Original Article
Bartonella (Rochalimaea) quintana Endocarditis in Three Homeless Men
N Engl J Med 1995; 332:419-423February 16, 1995
- Abstract
Background
Bartonella (Rochalimaea) quintana is the agent of trench fever and is transmitted by the body louse. We searched for this organism in three alcoholic homeless men with endocarditis.
Methods
Blood samples were cultured on a human endothelial cell line and on blood agar. Bacteria were identified by sequencing the amplified 16S ribosomal RNA gene. The presence of bartonella in tissue was assessed by Gram's staining, immunostaining, and polymerase-chain-reaction amplification. Serologic studies for antibodies to bartonella species were performed by indirect immunofluorescence and Western immunoblotting.
Results
B. quintana was isolated from one patient in the blood-agar culture and from the other two patients in the endothelial-cell culture. The organism was also identified by both immunostaining and molecular techniques in the valvular vegetations from the three patients and in a cervical lymph node from one patient. The 16S ribosomal RNA gene sequences of the three isolates were almost identical to that of the prototype strain of B. quintana. High titers of antibodies to B. quintana were detected in all three patients, but so were cross-reacting antibodies to chlamydia species. In all three patients studies were repeatedly negative for antibodies to the human immunodeficiency virus.
Conclusions
B. quintana is a cause of endocarditis in homeless patients and may be serologically misdiagnosed as a chlamydial infection.
Media in This Article
Figure 2
Western Blot Immunoassay of Serum Samples from Three Patients with B. quintana Endocarditis.Figure 1
Immunofluorescence Staining of B. quintana in a Cardiac Valve from Patient 1 (×2000).Article Activity
- Article
Bartonella quintana, the agent of trench fever, affected about 1 million soldiers during World War I and a smaller number during World War II. Sporadic reports have suggested that infection with this agent, which is transmitted by the body louse, is not restricted to wartime.1 Over the past few years, B. quintana (formerly known as Rochalimaea quintana) has been reported in North America in 5 patients infected with the human immunodeficiency virus (HIV),2,3 including 1 with endocarditis,4 and in 10 HIV-negative patients, including 1 with subacute endocarditis5 (and Spach DH: personal communication). We recently described two additional strains isolated from blood specimens obtained from patients with bacillary angiomatosis6 and one from a patient with chronic adenopathy.7 We now report on three homeless men with B. quintana endocarditis.
Case Reports
Patient 1
Patient 1 was a 47-year-old man who presented with fatigue, fever, a weight loss of 12 kg, and purpura of the lower limbs. His medical history included a heart murmur and chronic alcoholism. He had been homeless for one year and had been in contact with a dog but reported no dog bites or scratches. The weight loss, fatigue, and fever had started six months before admission.
At the time of admission, physical examination revealed a temperature of 38.5°C, bilateral epistaxis, and purpura of the lower limbs. The pulse was 110 beats per minute and the blood pressure was 105/60 mm Hg, with a grade 4/6 systolic murmur of mitral regurgitation and a gallop rhythm. An echocardiogram showed severe mitral regurgitation, perforation of the mitral valve with ruptured chordae, and an echogenic mass on the mitral valve. There was also an echogenic mass on the posterior cusp of the aortic valve and moderate aortic regurgitation.
Pertinent laboratory data are presented in Table 1Table 1
Demographic, Clinical, and Serologic Characteristics of Three Men with B. quintana Endocarditis.. Eight sets of blood cultures were performed. Enzyme-linked immunosorbent assays and Western blot immunoassays for HIV-1 antibody, performed at the time of admission and repeated two months later, were negative.Therapy was begun with a continuous intravenous infusion of amoxicillin (12 g per day) and gentamicin (180 mg per day). The mitral insufficiency became more marked, and on day 4 the patient underwent mitral-valve replacement with a Starr prosthesis. Pathological examination of the excised valve disclosed fibrin vegetation. Numerous minute coccobacillary organisms were observed after Gram's staining, but the culture of tissue from the valve remained sterile.
The same antibiotic treatment was continued for six weeks. The patient reported dysphonia, and an enlarged cervical lymph node was excised for diagnostic purposes. Five of the eight blood cultures grew a gram-negative bacillus subsequently identified as B. quintana, and the patient's serum had high titers of antibody to B. quintana (Table 2Table 2
IgG Antibodies against B. quintana Grown on 5 Percent Sheep-Blood Agar (Agar) and Human Endothelial Cells (Cells), B. henselae, C. pneumoniae, C. psittaci, and C. trachomatis in the Three Patients with B. quintana Endocarditis.). The patient remained well 10 months after surgery.Patient 2
Patient 2 was a 41-year-old man who presented with a temperature of 38.5°C and an erythematous lesion of the right foot. He was homeless and lived in close contact with two dogs, a cat, kittens, and a goat. He had a history of alcoholism and cigarette smoking. Aortic insufficiency was diagnosed clinically at the time of admission, and echocardiography revealed abnormal aortic cusps with one vegetation and dilatation of the left ventricle. The cutaneous lesions were clinically diagnosed as septic emboli but were not examined by biopsy. Blood cultures performed according to routine procedures were negative.
The patient was treated for three weeks with intravenous vancomycin combined with ofloxacin and netilmicin, followed by oral rifampin plus ofloxacin and pristinamycin for three additional weeks. The patient, then afebrile, was admitted to the Hôpital Louis Pradel (Lyons, France) for aortic-valve replacement. Pertinent laboratory data are shown in Table 1. Enzyme-linked immunosorbent assays and Western blot immunoassays, performed at the time of surgery and repeated three months later, were negative for HIV-1 antibody. Examination of the aortic valve at the time of surgery revealed numerous perforations of the cusps and multiple vegetations of the aortic ring. The valve was excised, and a mechanical prosthetic valve was implanted. Histologic examination of the valve showed vegetations consisting of fibrin and platelets. The patient received intravenous antibiotic treatment with vancomycin plus ofloxacin for two weeks after surgery, followed by doxycycline for four weeks. He was well six months after surgery.
