Original Article
Clearance of HIV Infection in a Perinatally Infected Infant
N Engl J Med 1995; 332:833-838March 30, 1995
- Abstract
Background
We describe a child who was identified shortly after birth as infected with the human immunodeficiency virus type 1 (HIV-1), but whose infection appears to have completely cleared. Asymptomatic HIV-1 infection was diagnosed in the mother during the fourth month of pregnancy. The infant was delivered vaginally at 36 weeks, received no blood products, and was not breast-fed.
Methods and Results
HIV-1 was detected by culture of the infant's peripheral-blood mononuclear cells at 19 and 51 days of age. Plasma from the infant was also culture-positive for HIV-1 at 51 days of age by DNA polymerase chain reaction (PCR). Nucleotide-sequence analysis of HIV-1 DNA showed extremely close homology of the cultures obtained 32 days apart, and forensic markers of genetic identity for the two cultures were identical. Hence, inadvertent viral contamination or error in the collection of specimens was highly unlikely. At 12 months of age the infant was seronegative for HIV-1, and numerous subsequent cultures and tests by PCR have also been negative for HIV-1. The child is five years of age at this writing, is HIV-seronegative, and remains well, with normal growth and development and no laboratory or clinical evidence of HIV-1 infection.
Conclusions
The infant we describe was infected perinatally with HIV-1, but the infection subsequently cleared and the infant remained without detectable HIV-1 infection five years later.
Media in This Article
Figure 1
Age-Specific Prevalence of Immunity to Tetanus According to Racial and Ethnic Group in the NHANES III Population, 1988 to 1991.Table 1
Laboratory Data on the Mother and the Infant before and after Birth.Article Activity
- Article
During the early stages of primary infection with the human immunodeficiency virus type 1 (HIV-1), viral titers in plasma reach high levels. This phase of viremia is followed by a rapid decline, in which viral titers in serum and the load of provirus in peripheral-blood lymphocytes decrease by several orders of magnitude, presumably as a result of cellular or humoral immune mechanisms.1 Lower levels of virus and viral DNA can then persist in asymptomatic people for 10 to 15 years.2 However, humans have not been known to have complete clearance of HIV-1.
It has been estimated that 13 to 40 percent of HIV-1–infected mothers transmit the virus to their infants,3 and most infected infants have symptoms of the acquired immunodeficiency syndrome (AIDS) within a few years. It has been difficult to investigate the early stages of HIV-1 infection in infants, since maternal HIV-1 IgG antibody persists in infants for up to 15 months. Thus, it has been necessary to measure HIV-1 directly by either culture for the virus or the polymerase chain reaction (PCR) for HIV-1 DNA sequences. Using these direct approaches in the early stages of HIV-1 infection in infants, we found several rare cases in which the infants had initial evidence of HIV-1 infection but in which the infections apparently cleared within a few months. In this report we describe one such case in detail.
Case Report
The infant was a 2.3-kg (4-lb, 11-oz) boy born at 36 weeks' gestation by normal vaginal delivery to a 33-year-old woman (gravida 4, para 2, abortus 2) who had been given a diagnosis of asymptomatic HIV-1 infection by routine prenatal testing in approximately the fourth month of pregnancy. The mother reported no intravenous drug abuse, but during the first few months of gestation she had had sexual relations with a former intravenous drug user. The pregnancy was uncomplicated. The mother had a normal absolute CD4 count (>1000 CD4 cells per cubic millimeter) during pregnancy and remained asymptomatic during the next four years.
The infant was normal at birth, but he required hospitalization for mild respiratory distress syndrome for the first eight days. He did not receive blood products or plasma and was not breast-fed. He was followed frequently for evidence of HIV-1 infection as part of a prospective study for early HIV-1 diagnosis. The infant underwent frequent physical examinations and remained asymptomatic subsequently, without any of the physical findings associated with HIV infection. His growth and development were normal, including normal neuropsychological examinations for his age. At this writing he is five years of age and attending kindergarten. The results of his standard laboratory evaluations, including complete blood counts, analyses of blood chemistry, and measurements of serum immunoglobulins, CD4 T-cell subgroups, and CD4/CD8 ratios, have been normal. The results of laboratory studies of the infant, including HIV cocultures; measurements of plasma viremia, p24 antigen (Abbott, Abbott Park, Ill.), and acid-dissociated, immune-complex–dissociated (ICD) p24 antigen (Coulter, Miami); and serum HIV IgA antibody tests by enzyme-linked immunosorbent assay (ELISA) and Western blotting, are shown in Table 1Table 1
Laboratory Data on the Mother and the Infant before and after Birth..Blood obtained from the baby at birth and 19, 33, and 51 days after birth was cultured for HIV-1 in peripheral-blood lymphocytes, as well as plasma, according to standard AIDS Clinical Trials Group (ACTG) methods (Table 1). The cultures of peripheral-blood mononuclear cells were negative at birth, positive 19 days after birth, negative at 33 days, and positive at 51 days of age with a relatively low titer (106 peripheral-blood lymphocytes). The quantitative plasma culture at 51 days was also positive at 100 median tissue-culture infective doses per milliliter. The assays of plasma p24 antigen and acid-dissociated, immune-complex–dissociated p24 antigen were negative in the infant, as were four HIV-1 IgA dot blot assays during the same period.4
Since the child was clinically well and became negative for HIV antibody by ELISA and the Western blot assay at the age of 1 year, at 13 months an HIV-1 culture was again initiated and was negative. Numerous subsequent cocultures using up to 107 peripheral-blood lymphocytes from the infant were also negative for HIV-1. Many additional PCRs of the infant's peripheral-blood lymphocytes have remained negative to the present time, five years after birth. The ELISA for HIV antibody remains negative, and the child remains asymptomatic.
