, 347-352
CrossRef268
MARIA T. SIFONTES, RACHELLE NUSS, STEPHEN P. HUNGER, LINDA J. JACOBSON, JILL WATERS, MARILYN J. MANCO-JOHNSON. (1997) Correlation between the Functional Assay for Activated Protein C Resistance and Factor V Leiden in the Neonate. Pediatric Research 42:6, 776-778
CrossRef269
Helge Stormorken, Kjell S. Sakariassen. (1997) HEMOSTATIC RISK FACTORS IN ARTERIAL THROMBOSIS AND ATHEROSCLEROSIS: THE THROMBIN-FIBRIN AND PLATELET-VWF AXIS. Thrombosis Research 88:1, 1-25
CrossRef270
Olafur Thorarensen, Stephen Ryan, Jill Hunter, Donald P. Younkin. (1997) Factor V Leiden mutation: An unrecognized cause of hemiplegic cerebral palsy, neonatal stroke, and placental thrombosis. Annals of Neurology 42:3, 372-375
CrossRef271
Ashley B. Irish, Fiona R. Green, Derek W.R. Gray, Peter J. Morris. (1997) THE FACTOR V LEIDEN (R506Q) MUTATION AND RISK OF THROMBOSIS IN RENAL TRANSPLANT RECIPIENTS1. Transplantation 64:4, 604-607
CrossRef272
N. Artemis, J. Heliopoulos, P. Makris, H. Piperidou, J. Milonas. (1997) Bilateral central retinal artery occlusions in a patient with activated protein C resistance. European Journal of Neurology 4:4, 404-407
CrossRef273
Magruder C. Donaldson, Michael Belkin, Anthony D. Whittemore, John A. Mannick, Janina A. Longtine, David M. Dorfman. (1997) Impact of activated protein C resistance on general vascular surgical patients. Journal of Vascular Surgery 25:6, 1054-1060
CrossRef274
Elena M. Faioni, Cristina Razzari, Ida Martinelli, Daniela Panzeri, Franca Franchi, Pier Mannuccio Mannucci. (1997) Resistance to activated protein C in unselected patients with arterial and venous thrombosis. American Journal of Hematology 55:2, 59-64
CrossRef275
Harland Austin, W. Craig Hooper, Anne Dilley, Carey Drews, Mary Renshaw, Dorothy Ellingsen, Bruce Evatt. (1997) THE PREVALENCE OF TWO GENETIC TRAITS RELATED TO VENOUS THROMBOSIS IN WHITES AND AFRICAN-AMERICANS. Thrombosis Research 86:5, 409-415
CrossRef276
Ilene C. Weitz, Valerie K. Israel, Howard A. Liebman. (1997) Tamoxifen-associated venous thrombosis and activated protein C resistance due to factor V leiden. Cancer 79:10, 2024-2027
CrossRef277
Charles J. Glueck, Greg Brandt, Ralph Gruppo, Alvin Crawford, Dennis Roy, Trent Tracy, Davis Stroop, Ping Wang, Ann Becker. (1997) Resistance to Activated Protein C and Legg-Perthes Disease. Clinical Orthopaedics and Related Research 338, 139-152
CrossRef278
P. Robbins, M. Forrest, S. Fanning, D. Royston. (1997) Use of Aprotinin Therapy in a Patient with Factor V Leiden. Anesthesia & Analgesia 84:3, 694-698
CrossRef279
Simioni, Paolo, Prandoni, Paolo, Lensing, Anthonie W.A., Scudeller, Alberta, Sardella, Corrado, Prins, Martin H., Villalta, Sabina, Dazzi, Francesco, Girolami, Antonio, . (1997) The Risk of Recurrent Venous Thromboembolism in Patients with an Arg506→Gln Mutation in the Gene for Factor V (Factor V Leiden). New England Journal of Medicine 336:6, 399-403
Full Text280
Paul M Ridker, Charles H Hennekens, Christian Schmitz, Meir J Stampfer, Klaus Lindpaintner. (1997) PIA1/A2 polymorphism of platelet glycoprotein IIIa and risks of myocardial infarction, stroke, and venous thrombosis. The Lancet 349:9049, 385-388
CrossRef281
B. Zöller, MD, A. Hillarp, PhD, E. Berntorp, MD, B. Dahlbäck, MD. (1997) ACTIVATED PROTEIN C RESISTANCE DUE TO A COMMON FACTOR V GENE MUTATION IS A MAJOR RISK FACTOR FOR VENOUS THROMBOSIS. Annual Review of Medicine 48:1, 45-58