Patient 3
Patient 3 was a 43-year-old man who presented with congestive heart failure and fever. He was a former soldier in the French Foreign Legion, had been back in France for 10 years, and was living in poor sanitary conditions in a seedy hotel close to the harbor in Marseilles. He had no contact with animals. He was an alcoholic and a cigarette smoker. His medical history was unremarkable with the exception of an episode of undiagnosed microscopic hematuria in 1983. Progressive dyspnea and cough developed one month before his hospitalization.
Clinical examination at the time of admission disclosed a 15-kg weight loss, a rectal temperature of 38.5°C, jaundice, cough, peripheral edema, hepatomegaly, splenomegaly, and loud systolic aortic and mitral murmurs. A chest radiograph showed marked cardiomegaly and a diffuse interstitial infiltrate. Pertinent laboratory results are shown in Table 1. Enzyme-linked immunosorbent assays and Western-blot tests for the presence of HIV-1 antibodies, performed at the time of admission and repeated 40 days later, were negative. Six blood cultures were performed, and empirical treatment with intravenous ceftazidime (3 g per day) plus ofloxacin (400 mg per day) was prescribed. Transthoracic echocardiography disclosed an aortic vegetation and a left ventricular ejection fraction of 30 percent. A diagnosis of infectious endocarditis with severe cardiac failure was made. The fever resolved after two days of antibiotic therapy. Netilmicin (300 mg per day) was added to the regimen when infection with B. quintana was suspected.
The aortic and mitral valves were excised five weeks after admission and replaced by a Carpentier-type bioprosthesis and a Hancock II–type bioprosthesis, respectively. Antibiotic therapy was continued for three weeks. Vegetations were observed on both valves, and microscopical examination confirmed the presence of infectious endocarditis. All microbiologic studies were negative, with the exception of serologic tests for chlamydia and bartonella species (Table 2). The patient died four months after surgery; no autopsy was performed.
Methods
Bacterial Strains
The following bacterial strains were obtained from the American Type Culture Collection (ATCC, Rockville, Md.): B. quintana (Fuller strain, ATCC VR358), B. henselae (Houston, ATCC 49882), Chlamydia pneumoniae (ATCC VR1310), C. psittaci (ATCC VR601), and C. trachomatis (ATCC VR878). B. quintana, Oklahoma strain, was provided by D.F. Welch; B. quintana, Toulouse strain, is a local isolate.6
Isolation Procedures
The blood samples, obtained in Bactec blood-culture bottles, and the excised cardiac valves were plated on 5 percent sheep-blood agar incubated at 37°C in an atmosphere of 5 percent carbon dioxide and on human endothelial-cell-line ECV 304,8 cultivated as previously described.3
Identification of the Isolates
For the antigenic characterization, the isolates were allowed to react with serial dilutions of polyclonal mouse anti–B. quintana serum and with a monoclonal antibody specific for B. henselae, with the use of an indirect immunofluorescence technique described previously.6 Analysis of cell-wall fatty acids was carried out as previously reported9 in the first isolate only. Restriction-fragment–length polymorphisms (RFLPs) were analyzed in a portion of the citrate–synthase gene amplified by the polymerase chain reaction (PCR).10 16S ribosomal RNA (rRNA) gene sequencing was performed on amplified products with the use of the direct, solid-phase method.11 For PCR amplifications, quick DNA extractions were performed with bacteria grown in agar (the first isolate) or cell culture (the second and third isolates), with the use of the Chelex 100 method.12 A fragment of the 16S rRNA gene (approximately 1400 base pairs [bp]) was amplified by PCR with the f D1 primer described by Weisburg et al.,13 with 5' biotin labeling and primer roc4 (5'CACCCCAGTCGCTGACCCTA3'). After immobilization of the biotinylated amplicon with streptavidin-coupled magnetic beads (Dynabeads M-280, Dynal, Oslo, Norway) and alkaline denaturation, the immobilized products were sequenced with an automatic sequencer (ALF DNA sequencer, Pharmacia Biotech, Uppsala, Sweden) and the Autoread sequencing kit supplied by the same manufacturer. 5'-Fluorescein–labeled primers roc1 (5'AGGCACGAAGTTAGCCGGGGC3'), roc2 (5'ATCGTTTACGGCGTGGACTAC3'), roc3 (5'GAGGGTTGCGCTCGTTGCGGG3'), and roc4 were used for sequencing the direct DNA strand. For each isolate, the sequence was determined four times. The sequences for the isolates were compared with those of B. quintana, B. henselae, B. elizabethae, and B. vinsonii in GenBank through Bisance,14 with the use of the Clustal package.15 The Fuller and Oklahoma strains of B. quintana were used as controls.
Detection of B. quintana in Tissues
A formalin-fixed, paraffin-embedded cervical lymph node from Patient 1 and formalin-fixed, paraffin-embedded cardiac valves from all three patients were examined after Gram's and Giménez staining.16 Immunofluorescent staining was performed with mouse polyclonal anti–B. quintana serum. The immunohistochemical analysis was a modification of that described by Dumler et al.17 Alkaline phosphatase and fast red were used to stain the tissue specimens after incubation with mouse polyclonal anti–B. quintana serum. PCR amplification of a portion of the bartonella citrate–synthase gene was also used to detect these organisms in the tissue specimens.10
Serologic Studies
Serum samples were reacted with two B. quintana, Oklahoma strain, antigen preparations. In one preparation, the bacteria were grown on 5 percent sheep-blood agar and resuspended in formaldehyde. In the other preparation, the bacteria were propagated on the ECV 304 cell line, purified by low-speed centrifugation of the cell-culture supernatant, and resuspended in formaldehyde. Antibodies were detected by a microimmunofluorescence technique.6 A Western blot immunoassay was performed as previously reported,6 with bacteria grown on 5 percent sheep-blood agar used as antigens, both boiled and not boiled. Mouse polyclonal anti–B. quintana serum was used as a positive control. The presence of IgG, IgA, and IgM antibodies against C. pneumoniae, C. trachomatis, and C. psittaci was determined by microimmunofluorescence. To detect cross-reactivity, one serum sample from Patient 1 was adsorbed with C. pneumoniae or blood-agar–grown B. quintana, Oklahoma strain, and tested against B. quintana and C. pneumoniae.