Methods
Blood samples were obtained from the baby at birth and 19, 33, and 51 days after birth, and at various times thereafter until he was five years old. After isolation, peripheral-blood mononuclear cells were cocultured with peripheral-blood mononuclear cells from healthy donors, and the titer of HIV-1 gag p24 antigen was monitored twice a week according to standard ACTG procedures. Quantitative plasma cocultures were also performed according to standard ACTG procedures at 33 and 51 days and at 3 months.5 DNA was isolated from the HIV-1 cultures of peripheral-blood mononuclear cells obtained from the infant at days 19 and 51 and was isolated directly from peripheral-blood mononuclear cells obtained from the mother 12 months after delivery by methods described previously.6 Briefly, the peripheral-blood mononuclear cells from the mother and the cultured samples from the infant were treated with phenol four or five times to remove proteins, then were extracted twice with chloroform–isoamyl alcohol, and were precipitated in ethyl alcohol. The isolated DNA was resuspended in TRIS-EDTA buffer (10 μm TRIS and 1 μm EDTA; pH, 8). Quantitative PCR was performed to determine the concentration of HIV-1 in the samples. With labeled primers M667 and M661, 1 μg of DNA was subjected to 25 cycles of PCR.7 DNA with an equivalent of 200 copies of HIV-1 was used to ensure adequate representation of variant sequences. In later clinical samples of peripheral-blood lymphocytes from the child, primers SK38 and 39 were also used to confirm a negative PCR.
The 5' primer, env22 (GTGGAGGGGAATTCTTCTACTGTAA), and the 3' primer, env21 (GGTACCACCATCTCTTGTTAATAG),6 were used for the PCR amplification and sequence analysis. PCR was performed in a buffer containing Taq polymerase (Boehringer, Mannheim, Germany). After 40 cycles of amplification, the PCR products were loaded onto a 5 percent polyacrylamide gel. Bands of 240 base pairs were recovered by soaking the gel overnight in 0.3 M sodium acetate, 10 mM TRIS–hydrochloric acid, and 1 mM EDTA. Negative control DNA isolated from HIV-1–negative donors and positive control DNA (10 to 1000 copies of the cloned JRCSF strain of HIV-1) were used to check for possible contamination and efficiency of amplification; there was no contamination.
The DNA recovered from the polyacrylamide gel was digested with EcoRI and ligated to the M13mp18 vector digested with EcoRI and SmaI. The ligated DNA was introduced into XL1-Blue cells (Stratagene, La Jolla, Calif.). Positive plaques selected by hybridization screening8 were sequenced with DNA sequencing kits (United States Biochemical, Cleveland). Sequences from the baby, the mother, and the HIV Database9 were assessed with the Clustal program.10 The nucleic acid sequences isolated from the mother and the infant have been deposited in the GenBank data base (accession numbers L33045 through L33074).
Sequences were obtained from three HIV-1 isolates from infants born in California during the same period as the study infant; HIV infection was diagnosed in all three. The sequences were cloned in the laboratory of one of the study authors and included in the comparison. The HIV envelope regions of these isolates (B1VC1, B2VC3, and B3VC14) were cloned into pGEM vector (Promega, Madison, Wis.) after amplification with outer primers 5'RedE1 (GTCAGCACAGTACAATGTAC; positions 6953 to 6972 of HIVJRCSF) and 3'RedE2 (GCACCACTCTTCTCTTTGCC; positions 7711 to 7730 of HIVJRCSF) with inner primers 5'RedE3 (AATTTCTAGATAGGCCAGTAGTATCAACTC; positions 6982 to 7001 of HIVJRCSF) and 3'RedE4 (AATTAAGCTTCACTTCTCCAATTGTCCCTC; positions 7636 to 7657 of HIVJRCSF) and digestion with XbaII and HindIII. The V4 envelope regions of these clones were sequenced with primer RedE4 and automated fluorescent sequencing (Applied Biosystems, Foster City, Calif.). In addition, known sequences from 27 North American HIV isolates, the BRU and OYI isolates from western Europe, and the JY1 isolate from Zaire were used for comparison.
Genetic Typing of Samples
Additional aliquots of frozen peripheral-blood lymphocytes saved from the sample obtained from the infant on day 19, which was positive for HIV by culture, and those obtained at the age of 21/2 years, when he was seronegative, as well as samples from the mother, were examined for genetic identity with the AmpliType PM PCR Amplification and Typing Kit (Perkin–Elmer Roche, Branchburg, N.J.). This kit includes reagents that allow the simultaneous amplification of specific regions of six genetic loci and the subsequent detection of their allelic variants. These independently segregating loci include HLA-DQA1 (DQA1), low-density lipoprotein receptor (LDLR), glycophorin A (GYPA), hemoglobin G gammaglobin (HBGG), D7S8, and group-specific component (GC). The combined power of discrimination for these markers for white people in the United States is 0.9997.