CrossRef282
Franklin A. Bontempo, Andrea Cortese Hassett, Hawazin Faruki, David L. Steed, Marshall W. Webster, Michel S. Makaroun. (1997) The factor V Leiden mutation: Spectrum of thrombotic events and laboratory evaluation. Journal of Vascular Surgery 25:2, 271-276
CrossRef283
Scott R. Florell, George M. Rodgers. (1997) Inherited thrombotic disorders: An update. American Journal of Hematology 54:1, 53-60
CrossRef284
A. Ferreira-Gonzalez, LM Fisher, CM Lehman, MH Langley, DH Lofland, Q Xia, NX Nguyen, D Modesto, JB Willoughby, DS Wilkinson, CT Garrett. (1997) Detection of a common mutation in factor V gene responsible for resistance to activated protein C causing predisposition to thrombosis. Journal of Clinical Laboratory Analysis 11:6, 328-335
CrossRef285
Marc J. Kahn, Charles Scher, Marta Rozans, Robert K. Michaels, Cindy Leissinger, John Krause. (1997) Factor V Leiden is not responsible for stroke in patients with sickling disorders and is uncommon in African Americans with sickle cell disease. American Journal of Hematology 54:1, 12-15
CrossRef286
Sanford J. Kempin. (1997) Clinical Science Review: Hemostatic Defects in Cancer Patients. Cancer Investigation 15:1, 23-36
CrossRef287
F.H. Herrmann, M. Koesling, W. Schröder, R. Altman, R. Jiménez Bonilla, S. Lopaciuk, J.L. Perez-Requejo, J.R. Singh. (1997) Prevalence of factor V Leiden mutation in various populations. Genetic Epidemiology 14:4, 403-411
CrossRef288
Marc R. Toglia, Thomas E. Nolan. (1997) Venous Thromboembolism During Pregnancy. Obstetrical & Gynecological Survey 52:1, 60-72
CrossRef289
Kenneth R. Chien, Mitsuyuki Shimizu, Masahiko Hoshijima, Susumu Minamisawa, Andrew A. Grace. (1997) Toward Molecular Strategies for Heart Disease. Japanese Circulation Journal 61:2, 91-118
CrossRef290
John V. L. Sheffield, Eric B. Larson. (1996) General internal medicine update. Journal of General Internal Medicine 11:10, 613-621
CrossRef291
Turgut Tatlisumak, Marc Fisher. (1996) Hematologic disorders associated with ischemic stroke. Journal of the Neurological Sciences 140:1-2, 1-11
CrossRef292
Stuart L. Graham, Ivan Goldberg, Barbara Murray, Paul Beaumont, Beng H. Chong. (1996) Activated protein C resistance â low incidence in glaucomatous optic disc haemorrhage and central retinal vein occlusion. Australian and New Zealand Journal of Ophthalmology 24:3, 199-205
CrossRef293
Toglia, Marc R., Weg, John G., . (1996) Venous Thromboembolism during Pregnancy. New England Journal of Medicine 335:2, 108-114
Full Text294
B. Montaruli, J. Voorberg, G. Tamponi, A. Borchielli, G. Muleo, A. Pannocchia, J. A. Mourik, P. Schinco. (1996) Arterial and venous thrombosis in two Italian families with the factor V Arg506→ Gln mutation. European Journal of Haematology 57:1, 96-100
CrossRef295
D. L. Weed. (1996) Weed Responds. American Journal of Public Health 86:7, 1029-1030
CrossRef296
M King. (1996) The population "wolf" and demographic entrapment in Rwanda.. American Journal of Public Health 86:7, 1030-1031
CrossRef297
A Lippman. (1996) Nonconsensual participation in genetic studies.. American Journal of Public Health 86:7, 1030-1030
CrossRef298
N. Schupf, R. Mayeux. (1996) Schupf and Mayeux Respond. American Journal of Public Health 86:7, 1030-1030
CrossRef299