Results
Isolation of Bacteria
The first strain, isolated from a blood sample from Patient 1, was grown on sheep-blood agar after 27 days of incubation and was subsequently subcultured on sheep-blood agar and on endothelial cells (Table 1). The second and third isolates, obtained from blood samples from Patients 2 and 3, were grown only on endothelial cells after 20 and 15 days of incubation, respectively. Subsequent attempts to culture these organisms on sheep-blood agar were unsuccessful. Cultures of the excised valves remained sterile.
Identification of the Isolates
After Giménez staining, the three isolates appeared as thin bacilli or coccobacilli. They reacted with mouse polyclonal antibody against B. quintana but not with a monoclonal antibody directed against B. henselae. The fatty-acid composition of the cell wall was comparable to that previously reported for bartonella species.18 Insufficient material was available for phenotypic characterization of the second and third isolates. For all three isolates, PCR–RFLP analysis of the citrate synthase amplicons resulted in profiles identical to those reported for B. quintana. 10 For each isolate, a total of 1300 nucleotide positions of the 16S rRNA gene were determined, representing 92 percent of the gene in B. quintana. In this overlapping region of 1300 nucleotides in the sequences for B. henselae, B. quintana, and the three clinical isolates, no difference was found between B. quintana and the three isolates at the 16 positions that differentiate B. quintana from B. henselae. However, one discrepancy was noted between the sequence in the Fuller strain of B. quintana from GenBank and the sequences in the three isolates and our Fuller and Oklahoma strains: a thymidine residue at position 1150 (Escherichia coli standard numbering system) appeared as a guanosine residue in the GenBank sequence.
Detection of B. quintana in Tissue
Immunofluorescence and immunohistochemical techniques demonstrated the presence of B. quintana in the cardiac valves from the three patients (Figure 1Figure 1
Immunofluorescence Staining of B. quintana in a Cardiac Valve from Patient 1 (×2000).) and in the cervical lymph node from Patient 1. The first isolate was also demonstrated by Gram's staining of the valve. Immunohistochemical techniques gave the best results. Also, PCR amplification of a portion of the citrate synthase gene was positive in the cardiac valves and in the lymph node.Serologic Studies
Five serum samples from Patient 1, four from Patient 2, and five from Patient 3 were tested for IgG, IgA, and IgM antibodies. All the samples had IgG titers >1:400 against agar-grown B. quintana antigen and IgG titers >1:1600 against endothelial-cell–grown antigen, with almost no detectable IgM or IgA (Table 2). Only one sample had anti–B. henselae antibody, but all the samples had IgG titers >1:256 against C. pneumoniae and IgG titers <1:64 against C. psittaci and C. trachomatis. Adsorption of the serum samples with C. pneumoniae antigen did not alter the antibody titer against B. quintana, whereas adsorption with agar-grown B. quintana antigen eliminated antibody against C. pneumoniae. When analyzed by Western immunoblotting, the samples from the three patients had a slight reaction against B. quintana crude antigen, whereas they exhibited numerous bands against boiled B. quintana antigen (Figure 2Figure 2
Western Blot Immunoassay of Serum Samples from Three Patients with B. quintana Endocarditis.). There was a cross-reaction with C. pneumoniae, which decreased after adsorption of the serum with B. quintana antigen, with the persistence of one band (Figure 3Figure 3
Western Blot Immunoassay with the Fourth Serum Sample from Patient 1.). Proteinase K digestion of the antigens suppressed their reactivity.Discussion
We report endocarditis due to B. quintana in three men who were not infected with HIV. All three were about 40 years old, had histories of chronic alcoholism and smoking, and were homeless.
Three isolates of B. quintana were identified on the basis of their antigenicity, RFLP analysis of the citrate synthase gene, the 16S rRNA gene sequence,19 and the cell-wall fatty-acid composition in one isolate. The sequence of the 16S rRNA gene was determined with the use of rapid DNA preparation and solid-phase, automatic DNA sequencing. Solid-phase, manual sequencing has previously been used to identify B. elizabethae. 18 Analysis of the 16S rRNA sequence allowed us to identify the three isolates as B. quintana, although a discrepancy in one base was noted between our sequence and that of GenBank. Also, differences in isolation were noted: whereas one strain was isolated in the blood-agar culture, the other two were isolated only in cell culture and could not be subcultured on other mediums. Such differences in the ease of isolation have previously been noted for B. quintana. 3 Isolation from the cardiac valves was unsuccessful, despite immunologic and molecular detection of B. quintana in these specimens, but there had been antibiotic treatment before excision of the valves.20
Knowledge of the clinical spectrum of human pathogens belonging to the bacterial genus bartonella (previously known as rochalimaea) has expanded dramatically over the past three years. Earlier, B. quintana, the agent of trench fever,21 and B. vinsonii were the only known members of the genus, and the latter was not associated with disease in humans.22 A third species, B. henselae, was subsequently identified in immunocompetent and immunocompromised patients, including HIV-infected patients with bacillary angiomatosis, visceral bacillary peliosis, relapsing fever with bacteremia, encephalitis, and endocarditis.2,10,23 More recently, B. elizabethae was isolated from an immunocompetent patient with endocarditis.18 A reclassification of these four species in the genus bartonella was proposed on the basis of their phenotypic and genotypic characteristics.24
The body louse, Pediculus humanus, has been recognized as the vector of B. quintana causing trench fever. Although the American HIV-infected patients with B. quintana infection reported no contact with animals or arthropods, one of them had been treated for scabies eight months before the isolation of B. quintana, 3 suggesting poor hygienic conditions. We isolated B. quintana, Toulouse strain, from a homeless patient with the acquired immunodeficiency syndrome and cutaneous bacillary angiomatosis.6 This suggests that ectoparasites, which are frequently associated with poor hygienic conditions, may be the vector of B. quintana. However, we also isolated two strains from patients who were not homeless.7
Several serologic methods have been proposed for the diagnosis of trench fever,25-27 and serotyping of bartonella species in mice has been reported.28 The serologic studies in our three patients were highly suggestive of infection due to B. quintana. Of 12,355 serum specimens tested in our laboratory for the presence of B. quintana antibodies over the past 17 months, 70 (0.57 percent) had IgG titers >1:100, and 31 serum samples (0.25 percent) from 11 patients, including those described here, had IgG titers >1:400. Thus, with the use of immunofluorescence and blood-agar–grown antigen, a cutoff value of 1:100 for the IgG titer allows detection of B. quintana infection. All tested samples had higher IgG titers when tested against endothelial-cell–grown antigen, which may be related to the endothelial-cell–associated expression of one or several antigens by B. quintana.