Results
Since this child was positive for HIV-1 on two independent cultures of peripheral-blood lymphocytes obtained 32 days apart, as well as on a plasma culture (performed in a separate laboratory), it is highly unlikely that the early positive cultures from the infant resulted from inadvertent contamination with HIV-1. Nevertheless, to provide further confirmation, we analyzed nucleic acid sequences of PCR-generated clones of the HIV-1 DNA in the two cultures to determine whether the viruses were similar. Similarity would indicate that both came from the infant. We sequenced the V4 and C4 envelope regions of cultured virus (28 independent clones from samples obtained on day 19 and 5 from those obtained on day 51). As evidenced by visual examination of the viral sequences Figure 1Figure 1
Age-Specific Prevalence of Immunity to Tetanus According to Racial and Ethnic Group in the NHANES III Population, 1988 to 1991., as well as by analysis with Clustal software10 (data not shown), the consensus sequences of the infant's two isolates showed close homology, but there was a significant percentage of diversity in comparison with other sequences in the data base. In particular, the sequences differed substantially from the only laboratory strains commonly used in this laboratory (HIV-1JRCSF and HIV-1JRFL). This sequence analysis shows that the two viral isolates from the infant on day 19 and day 51 were very closely related. In addition, we compared the consensus sequence of the isolates from this infant with those of the first viral isolates from three other California-born infants in whom HIV infection was diagnosed during the same period (B1VC1, B3VC14, and B2VC3 in Figure 1). The consensus sequence of the viruses from these three infants was substantially different from those of the two viral isolates from the infant.To eliminate further the possibility of misclassifying the samples, we performed studies of genetic identity by co-amplifying six separate genetic markers by PCR amplification of peripheral-blood lymphocytes saved from the infant at 19 days of age (when the HIV-1 culture was positive) and at the age of 21/2 years (when it was negative). The two samples contained identical six-locus genotypes: DQA1:4.1/4.1, LDLR:AB, GYPA:AB, HBGG:AB, D7S8:BB, and GC:AC. If these six loci are assumed to be statistically independent, the frequency of this genotype (obtained by multiplying the observed frequencies of the genotypes at each locus) was calculated to be 0.00013. If the expected frequencies of the genotypes are multiplied, the frequency of the six-locus genotype would be 0.0032, on the basis of Hardy–Weinberg assumptions. (This calculated difference in frequency is due to the difference between the observed and expected frequencies of DQA1:4.1/4.1 [0.055].) Given one sample with this six-locus genotype, the probability of finding an identical genotype in a randomly selected white population would be less than 1 in 1000.
These data indicate that the two samples probably originated from the same person and that the likelihood of their originating from two different people is extremely low. Thus, it is highly unlikely that contamination in the laboratory or by another clinical sample could account for the two independent positive results in this child. In addition, the mother's peripheral-blood mononuclear cells shared alleles at all six loci with those of the infant, in a manner consistent with this woman's status as the biologic mother of this child.
We compared the nucleotide sequence of the virus obtained from the child with HIV-1 sequences from the mother. Unfortunately, no samples of the mother's blood obtained at the time of delivery were available for analysis. Instead, samples of the mother's lymphocytes 12 months after delivery were used in the sequence analysis. HIV-1 sequences isolated by PCR directly from the DNA of the mother's peripheral-blood lymphocytes were analyzed as described in the case of HIV-1 DNA from the child. Since the mother's peripheral-blood mononuclear cells were not cultured before analysis, there was wide heterogeneity of the HIV-1 sequence. Some of the maternal HIV-1 sequences were closely related to the principal sequence from the child's samples (BC11-1 in Figure 1). However, other HIV-1 sequences from the mother differed from those of the child. This result was expected, given the relatively extended time between the isolation of the HIV-1 DNA samples from the mother and from the child. Therefore, although it is difficult to assign with certainty an evolutionary relationship between the mother's HIV-1 sequences and those of the infant, the similarities suggest such a relationship. When the results of the sequence analysis and the genetic typing are taken together, it is highly likely that both viruses found in the infant originated from the mother.
Discussion
The data we report document the apparent clearance of HIV-1 from an infant infected perinatally. Questions remain about the mechanism involved in this clearance and about whether such an event may occur more frequently than we realize in infants born of HIV-infected mothers, although it may not be detectable because of a low viral load or insensitive assay methods. One potential explanation for transient HIV-positive cultures in an HIV-exposed infant may be the persistence in the infant of infected maternal cells that are ultimately cleared. This is less plausible in this case because there were 19 days to the first positive culture from the infant and infection persisted in the infant for at least 1 month in association with plasma viremia, suggesting a primary infection.1 Even if there were infected maternal cells, they would not explain the failure of the virus to establish infection in the infant.
The infant had an HIV-1–negative blood sample at birth and a positive 19-day HIV-1 coculture, which suggests that he acquired the infection during birth, in accordance with current proposed working definitions of intrapartum and in utero transmission.11 The mother may have had primary or recent HIV infection during pregnancy for several reasons: her absolute CD4 cell counts were in the normal range, she was sexually exposed to a former intravenous drug user during gestation, and she remained asymptomatic with normal CD4 cell counts over the four subsequent years.