Ian Roberts, Zahir Amoura, Thomas Papo, Jean-Charles Piette, H. Bounameaux, S. Desmarais, G. Reber, A. Perrier, P. de Moerloose, M. Bazzan, E. Aluffi, A. Vaccarino, P. Schinco, B. Montaruli. (1996) Activated protein C and pulmonary embolism. The Lancet 347:9018, 1841-1842
CrossRef300
Welch, H. Gilbert, . (1996) Questions about the Value of Early Intervention. New England Journal of Medicine 334:22, 1472-1473
Full Text301
S. Desmarais, P. de Moerloose, G. Reber, P. Minazio, H. Bounameaux, A. Perrier. (1996) Resistance to activated protein C in an unselected population of patients with pulmonary embolism. The Lancet 347:9012, 1374-1375
CrossRef302
Toshiyuki Sakata, Kazuomi Kario, Yoshiaki Katayama, Tatsuo Matsuyama, Hisao Kato, Toshiyuki Miyata. (1996) Clinical significance of activated protein C resistance as a potential marker for hypercoagulable state. Thrombosis Research 82:3, 235-244
CrossRef303
Dominique De Prost, Vincent Delmas, Martine Lefebvre, Catherine Lacombe, Francoise Bridey. (1996) Priapism Revealing ARG 506 to GLN Factor V Mutation. The Journal of Urology1392
CrossRef304
J. EIKELBOOM, J. THOM, F. BOCKXMEER, R. BAKER. (1996) Does activated protein C resistance increase the risk of systemic embolism in non rheumatic atrial fibrillation?. Australian and New Zealand Journal of Medicine 26:2, 243-244
CrossRef305
Dominique De Prost, Vincent Delmas, Martine Lefebvre, Catherine Lacombe, Francoise Bridey. (1996) Priapism Revealing ARG 506 to GLN Factor V Mutation. The Journal of Urology 155:4, 1392
CrossRef306
D GILLESPIE, L CARRINGTON, J GRIFFIN, B ALVING. (1996) Resistance to Activated Protein C: A Common Inherited Cause of Venous Thrombosis. Annals of Vascular Surgery 10:2, 174-177
CrossRef307
W.Craig Hooper, Anne Dilley, Maria J.A. Ribeiro, Jane Benson, Harland Austin, Victor Silva, Peggy Rawlins, Nanette K. Wenger, Bruce L. Evatt. (1996) A racial difference in the prevalence of the Arg506->Gln mutation. Thrombosis Research 81:5, 577-581
CrossRef308
A. Braun, B. Müller, A. A. Rosche. (1996) Population study of the G1691A mutation (R506% FV Leiden) in the human factor V gene that is associated with resistance to activated protein C. Human Genetics 97:2, 263-264
CrossRef309
V. Ganesan, H. Kelsey, J. Cookson, A. Osborn, F.J. Kirkham. (1996) Activated protein C resistance in childhood stroke. The Lancet 347:8996, 260
CrossRef310
MoniekP.M. de Maat, Cornelis Kluft, Jrgen Jespersen, Jrgen Gram, Winnie Schröder, Manuela Koessling, Karin Wulff, Manfred Wehnert, FalkoH. Herrmann, S. Fouéré, F. Guibal, P. Morel, D. Gou, A. Naipal, P.H. Reitsma. (1996) World distribution of factor V Leiden mutation. The Lancet 347:8993, 58-59
CrossRef311
J Emmerich, M Alhenc-Gelas, M Aiach, J.N. Fiessinger. (1996) Resistance to activated protein C: role in venous and arterial thrombosis. Biomedicine & Pharmacotherapy 50:6-7, 254-260
CrossRef312
A. Hillarp, B. Dahlbäck, B. Zöller. (1995) Actuated protein C resistance: From phenotype to genotype and clinical practice. Blood Reviews 9:4, 201-212
CrossRef313
D.C. Rees, M. Cox, J.B. Clegg. (1995) World distribution of factor V Leiden. The Lancet 346:8983, 1133-1134
CrossRef314
(1995) Mutation in the Factor V Gene and the Risk of Myocardial Infarction. New England Journal of Medicine 333:13, 880-881
Full Text315
Jan Eritsland, Gro Gjønnes, Per M. Sandset, Ingebjørg Seljeflot, Harald Arnesen. (1995) Activated protein C resistance and graft occlusion after coronary artery bypass surgery. Thrombosis Research 79:2, 223-226
CrossRef
- Letters