Our patients had substantial titers of IgG antibodies against C. pneumoniae, which may have been related either to dual infection with chlamydia species and B. quintana or to a serologic cross-reactivity between chlamydia species and B. quintana. To the best of our knowledge, there was no common source of exposure to chlamydia species and B. quintana, and there was no evidence of chlamydial infection in these patients, apart from the antibody titers. Therefore, the most likely explanation for the high titers of IgG antibodies against C. pneumoniae is cross-reactivity between B. quintana and chlamydia species. After adsorption of the serum samples by B. quintana antigen, the antibodies against C. pneumoniae disappeared, confirming a cross-reaction. A similar cross-reaction reported between B. bacilliformis and C. psittaci was attributed to a lipopolysaccharide epitope.29
This cross-reactivity may be confusing, since both chlamydia and bartonella species are implicated in infective endocarditis.30,31 Serologic studies can support a presumptive diagnosis of endocarditis caused by bartonella or chlamydia species, but a definitive diagnosis requires demonstration of the microorganism in blood or a cardiac valve. We reviewed a series of 10 cases of endocarditis associated with chlamydia species.31 Serum samples from nine of these patients were tested for B. quintana, and all had high level of antibodies.
The studies in the three patients described here add to the evidence that bartonella species, including B. quintana, B. henselae, and B. elizabethae, are etiologic agents of endocarditis. These organisms should be included in the differential diagnosis of culture-negative endocarditis.
Supported by a grant from the French Ministry of Health.
We are indebted to H. Tissot Dupont and J. Gouvernet for performing the sequence analysis and to T.J. Marrie for reviewing the manuscript.
Source Information
From the Unité des Rickettsies, Faculté de Médecine, Marseilles (M.D., A.C., D.R.); Laboratoire de Microbiologie Médicale (J.L.M., F.G., J.A.) and Service de Cardiologie (F.L.), Hôpital Saint-Joseph, Paris; Service des Maladies Tropicales et Infectieuses, Hôpital Félix Houphouet-Boigny, Marseilles (P.B.); and Laboratoire de Bactériologie, Hôpital Louis Pradel, Lyons (F.V., J.E.) — all in France.
Address reprint requests to Dr. Raoult at Unité des Rickettsies, Faculté de Médecine, Blvd. Jean Moulin, 13385 Marseilles CEDEX 5, France.
- References
References
1
Vinson JW . In vitro cultivation of the rickettsial agent of trench fever. Bull World Health Organ 1966;35:155-164
Web of Science | Medline2
Welch DF ,Pickett DA ,Slater LN ,Steigerwalt AG ,Brenner DJ . Rochalimaea henselae sp. nov., a cause of septicemia, bacillary angiomatosis, and parenchymal bacillary peliosis. J Clin Microbiol 1992;30:275-280
Web of Science | Medline3
Koehler JE ,Quinn FD ,Berger TG ,LeBoit PE ,Tappero JW . Isolation of rochalimaea species from cutaneous and osseous lesions of bacillary angiomatosis. N Engl J Med 1992;327:1625-1631
Full Text | Web of Science | Medline4
Spach DH ,Callis KP ,Paauw DS , et al. Endocarditis caused by Rochalimaea quintana in a patient infected with human immunodeficiency virus. J Clin Microbiol 1993;31:692-694
Web of Science | Medline5
Larson AM ,Dougherty MJ ,Nowowiejski DJ , et al. Detection of Bartonella (Rochalimaea) quintana by routine acridine orange staining of broth blood cultures. J Clin Microbiol 1994;32:1492-1496
Web of Science | Medline6
Maurin M ,Roux V ,Stein A ,Ferrier F ,Viraben R ,Raoult D . Isolation and characterization by immunofluorescence, sodium dodecyl sulfate-polyacrylamide gel electrophoresis, Western blot, restriction fragment length polymorphism-PCR, 16S rRNA gene sequencing, and pulsed-field gel electrophoresis of Rochalimaea quintana from a patient with bacillary angiomatosis. J Clin Microbiol 1994;32:1166-1171
Web of Science | Medline7
Raoult D ,Drancourt M ,Carta A ,Gastaut JA . Bartonella (Rochalimaea) quintana isolation in patient with chronic adenopathy, lymphopenia, and a cat. Lancet 1994;343:977-977
CrossRef | Web of Science | Medline8
Takahashi K ,Sawasaki Y ,Hata JI ,Mukai K ,Goto T . Spontaneous transformation and immortalization of human endothelial cells. In Vitro Cell Dev Biol 1990;26:265-274
CrossRef | Web of Science | Medline9
Miller L, Berger T. Bacterial identification by gas chromatography of whole cell fatty acids. Avondale, Pa.: Hewlett–Packard, 1985. (Hewlett–Packard application note 228-41.)