A number of studies of maternal–fetal HIV transmission describe other seroreverting infants with some unexplained positive results, including isolated transiently HIV-positive blood cultures, positive serum p24 antigen tests, or both. Borkowsky et al. described 4 of 14 seroreverting well children who had transient p24 antigen in their serum at the age of several months,12 and De Rossi et al. found 3 of 74 seroreverting infants with transiently positive results of PCR, viral culture, or both.13 In several large perinatal cohort studies, a small group (2.5 to 4.7 percent) of seronegative children born to HIV-positive mothers has been identified who had transiently positive viral markers.3,14 Baur et al. described one child with clearance of virus, but the follow-up of that infant was limited.15 A recent report found two seroreverting, clinically well children who had initially positive PCR results in early sequential samples, with subsequent tests that were repeatedly negative.16
Cases such as these have usually been dismissed as laboratory mistakes. In rare cases there have also been reports of infants who became seronegative at the age of 1 year and then became seropositive between 12 and 30 months of age.12 The child we describe, however, had no evidence of HIV infection by any laboratory or clinical measure at the age of five years. He has had no lymphadenopathy for five years, and has had normal neurologic function and growth during that period. Of course, we cannot exclude the remaining possibility — that this child has silent or “hidden” HIV infection in some privileged site such as lymph nodes or the brain.17
Our results indicate that clearance of HIV can occur and may be underrecognized. These findings may also have implications for the sexual transmission of HIV in adults. Previous studies of HIV-1–seronegative homosexual men who are at high risk have suggested that “abortive infection” may have occurred, although this issue has been very controversial.18-22 Recently, Clerici et al. detected T-cell responses to HIV peptides in homosexual men at high risk and in a subgroup of infants born of HIV-infected mothers, who all remained seronegative despite potential exposure to HIV. These studies suggested that early cellular immune responses, as measured by the proliferation of interleukin-2 to HIV-specific peptide antigens, may be associated with the absence of infection.23-25 Other reports have detected HIV-1–specific cytotoxic T-cell responses or lymphoproliferation in response to HIV antigens in the peripheral-blood cells of seroreverting infants born of HIV-infected mothers.21,26,27 Whether there is an immune response to transient infection or an exposure to defective virus or HIV antigens without infection is unknown. The child we studied had no detectable proliferative response in his peripheral-blood cells to HIV-1 MN or IIIB envelope antigens, but further studies with autologous and maternal virus are in progress.
Understanding the mechanism of clearance based on either the biologic characteristics of the virus or the immune response of the host could have profound implications for HIV-1 therapy and vaccine development. Potential exposure to low-dose virus or viral antigens in the presence of maternal antibody may only serve to immunize the infant and create a long-term specific immunity without the production of antibody, as has recently been proposed.28 Zack et al. have reported in vitro results indicating that in quiescent peripheral-blood mononuclear cells, the HIV-1 genome is represented in the form of partially completed reverse transcripts that are labile and have an intracellular half-life of approximately 24 hours before they are cleared without evidence of integration.29 Although there are no in vivo data, these data provide some laboratory rationale for the ability of the host to eliminate the virus in peripheral-blood lymphocytes with low-level exposure without immune stimulation.30 However, the child we studied had virus that was detectable for at least 32 days.
Further careful study of infants with potential exposure to HIV and evidence of clearance of the virus should provide important insights into the pathogenesis of HIV and explain further why over 70 to 80 percent of infants born to HIV-1–infected mothers escape infection.
Supported in part by grants (R01 HD30629 and R01 HD26221) from the National Institute of Child Health and Human Development, by a grant (AI27550) from the AIDS Clinical Trials Group of the National Institute of Allergy and Infectious Diseases, by grants (AI31822, AI29107, and AI32440) from the National Institute of Allergy and Infectious Diseases, by a Clinical Research Center grant (RR-00865) from UCLA, by a Fogarty International AIDS Training Grant (to Dr. Pang), by a scholarship from the Leukemia Society of America (to Dr. Chen), and by a training grant (5-T32-AI07388) from the National Institutes of Health (to Dr. Dickover).
We are indebted to Dr. Ray Apple and Henry Erlich of Roche Molecular Systems for kindly performing the assays of genetic markers; to S. Gillette, M. Dillon, and E.R. Stiehm for their help with this case; to T. Rossomando and W. Aft for assistance in the preparation of the manuscript; to N. Martin and D. Wara (of the University of California, San Francisco) for performing the HIV IgA assay, to Dr. Steve Wolinsky for his helpful comments and review of the manuscript; and to the late Elizabeth Glaser for her continued inspiration.
Source Information
From the Departments of Pediatrics (Y.J.B., L.S.W., R.D.), Urology (S.P.), and Microbiology and Immunology and Medicine (A.D., I.S.Y.C.), UCLA School of Medicine, Los Angeles.
Address reprint requests to Dr. Bryson at the Department of Pediatrics, Division of Infectious Diseases, UCLA School of Medicine, Los Angeles, CA 90024-1752.
- References
References
1
Daar ES ,Moudgil T ,Meyer RD ,Ho DD . Transient high levels of viremia in patients with primary human immunodeficiency virus type 1 infection. N Engl J Med 1991;324:961-964
Full Text | Web of Science | Medline2
Ho DD ,Moudgil T ,Alam M . Quantitation of human immunodeficiency virus type 1 in the blood of infected persons. N Engl J Med 1989;321:1621-1625
Full Text | Web of Science | Medline3
European Collaborative Study
CrossRef | Web of Science | Medline4
Martin NL ,Levy JA ,Legg H ,Weintrub PS ,Cowan MJ ,Wara DW . Detection of infection with human immunodeficiency virus (HIV) type 1 in infants by an anti-HIV immunoglobulin A assay using recombinant proteins. J Pediatr 1991;118:354-358
CrossRef | Web of Science | Medline5
Pang S ,Koyanagi Y ,Miles S ,Wiley C ,Vinters HV ,Chen IS . High levels of unintegrated HIV-1 DNA in brain tissue of AIDS dementia patients. Nature 1990;343:85-89
CrossRef | Web of Science | Medline6
Pang S ,Vinters HV ,Akashi T ,O'Brien WA ,Chen IS . HIV-1 env sequence variation in brain tissue of patients with AIDS-related neurologic disease. J Acquir Immune Defic Syndr 1991;4:1082-1092
Web of Science | Medline7
Lee H ,Swanson P ,Shorty VS ,Zack JA ,Rosenblatt JD ,Chen IS . High rate of HTLV-II infection in seropositive i.v. drug abusers in New Orleans. Science 1989;244:471-475
CrossRef | Web of Science | Medline8
Sambrook J, Fritsch E, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Plainview, N.Y.: Cold Spring Harbor Laboratory Press, 1989.