10
Regnery RL ,Anderson BE ,Clarridge JE III ,Rodriguez-Barradas MC ,Jones DC ,Carr JH . Characterization of a novel Rochalimaea species, R. henselae sp. nov., isolated from blood of a febrile, human immunodeficiency virus-positive patient. J Clin Microbiol 1992;30:265-274
Web of Science | Medline11
Hultman T ,Stahl S ,Hornes E ,Uhlen M . Direct solid phase sequencing of genomic and plasmid DNA using magnetic beads as solid support. Nucleic Acids Res 1989;17:4937-4946
CrossRef | Web of Science | Medline12
Stein A ,Raoult D . A simple method for amplification of DNA from paraffin-embedded tissues. Nucleic Acids Res 1992;20:5237-5238
CrossRef | Web of Science | Medline13
Weisburg WG ,Barns SM ,Pelletier DA ,Lane DJ . 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol 1991;173:697-703
Web of Science | Medline14
Dessen P ,Fondrat C ,Valencien C ,Mugnier C . BISANCE: a French service for access to biomolecular sequence databases. Comput Appl Biosci 1990;6:355-356
Medline15
Higgins DG ,Sharp PM . CLUSTAL: a package for performing multiple sequence alignment on a microcomputer. Gene 1988;73:237-244
CrossRef | Web of Science | Medline16
Gimenez DF . Staining rickettsiae in yolk-sac cultures. Stain Technol 1964;39:135-140
Web of Science | Medline17
Dumler JS ,Brouqui P ,Aronson J ,Taylor JP ,Walker DH . Identification of ehrlichia in human tissue. N Engl J Med 1991;325:1109-1110
Full Text | Web of Science | Medline18
Daly JS ,Worthington MG ,Brenner DJ , et al. Rochalimaea elizabethae sp. nov. isolated from a patient with endocarditis. J Clin Microbiol 1993;31:872-881
Web of Science | Medline19
Relman DA ,Loutit JS ,Schmidt TM ,Falkow S ,Tompkins LS . The agent of bacillary angiomatosis -- an approach to the identification of uncultured pathogens. N Engl J Med 1990;323:1573-1580
Full Text | Web of Science | Medline20
Maurin M ,Raoult D . Antimicrobial susceptibility of Rochalimaea quintana, Rochalimaea vinsonii, and the newly recognized Rochalimaea henselae. J Antimicrob Chemother 1993;32:587-594
CrossRef | Web of Science | Medline21
Swift HF . Trench fever. Arch Intern Med 1920;26:76-98
Web of Science22
Baker JA . A rickettsial infection in Canadian voles. J Exp Med 1946;84:37-50
CrossRef | Web of Science | Medline23
Hadfield TL ,Warren R ,Kass M ,Brun E ,Levy C . Endocarditis caused by Rochalimaea henselae. Hum Pathol 1993;24:1140-1141
CrossRef | Web of Science | Medline24
Brenner DJ ,O'Connor SP ,Winkler HH ,Steigerwalt AG . Proposals to unify the genera Bartonella and Rochalimaea, with descriptions of Bartonella quintana comb. nov., Bartonella vinsonii comb. nov., Bartonella henselae comb. nov., and Bartonella elizabethae comb. nov., and to remove the family Bartonellaceae from the order Rickettsiales. Int J Syst Bacteriol 1993;43:777-786
CrossRef | Medline25
Kostrzewski J . The epidemiology of trench fever. Med Dosw Mikrobiol 1950;11:233-26326
Myers WF, Wisseman CL Jr. Serologic studies of trench fever employing a microagglutination procedure. In: Proceedings of the International Symposium on the Control of Lice and Louse-borne Diseases. Washington, D.C.: Pan American Health Organization, 1973:79-81. (Scientific publication no. 263.)
27
Hollingdale MR ,Herrmann JE ,Vinson JW . Enzyme immunoassay of antibody to Rochalimaea quintana: diagnosis of trench fever and serologic cross-reactions among other rickettsiae. J Infect Dis 1978;137:578-582
CrossRef | Web of Science | Medline28
Slater LN ,Coody DW ,Woolridge LK ,Welch DF . Murine antibody responses distinguish Rochalimaea henselae from Rochalimaea quintana. J Clin Microbiol 1992;30:1722-1727
Web of Science | Medline29
Knobloch J ,Bialek R ,Muller G ,Asmus P . Common surface epitope of Bartonella bacilliformis and Chlamydia psittaci. Am J Trop Med Hyg 1988;39:427-433
Web of Science | Medline30
Shapiro DS ,Kenney SC ,Johnson M ,Davis CH ,Knight ST ,Wyrick PB . Chlamydia psittaci endocarditis diagnosed by blood culture. N Engl J Med 1992;326:1192-1195
Full Text | Web of Science | Medline31
Etienne J ,Ory D ,Thouvenot D , et al. Chlamydial endocarditis: a report on ten cases. Eur Heart J 1992;13:1422-1426
Web of Science | Medline
- Citing Articles (81)
Citing Articles
1
Mosepele Mosepele, Dana Mazo, Jennifer Cohn. (2012) Bartonella Infection in Immunocompromised Hosts: Immunology of Vascular Infection and Vasoproliferation. Clinical and Developmental Immunology 2012, 1-5
CrossRef2
Oto Melter, Mardjan Arvand, Jiří Votýpka, Dagmar Hulínská. (2012) Bartonella quintana Transmission from Mite to Family with High Socioeconomic Status. Emerging Infectious Diseases 10:1, 163-165
CrossRef3
Ricardo G. Maggi, Patricia E. Mascarelli, Elizabeth L. Pultorak, Barbara C. Hegarty, Julie M. Bradley, B. Robert Mozayeni, Edward B. Breitschwerdt. (2011) Bartonella spp. bacteremia in high-risk immunocompetent patients. Diagnostic Microbiology and Infectious Disease 71:4, 430-437
CrossRef4
F. K. Gould, D. W. Denning, T. S. J. Elliott, J. Foweraker, J. D. Perry, B. D. Prendergast, J. A. T. Sandoe, M. J. Spry, R. W. Watkin. (2011) Guidelines for the diagnosis and antibiotic treatment of endocarditis in adults: a report of the Working Party of the British Society for Antimicrobial Chemotherapy. Journal of Antimicrobial Chemotherapy
CrossRef5
J.-C. Desenclos, A. Laporte, P. Brouqui. (2011) Les infections humaines transmises par les poux. Médecine et Maladies Infectieuses 41:6, 295-300
CrossRef6
Philippe Brouqui. (2011) Arthropod-Borne Diseases Associated with Political and Social Disorder. Annual Review of Entomology 56:1, 357-374
CrossRef7
Silpak Biswas, Jean-Marc Rolain. (2010) Bartonella infection: treatment and drug resistance. Future Microbiology 5:11, 1719-1731
CrossRef8
Anna Sander. 2010. Bartonella and Afipia. .
CrossRef9
Ciro Maguiña, Humberto Guerra, Palmira Ventosilla. (2009) Bartonellosis. Clinics in Dermatology 27:3, 271-280
CrossRef10
F. Gouriet, L. Samson, M. Delaage, J.-L. Mainardi, S. Meconi, M. Drancourt, D. Raoult. (2008) Multiplexed whole bacterial antigen microarray, a new format for the automation of serodiagnosis: the culture-negative endocarditis paradigm. Clinical Microbiology and Infection 14:12, 1112-1118
CrossRef11
Sue Lang. (2008) Getting to the heart of the problem: serological and molecular techniques in the diagnosis of infective endocarditis. Future Microbiology 3:3, 341-349
CrossRef12
Jane E. Koehler. 2008. Bartonella Infections in HIV-infected Individuals. , 425-436.
CrossRef13
Tera L. McCool, John G. Hoey, Francesca Montileone, Hannah B. Goldenberg, Eli Mordechai, Martin E. Adelson. (2008) Discovery and analysis of Bartonella henselae antigens for use in clinical serologic assays. Diagnostic Microbiology and Infectious Disease 60:1, 17-23
CrossRef14
Nils-Gunnar Ilbäck, Göran Friman. (2007) Interactions Among Infections, Nutrients and Xenobiotics. Critical Reviews in Food Science and Nutrition 47:5, 499-519
CrossRef15
(2007) German guidelines for the diagnosis and management of infective endocarditis. International Journal of Antimicrobial Agents 29:6, 643-657
CrossRef16
Linda Houhamdi, Didier Raoult. 2007. Louse-Borne Epidemic Typhus. , 51-62.
CrossRef17
Aaron R Kosmin, Bennett Lorber. 2007. Specific Tests in the Diagnosis of Fever of Unknown Origin. , 159-208.
CrossRef18
Cabot, Richard C.Harris, Nancy Lee, Shepard, Jo-Anne O., Rosenberg, Eric S., Cort, Alice M., Ebeling, Sally H.Peters, Christine C., Raoult, Didier, Abbara, Suhny, Jassal, Davinder S., Kradin, Richard L., . (2007) Case 5-2007. New England Journal of Medicine 356:7, 715-725
Full Text19
L. Dehen, O. Chosidow. (2007) Ectoparasitosis. EMC - Dermatolog??a 41:3, 1-16
CrossRef20
Chien Chang Loa, Eli Mordechai, Richard C. Tilton, Martin E. Adelson. (2006) Production of recombinant Bartonella henselae 17-kDa protein for antibody-capture enzyme-linked immunosorbent assay. Diagnostic Microbiology and Infectious Disease 55:1, 1-7
CrossRef21
José Antonio Oteo, Alberto Castilla, Ángel Arosey, José Ramón Blanco, Valvanera Ibarra, Luis Enrique Morano. (2006) Endocarditis por Bartonella spp. Aportación de tres nuevos casos y revisión de la literatura nacional. Enfermedades Infecciosas y Microbiología Clínica 24:5, 297-301
CrossRef22
Dirk M. Elston. (2005) Life-threatening stings, bites, infestations, and parasitic diseases. Clinics in Dermatology 23:2, 164-170
CrossRef23
Cabot, Richard C.Harris, Nancy Lee, Shepard, Jo-Anne O., Ebeling, Sally H.Ellender, Stacey M.Peters, Christine C., Biddinger, Paul D., Isselbacher, Eric M., Fan, Dali, Shepard, Jo-Anne O., . (2005) Case 5-2005. New England Journal of Medicine 352:7, 709-716
Full Text24
C. K. Naber, Artur Bauhofer, Michael Block, Michael Buerke, Raimund Erbel, Wolfgang Graninger, Mathias Herrmann, Dieter Horstkotte, Peter Kern, Hartmut Lode, Uwe Mehlhorn, J
rgen Meyer, Andreas M
CrossRef25
Philippe Brouqui, Andreas Stein, Herv?? Tissot Dupont, Pierre Gallian, Sekene Badiaga, Jean Marc Rolain, Jean Louis Mege, Bernard La Scola, Philippe Berbis, Didier Raoult. (2005) Ectoparasitism and Vector-Borne Diseases in 930 Homeless People From Marseilles. Medicine 84:1, 61-68
CrossRef26
Svena McGill, Lars Wesslén, Eva Hjelm, Martin Holmberg, Marja Kaisa Auvinen, Karl Berggren, Bodil Grandin-Jarl, Ulf Johnson, Staffan Wikström, Göran Friman. (2005) Bartonella spp. seroprevalence in healthy Swedish blood donors. Scandinavian Journal of Infectious Diseases 37:10, 723-730
CrossRef27
C. K. Naber, , . (2004) S2-Leitlinie zur Diagnostik und Therapie der infekti
CrossRef28
G. Aboudharam, P.-E. Fournier, M. Drancourt, D. Raoult, C. Foucault, P. Brouqui. (2004) Molecular detection of Bartonella quintana DNA in the dental pulp of a homeless patient. European Journal of Clinical Microbiology & Infectious Diseases
CrossRef29
F. Durupt, P. Seve, C. Roure, F. Biron, D. Raoult, C. Broussolle. (2004) Liver and spleen abscesses without endocarditis due to Bartonella quintana in an immunocompetent host. European Journal of Clinical Microbiology & Infectious Diseases 23:10, 790-791
CrossRef30
Maria Werner, Rune Andersson, Lars Olaison, Harriet Hogevik. (2003) A Clinical Study of Culture-Negative Endocarditis. Medicine 82:4, 263-273
CrossRef31
SVENA McGILL, EVA HJELM, JOVAN RAJS, OLLE LINDQUIST, GÖRAN FRIMAN. (2003) Bartonella spp. Antibodies in Forensic Samples from Swedish Heroin Addicts. Annals of the New York Academy of Sciences 990:1, 409-413
CrossRef32
Alexander J. Stratigos, Andreas D. Katsambas. (2003) Medical and Cutaneous Disorders Associated With Homelessness. SKINmed 2:3, 168-174
CrossRef33