9
Myers G. Human retroviruses and AIDS compendium. Los Alamos, N.M.: Los Alamos National Laboratory, 1992.
10
Higgins DG ,Sharp PM . CLUSTAL: a package for performing multiple sequence alignment on a microcomputer. Gene 1988;73:237-244
CrossRef | Web of Science | Medline11
Bryson YJ ,Luzuriaga K ,Sullivan JL ,Wara DW . Proposed definitions for in utero versus intrapartum transmission of HIV-1. N Engl J Med 1992;327:1246-1247
Full Text | Web of Science | Medline12
Borkowsky W ,Krasinski K ,Paul D , et al. Human immunodeficiency virus type 1 antigenemia in children. J Pediatr 1989;114:940-945
CrossRef | Web of Science | Medline13
De Rossi A ,Ades AE ,Mammano F , et al. Antigen detection, virus culture, polymerase chain reaction, and in vitro antibody production in the diagnosis of vertically transmitted HIV-1 infection. AIDS 1991;5:15-20
CrossRef | Web of Science | Medline14
Tovo PA ,de Martino M ,Gabiano C , et al. Prognostic factors and survival in children with perinatal HIV-1 infection: the Italian register for HIV infections in children. Lancet 1992;339:1249-1253
CrossRef | Web of Science | Medline15
Baur A ,Schwarz N ,Ellinger S , et al. Continuous clearance of HIV in a vertically infected child. Lancet 1989;2:1045-1045
CrossRef | Web of Science | Medline16
Pahwa S, Abrahms E, Tetali S, et al. Diagnosis of infection status in infants born to HIV infected women. In: Abstracts of the Ninth International Conference on AIDS/Fourth STD World Congress, Berlin, Germany, June 6–11, 1993. Vol. 1. London: Wellcome Foundation, 1993:306. abstract.
17
Pantaleo G ,Graziosi C ,Demarest JF , et al. HIV infection is active and progressive in lymphoid tissue during the clinically latent stage of disease. Nature 1993;362:355-358
CrossRef | Web of Science | Medline18
Imagawa DT ,Lee MH ,Wolinsky SM , et al. Human immunodeficiency virus type 1 infection in homosexual men who remain seronegative for prolonged periods. N Engl J Med 1989;320:1458-1462
Full Text | Web of Science | Medline19
Horsburgh CR Jr ,Ou CY ,Jason J , et al. Duration of human immunodeficiency virus infection before detection of antibody. Lancet 1989;2:637-640
CrossRef | Web of Science | Medline20
Pan LZ ,Sheppard HW ,Winkelstein W ,Levy JA . Lack of detection of human immunodeficiency virus in persistently seronegative homosexual men with high or medium risks for infection. J Infect Dis 1991;164:962-964
CrossRef | Web of Science | Medline21
Borkowsky W ,Krasinski K ,Moore T ,Papaevangelou V . Lymphocyte proliferative responses to HIV-1 envelope and core antigens by infected and uninfected adults and children. AIDS Res Hum Retroviruses 1990;6:673-678
CrossRef | Web of Science | Medline22
Soriano V ,Hewlett I ,Tor J ,Clotet B ,Epstein J ,Foz M . Silent HIV infection in heterosexual partners of seropositive drug abusers in Spain. Lancet 1990;335:860-860
CrossRef | Web of Science | Medline23
Shearer GM ,Sison AV ,Rakusan T , et al. In vitro T cell immunity to HIV synthetic peptides and other antigens by peripheral blood leukocytes from HIV-infected women and by cord blood from their offspring. J Cell Biochem Suppl 1992;16:112-112 abstract.24
Clerici M ,Berzofsky JA ,Shearer GM ,Tacket CO . Exposure to human immunodeficiency virus (HIV) type I indicated by HIV-specific T helper cell responses before detection of infection by polymerase chain reaction and serum antibodies. J Infect Dis 1991;164:178-182[Erratum, J Infect Dis 1991;164:832.]