SVENA McGILL, JOVAN RAJS, EVA HJELM, OLLE LINDQUIST, GORAN FRIMAN. (2003) A study on forensic samples of Bartonella spp. antibodies in Swedish intravenous heroin addicts. APMIS 111:4, 507-513
CrossRef34
Maria Carla Liberto, Giovanni Matera, Angelo G Lamberti, Giorgio S Barreca, Angela Quirino, Alfredo Focà. (2003) In vitro Bartonella quintana infection modulates the programmed cell death and inflammatory reaction of endothelial cells. Diagnostic Microbiology and Infectious Disease 45:2, 107-115
CrossRef35
C. Foucault, K. Barrau, P. Brouqui, D. Raoult. (2002) Bartonella quintana Bacteremia among Homeless People. Clinical Infectious Diseases 35:6, 684-689
CrossRef36
Hubert Lepidi, David T Durack, Didier Raoult. (2002) Diagnostic methods. Infectious Disease Clinics of North America 16:2, 339-361
CrossRef37
Pierre Houpikian, Didier Raoult. (2002) Diagnostic methods. Infectious Disease Clinics of North America 16:2, 377-392
CrossRef38
K. Bergh, L. Bevanger, I. Hanssen, K. Loseth. (2002) Low prevalence of Bartonella henselae infections in Norwegian domestic and feral cats. APMIS 110:4, 309-314
CrossRef39
K Hercík. (2002) In situ detection of Bartonella henselae cells. Molecular and Cellular Probes 16:1, 49-56
CrossRef40
Mylonakis, Eleftherios, Calderwood, Stephen B., . (2001) Infective Endocarditis in Adults. New England Journal of Medicine 345:18, 1318-1330
Full Text41
Didier Raoult, Cédric Foucault, Philippe Brouqui. (2001) Infections in the homeless. The Lancet Infectious Diseases 1:2, 77-84
CrossRef42
PIERRE-EDOUARD FOURNIER, HERVÉ LELIEVRE, SUSANNAH J. EYKYN, JEAN-LUC MAINARDI, THOMAS J. MARRIE, FABRICE BRUNEEL, CHANTAL ROURE, JAMES NASH, DANIÈLE CLAVE, EDWARD JAMES, CATHERINE BENOIT-LEMERCIER, LIONEL DEFORGES, HERVÉ TISSOT-DUPONT, DIDIER RAOULT. (2001) Epidemiologic and Clinical Characteristics of Bartonella quintana and Bartonella henselae Endocarditis. Medicine 80:4, 245-251
CrossRef43
P Abgueguen, J.M Chennebault, J Achard, J Cottin, E Pichard. (2001) Maladie des griffes du chat. Étude clinique de 26 patients. Intérêt et place de la PCR. La Revue de Médecine Interne 22:6, 522-529
CrossRef44
James A. Comer, Christopher D. Paddock, James E. Childs. (2001) Urban Zoonoses Caused by Bartonella , Coxiella , Ehrlichia , and Rickettsia Species. Vector-Borne and Zoonotic Diseases 1:2, 91-118
CrossRef45
Joseph A Witkowski, Lawrence Charles Parish. (2001) Reflections on dermatology and projections for the 21st Century. Clinics in Dermatology 19:1, 31-34
CrossRef46
Hubert Lepidi, MD, PhD, Didier Raoult, MD, PhD, Pierre-Edouard Fournier, MD, PhD. (2000) Quantitative Analysis of Valvular Lesions During Bartonella Endocarditis. American Journal of Clinical Pathology 114:6, 880-889
CrossRef47
M.Y Kosoy, E.K Saito, D Green, E.L Marston, D.C Jones, J.E Childs. (2000) Experimental evidence of host specificity of Bartonella infection in rodents. Comparative Immunology, Microbiology and Infectious Diseases 23:4, 221-238
CrossRef48
Kevin L Karem, Christopher D Paddock, Russell L Regnery. (2000) Bartonella henselae, B. quintana, and B. bacilliformis: historical pathogens of emerging significance. Microbes and Infection 2:10, 1193-1205
CrossRef49
Hiroko Bessho. (2000) Detection of Chlamydia species-specific serum antibodies by prior adsorption of common genus-specific antibodies. FEMS Immunology & Medical Microbiology 28:4, 269-272
CrossRef50
M. E. Ohl, D. H. Spach. (2000) Bartonella quintana and Urban Trench Fever. Clinical Infectious Diseases 31:1, 131-135
CrossRef51
J. V. Graham, L. Baden, S. Tsiodras, A. W. Karchmer. (2000) Q Fever Endocarditis Associated with Extensive Serological Cross-Reactivity. Clinical Infectious Diseases 30:3, 609-610
CrossRef52
Ciro Maguiña, Eduardo Gotuzzo. (2000) BARTONELLOSIS. Infectious Disease Clinics of North America 14:1, 1-22
CrossRef53
Olivier Chosidow. (2000) Scabies and pediculosis. The Lancet 355:9206, 818
CrossRef54
Pierre-Edouard Fournier, Didier Raoult. (1999) Nonculture laboratory methods for the diagnosis of infectious endocarditis. Current Infectious Disease Reports 1:2, 136-141
CrossRef55
ERIK LARSSON, LARS WESSLÉN, OLLE LINDQUIST, ULRIK BAANDRUR, LARS ERIKSSON, ECKHARDT OLSEN, CHRISTER ROLF, GÖRAN FRIMAN. (1999) Sudden unexpected cardiac deaths among young Swedish orienteers - Morphological changes in hearts and other organs. APMIS 107:1-6, 325-336
CrossRef56
Cabot, Richard C.Scully, Robert E., Mark, Eugene J., McNeely, William F., Ebeling, Sally H., Skolnik, Paul R.Mark, Eugene J.. (1999) Case 5-1999. New England Journal of Medicine 340:7, 545-554
Full Text57
Brouqui, Philippe, Lascola, Bernard, Roux, Veronique, Raoult, Didier, . (1999) Chronic Bartonella quintana Bacteremia in Homeless Patients. New England Journal of Medicine 340:3, 184-189
Full Text58
Sophie Gasquet, Max Maurin, Philippe Brouqui, Hubert Lepidi, Didier Raoult. (1998) Bacillary angiomatosis in immunocompromised patients. AIDS 12:14, 1793-1803
CrossRef59
David H. Spach, Jane E. Koehler. (1998) BARTONELLA-ASSOCIATED INFECTIONS. Infectious Disease Clinics of North America 12:1, 137-155
CrossRef60
A. M. C. Bergmans, J. L. Coenen, R. Bakhuizen, B. W. Mooi, A. R. Ramdat Misier, B. Wilbrink, L. M. Schouls, M. J. H. M. Wolfhagen. (1997) Endocarditis in a Dutch patient caused by Bartonella quintana. Clinical Microbiology and Infection 3:6, 692-694
CrossRef61
Bruce A. Stewart. (1997) Human infection with Bartonella species. Clinical Microbiology and Infection 3:6, 677-689
CrossRef62
Stefano R Tarantolo, James D Landmark, Peter C Iwen, Anne Kessinger, Wing C Chan, Steven H Hinrichs. (1997) Bartonella-like erythrocyte inclusions in thrombotic thrombocytopenic purpura. The Lancet 350:9091, 1602
CrossRef63
R. Zbinden, N. Michael, M. Sekulovski, A. Graevenitz, D. Nadal. (1997) Evaluation of commercial slides for detection of immunoglobulin G againstBartonella henselae by indirect immunofluorescence. European Journal of Clinical Microbiology & Infectious Diseases 16:9, 648-652
CrossRef64
C.Lars Mouritsen, Christine M Litwin, Russell L Maiese, Suzanne M Segal, Glenn H Segal. (1997) Rapid polymerase chain reaction-based detection of the causative agent of cat scratch disease (Bartonella henselae) in formalin-fixed, paraffin-embedded samples. Human Pathology 28:7, 820-826
CrossRef65
M. Maurin, R. Birtles, D. Raoult. (1997) Current knowledge ofBartonella species. European Journal of Clinical Microbiology & Infectious Diseases 16:7, 487-506
CrossRef66
Jukka Juvonen, Aino Laurila, Tatu Juvonen, Hannu Alakärppä, Heljä-Marja Surcel, Kari Lounatmaa, Johanna Kuusisto, Pekka Saikku. (1997) Detection of Chlamydia pneumoniae in Human Nonrheumatic Stenotic Aortic Valves. Journal of the American College of Cardiology 29:5, 1054-1059
CrossRef67
Cabot, Richard C.Scully, Robert E., Mark, Eugene J., McNeely, William F., Ebeling, Sally H., Jacoby, George A.Hay, C. Mhorag. (1997) Case 2-1997. New England Journal of Medicine 336:3, 205-210
Full Text68
Christina Nyström-Rosander, Stefan Thelin, Eva Hjelm, Olle Lindquist, Carl Påhlson, Göran Friman. (1997) High Incidence of Chlamydia pneumoniae in Sclerotic Heart Valves of Patients Undergoing Aortic Valve Replacement. Scandinavian Journal of Infectious Diseases 29:4, 361-365
CrossRef69
JAMES W. BASS, JUDY M. VINCENT, DONALD A. PERSON. (1997) The expanding spectrum of Bartonella infections: I. Bartonellosis and trench fever. The Pediatric Infectious Disease Journal 16:1, 2-10
CrossRef70
Robert C. Jerris, Russell L. Regnery. (1996) WILL THE REAL AGENT OF CAT-SCRATCH DISEASE PLEASE STAND UP? 1. Annual Review of Microbiology 50:1, 707-725
CrossRef71
H. -U. Schmidt, T. Kaliebe, J. Poppinger, C. Bühler, A. Sander. (1996) Isolation ofBartonella quintana from an HIV-positive patient with bacillary angiomatosis. European Journal of Clinical Microbiology & Infectious Diseases 15:9, 736-741
CrossRef72
Gad Baneth, Dorsey L. Kordick, Barbara C. Hegarty, Edward B. Breitschwerdt. (1996) Comparative seroreactivity to Bartonella henselae and Bartonella quintana among cats from Israel and North Carolina. Veterinary Microbiology 50:1-2, 95-103
CrossRef73
Stephen J. Gluckman. (1996) Q fever and trench fever. Clinics in Dermatology 14:3, 283-287
CrossRef74
Jean-Luc Mainardi. (1996) Endocarditis with negative blood cultures. Clinical Microbiology and Infection 1:3, 151-152
CrossRef75
P. Colson, L. Lebrun, M. Drancourt, F. Boué, D. Raoult, P. Nordmann. (1996) Multiple recurrent bacillary angiomatosis due toBartonella quintana in an HIV-infected patient. European Journal of Clinical Microbiology & Infectious Diseases 15:2, 178-180
CrossRef76
W. Schwartzman, M.D. (1996) BARTONELLA ( ROCHALIMAEA ) INFECTIONS: Beyond Cat Scratch 1. Annual Review of Medicine 47:1, 355-364
CrossRef77
P Brouqui, D Raoult. (1996) Bartonella quintana invades and multiplies within endothelial cells in vitro and in vivo and forms intracellular blebs. Research in Microbiology 147:9, 719-731
CrossRef78
Michel Dupon, Anne-marie Savin De Larclause, Philippe Brouqui, Michel Drancourt, Didier Raoult, Antoine De Mascarel, Jean-Yves Lacut. (1996) Evaluation of Serological Response to Bartonella henselae, Bartonella quintana and Afipia felis Antigens in 64 Patients with Suspected Cat-scratch Disease. Scandinavian Journal of Infectious Diseases 28:4, 361-366
CrossRef79
Jane E. Koehler, Laurie Cederberg. (1995) Intra-abdominal mass associated with gastrointestinal hemorrhage: A new manifestation of bacillary angiomatosis. Gastroenterology 109:6, 2011-2014
CrossRef80
Thomas J. Marrie. (1995) Endocarditis of Uncertain Etiology. Zentralblatt für Bakteriologie 283:1, 1-4
CrossRef81
Relman, David A., . (1995) Has Trench Fever Returned?. New England Journal of Medicine 332:7, 463-464
Full Text