CrossRef | Web of Science | Medline25
Clerici M ,Giorgi JV ,Chou CC , et al. Cell-mediated immune response to human immunodeficiency virus (HIV) type 1 in seronegative homosexual men with recent sexual exposure to HIV-1. J Infect Dis 1992;165:1012-1019
CrossRef | Web of Science | Medline26
Cheynier R ,Langlade-Demoyen P ,Marescot MR , et al. Cytotoxic T lymphocyte responses in the peripheral blood of children born to human immunodeficiency virus-1-infected mothers. Eur J Immunol 1992;22:2211-2217
CrossRef | Web of Science | Medline27
Pollack H ,Zhan MX ,Ilmet-Moore T ,Ajuang-Simbiri K ,Krasinski K ,Borkowsky W . Ontogeny of anti-human immunodeficiency virus (HIV) antibody production in HIV-1-infected infants. Proc Natl Acad Sci U S A 1993;90:2340-2344
CrossRef | Web of Science | Medline28
Salk J ,Bretscher PA ,Salk PL ,Clerici M ,Shearer GM . A strategy for prophylactic vaccination against HIV. Science 1993;260:1270-1272
CrossRef | Web of Science | Medline29
Zack JA ,Haislip AM ,Krogstad P ,Chen IS . Incompletely reverse-transcribed human immunodeficiency virus type 1 genomes in quiescent cells can function as intermediates in the retroviral life cycle. J Virol 1992;66:1717-1725
Web of Science | Medline30
Bukrinsky MI ,Stanwick TL ,Dempsey MP ,Stevenson M . Quiescent T lymphocytes as an inducible virus reservoir in HIV-1 infection. Science 1991;254:423-427
CrossRef | Web of Science | Medline
- Citing Articles (59)
Citing Articles
1
S. Kageha, V. Okoth, S. Kadima, S. Vihenda, E. Okapesi, E. Nyambura, A. Maiyo, N. Ndung'u, S. Khamadi, M. Mwau. (2011) Discrepant test findings in Early Infant Diagnosis of HIV in a National Reference Laboratory in Kenya: Challenges and Opportunities for Programs. Journal of Tropical Pediatrics
CrossRef2
Arman Nabatiyan, Zaheer A. Parpia, Robert Elghanian, David M. Kelso. (2011) Membrane-based plasma collection device for point-of-care diagnosis of HIV. Journal of Virological Methods 173:1, 37-42
CrossRef3
Debrah I Boeras, Nicole Luisi, Etienne Karita, Shila McKinney, Tyronza Sharkey, Michelle Keeling, Elwyn Chomba, Colleen Kraft, Kristin Wall, Jean Bizimana, William Kilembe, Amanda Tichacek, Angela M Caliendo, Eric Hunter, Susan Allen. (2011) Indeterminate and discrepant rapid HIV test results in couples' HIV testing and counselling centres in Africa. Journal of the International AIDS Society 14:1, 18
CrossRef4
Sarah M Lofgren, Anne B Morrissey, Caroline C Chevallier, Anangisye I Malabeja, Sally Edmonds, Ben Amos, David J Sifuna, Lorenz von Seidlein, Werner Schimana, Wendy S Stevens, John A Bartlett, John A Crump. (2009) Evaluation of a dried blood spot HIV-1 RNA program for early infant diagnosis and viral load monitoring at rural and remote healthcare facilities. AIDS 23:18, 2459-2466
CrossRef5
Yvonne A. Maldonado. 2006. Acquired Immunodeficiency Syndrome in the Infant. , 667-692.
CrossRef6
Omar Bagasra, Kiley R. Prilliman. (2004) RNA interference: The molecular immune system. The Histochemical Journal 35:6, 545-553
CrossRef7
SYBILLE MULLER. (2004) AVOIDING DECEPTIVE IMPRINTING OF THE IMMUNE RESPONSE TO HIV-1 INFECTION IN VACCINE DEVELOPMENT. International Reviews of Immunology 23:5-6, 423-436
CrossRef8
Robin W. Allison, Edward A. Hoover. (2003) Covert Vertical Transmission of Feline Immunodeficiency Virus. AIDS Research and Human Retroviruses 19:5, 421-434
CrossRef9
Nabila M. Wassef, Janet Young, Roger Miller. (2003) Viral Reservoirs/Transient Infection in HIV/AIDS: Where Are We Now and Where Should We Go? Summary of the June 13–14, 2002 Think Tank Meeting. AIDS Research and Human Retroviruses 19:4, 333-344
CrossRef10
Donald P Kotler. (2003) Human immunodeficiency virus and pregnancy. Gastroenterology Clinics of North America 32:1, 437-448
CrossRef11
Louise Kuhn, Stephen Meddows‐Taylor, Glenda Gray, Caroline Tiemessen. (2002) Human Immunodeficiency Virus (HIV)–Specific Cellular Immune Responses in Newborns Exposed to HIV In Utero. Clinical Infectious Diseases 34:2, 267-276
CrossRef12
Oronzo Ceci, Marcella Margiotta, Fiorino Marello, Ruggiero Francavilla, Pasquale Loizzi, Antonio Francavilla, Angela Mautone, Luigi Impedovo, Enzo Ierardi, Maria Mastroianni, Stefano Bettocchi, Luigi Selvaggi. (2001) Vertical Transmission of Hepatitis C Virus in a Cohort of 2,447 HIV-Seronegative Pregnant Women: A 24-Month Prospective Study. Journal of Pediatric Gastroenterology and Nutrition 33:5, 570-575
CrossRef13
Lainie Friedman Ross. (2001) Genetic Exceptionalism vs. Paradigm Shift: Lessons from HIV. The Journal of Law, Medicine & Ethics 29:2, 141-148
CrossRef14
Gautam K. Sahu, Jenny J. Y. Chen, Jason C. Huang, Keith M. Ramsey, Miles W. Cloyd. (2001) Transient or occult HIV-1 infection in high-risk adults. AIDS 15:9, 1175-1177
CrossRef15
Lainie Friedman Ross. (2001) Genetic Exceptionalism vs. Paradigm Shift: Lessons from HIV. The Journal of Law, Medicine & Ethics 29:1, 141-148
CrossRef16
Jean-Pierre Allain. (2000) Will genome detection replace serology in blood screening for microbial agents?. Best Practice & Research Clinical Haematology 13:4, 615-629
CrossRef17
Keith R Fowke, Rupert Kaul, Kenneth L Rosenthal, Julius Oyugi, Joshua Kimani, W John Rutherford, Nico JD Nagelkerke, T Blake Ball, Job J Bwayo, J Neil Simonsen, Gene M Shearer, Francis A Plummer. (2000) HIV-1-specific cellular immune responses among HIV-1-resistant sex workers. Immunology and Cell Biology 78:6, 586-595
CrossRef18
Hugo Guevara, Elizabeth Johnston, Lynn Zijenah, Ocean Tobaiwa, Peter Mason, Christopher Contag, Kassam Mahomed, Michael Hendry, David Katzenstein. (2000) Prenatal Transmission of Subtype C HIV-1 in Zimbabwe: HIV-1 RNA and DNA in Maternal and Cord Blood. JAIDS Journal of Acquired Immune Deficiency Syndromes 25:5, 390-397
CrossRef19
Hugo Guevara, Elizabeth Johnston, Lynn Zijenah, Ocean Tobaiwa, Peter Mason, Christopher Contag, Kassam Mahomed, Michael Hendry, David Katzenstein. (2000) Prenatal Transmission of Subtype C HIV-1 in Zimbabwe: HIV-1 RNA and DNA in Maternal and Cord Blood. Journal of Acquired Immune Deficiency Syndromes390-397
CrossRef20
Omar Bagasra, Muhammad Amjad. (2000) Applied Immunohistochemistry 8:2, 133-146
CrossRef21
Leslie A. Obert, Edward A. Hoover. (2000) Feline Immunodeficiency Virus Clade C Mucosal Transmission and Disease Courses. AIDS Research and Human Retroviruses 16:7, 677-688
CrossRef22
Andrea De Maria, Lorenzo Moretta. (2000) HLA-class I-specific inhibitory receptors in HIV-1 infection. Human Immunology 61:1, 74-81
CrossRef23
S. Fadel, M. Sarzotti. (2000) Cellular Immune Responses in Neonates. International Reviews of Immunology 19:2-3, 173-193
CrossRef24
Frank Notka, Christiane Stahl-Hennig, Ulf Dittmer, Hans Wolf, Ralf Wagner. (1999) Accelerated clearance of SHIV in rhesus monkeys by virus-like particle vaccines is dependent on induction of neutralizing antibodies. Vaccine 18:3-4, 291-301
CrossRef25
F. Notka, C. Stahl-Hennig, U. Dittmer, H. Wolf, R. Wagner. (1999) Construction and Characterization of Recombinant VLPs and Semliki-Forest Virus Live Vectors for Comparative Evaluation in the SHIV Monkey Model. Biological Chemistry 380:3, 341-352
CrossRef26
M.-C. Boily, B.R. Mâsse, K. Desai, M. Alary, R.M. Anderson. (1999) Some important issues in the planning of phase III HIV vaccine efficacy trials. Vaccine 17:7-8, 989-1004
CrossRef27
ANDREA MANGANO, GABRIELA PITTIS, CECILIA GALINDEZ, ROSA BOLOGNA, LUISA SEN. (1998) Reliability of Laboratory Markers of HIV-1 Infection in Argentinean Infants at Risk of Perinatal Infection. AIDS Patient Care and STDs 12:9, 691-696
CrossRef28
JOHN J. LIPUMA. (1998) Molecular tools for epidemiologic study of infectious diseases. The Pediatric Infectious Disease Journal 17:8, 667-675
CrossRef29
KOEN K.A. VAN ROMPAY, MARTA L. MARTHAS, JEFFREY D. LIFSON, CHRISTOPHER J. BERARDI, GABRIELA M. VASQUEZ, ELMO AGATEP, ZIA A. DEHQANZADA, KENNETH C. CUNDY, NORBERT BISCHOFBERGER, NIELS C. PEDERSEN. (1998) Administration of 9-[2-(Phosphonomethoxy)propyl] adenine (PMPA) for Prevention of Perinatal Simian Immunodeficiency Virus Infection in Rhesus Macaques. AIDS Research and Human Retroviruses 14:9, 761-773
CrossRef30
Denise E. Kirschner, Ramit Mehr, Alan S. Perelson. (1998) Role of the Thymus in Pediatric HIV-1 Infection. Journal of Acquired Immune Deficiency Syndromes and Human Retrovirology 18:2, 95-109
CrossRef31
Donald P. Kotler. (1998) HIV IN PREGNANCY. Gastroenterology Clinics of North America 27:1, 269-280
CrossRef32
André Nahmias, Carlos Abramowsky, Istvan Dobronyi, Chris Ibegbu, Sheryl Henderson. (1998) Infection and immunity at the maternal-placental-fetal interface: Focus on HIV-1. Placenta 19, 103-124
CrossRef33
L MOFENSON. (1997) MOTHER-CHILD HIV-1 TRANSMISSIONTiming and Determinants. Obstetrics and Gynecology Clinics of North America 24:4, 759-784
CrossRef34
JB ZIEGLER, P PALASANTHIRAN. (1997) Paediatric HIV update. Journal of Paediatrics and Child Health 33:5, 373-377
CrossRef35
Shin-ichiro Fujii, Kenshi Obaru, Shuzo Matsushita, Tatsuma Morikita, Hirofumi Higuchi, Koji Fujimoto, Kiyoshi Takatsuki. (1997) Characterization of Proviral DNA From an Individual With Long-Term, Nonprogressive Infection With HIV-1 and Nonrecoverable Virus. Journal of Acquired Immune Deficiency Syndromes and Human Retrovirology 15:4, 247-256
CrossRef36
LAURENT MANDELBROT. (1997) Timing of In Utero HIV Infection: Implications for Prenatal Diagnosis and Management of Pregnancy. AIDS Patient Care and STDs 11:3, 139-147
CrossRef37
LYNNE L. O'NEIL, MARY JO BURKHARD, LESLIE A. OBERT, EDWARD A. HOOVER. (1997) Regression of Feline Immunodeficiency Virus Infection. AIDS Research and Human Retroviruses 13:8, 713-718
CrossRef38
Luzuriaga, Katherine, Bryson, Yvonne, Krogstad, Paul, Robinson, James, Stechenberg, Barbara, Lamson, Michael, Cort, Susannah, Sullivan, John L., . (1997) Combination Treatment with Zidovudine, Didanosine, and Nevirapine in Infants with Human Immunodeficiency Virus Type 1 Infection. New England Journal of Medicine 336:19, 1343-1349
Full Text39
Robert J. Biggar, Wendel Miley, Paolo Miotti, Taha E. Taha, Ann Butcher, Joanne Spadoro, David Waters. (1997) Blood Collection on Filter Paper. Journal of Acquired Immune Deficiency Syndromes & Human Retrovirology 14:4, 368-373
CrossRef40
Glen N. Gaulton, Janice V. Scobie, Michael Rosenzweig. (1997) HIV-1 and the thymus. AIDS 11:4, 403-414
CrossRef41
William A. Paxton, Richard A. Koup. (1997) Mechanisms of resistance to HIV infection. Springer Seminars in Immunopathology 18:3, 323-340
CrossRef42
Mao-Yuan Chen, Chien-Chang Hung, Yvonne G. Lin, Ruey-Yi Lin, Shing Jer Twu, Ying-Chin Ko, Hong-Nerng Ho, Chang-Ping Lin, Shiu-Feng Huang, Mary Ellen Kerrigan, Jacqueline Whang-Peng, Che-Yen Chuang, Kenneth S.S. Chang, Juei-Low Sung, Hong-Jen Chang, Yaw-Tang Shih, Po-Ya Chang. (1996) Reappraisal of the early diagnostic value of serial analyses of western blot patterns for HIV infection in neonates. International Journal of Infectious Diseases 1:2, 83-86
CrossRef43
Barton F Haynes. (1996) HIV vaccines: where we are and where we are going. The Lancet 348:9032, 933-937
CrossRef44
Margaret I. Johnston. (1996) HIV/AIDS Vaccine Development: Challenges, Progress and Future Directions. Reviews in Medical Virology 6:3, 123-140
CrossRef45
Roger Detels, Dean Mann, Mary Carrington, Karen Hennessey, Zunyou Wu, Karim F. Hirji, Dorothy Wiley, Barbara R. Visscher, Janis V. Giorgi. (1996) Persistently seronegative men from whom HIV-1 has been isolated are genetically and immunologically distinct. Immunology Letters 51:1-2, 29-33
CrossRef46
Wayne C. Koff, Alan M. Schultz. (1996) Progress and challenges toward an AIDS vaccine: Brother, can you spare a paradigm?. Journal of Clinical Immunology 16:3, 127-133
CrossRef47
McMichael, Andrew, , Koup, Richard, , Ammann, Arthur J., . (1996) Transient HIV Infection in Infants. New England Journal of Medicine 334:12, 801-802
Full Text48
Dimitri Viza. (1996) AIDS and transfer factor: Myths, certainties and realities. Biotherapy 9:1-3, 17-26
CrossRef49
Christoph Rudin, Hans-Peter Senn, Urs B. Schaad. (1996) TRANSIENT INFECTION IN HUMAN IMMUNODEFICIENCY VIRUS TYPE 1-EXPOSED INFANTS. The Pediatric Infectious Disease Journal 15:2, 182
CrossRef50
M-L Newell, D Dunn, C Peckham, A De Maria, A Ferrazin, A De Rossi, C Giaquinto, J Levy, A Alimenti, A Ehrnst, A-B Bohlin, R Ljung. (1996) Detection of virus in vertically exposed HIV-antibody-negative children. The Lancet 347:8996, 213-215
CrossRef51
Alexander M. Scharko, Franklin M. Graziano, Miroslav Malkovsky, C.David Pauza, Marianne Wallace. (1995) Persistent non-B cell lymphocytosis in HIV-infected individuals. Immunology Letters 48:2, 157-158
CrossRef52
Marie-Louise Newell, Clive Loveday, David Dunn, Steve Kaye, Richard Tedder, Catherine Peckham, Andrea De Maria, Carlo Giaquinto, Felix Omenaca, Cipriano Canosa, Antonio M??r. (1995) Use of polymerase chain reaction and quantitative antibody tests in children born to human immunodeficiency virus-1-infected mothers. Journal of Medical Virology 47:4, 330-335
CrossRef53
Michèl R Klein, Frank Miedema. (1995) Long-term survivors of HIV-1 infection. Trends in Microbiology 3:10, 386-391
CrossRef54
Peckham, Catherine, Gibb, Diana, . (1995) Mother-to-Child Transmission of the Human Immunodeficiency Virus. New England Journal of Medicine 333:5, 298-303
Full Text55
(1995) Clearance of HIV in an Infant. New England Journal of Medicine 333:5, 319-320
Full Text56
William E Paul. (1995) Can the immune response control HIV infection?. Cell 82:2, 177-182
CrossRef57
Joseph M McCune. (1995) Viral latency in HIV disease. Cell 82:2, 183-188
CrossRef58
McIntosh, Kenneth, Burchett, Sandra K., . (1995) Clearance of HIV — Lessons from Newborns. New England Journal of Medicine 332:13, 883-884
Full Text59
MARINELLA PORTOLANI, MARISA MEACCI, MONICA PECORARI, PAOLA PIETROSEMOLI, CLAUDIO CERMELLI, MONICA CELLINI, AURO TAMPIERI, PIERLUIGI TARTONI, FRANCESCO STELLA. (1995) Quantitation of HIV-1 p24 Antibody Expressed as Relative Binding Capacity p24 Antigen (p24 RBC) in Infants Born to HIV-1 Seropositive Mothers: Correlation of This Serological Marker with the HIV-1 Maternal Antibody Course and p24 Antigenemia Detection. Viral Immunology 8:2, 93-99
CrossRef
- Letters
