Original Article
Concordance for Hodgkin's Disease in Identical Twins Suggesting Genetic Susceptibility to the Young-Adult Form of the Disease
N Engl J Med 1995; 332:413-419February 16, 1995
- Abstract
Background
Relatives of young adults with Hodgkin's disease are at increased risk of Hodgkin's disease, and lines of evidence implicate both inheritance and environment.
Methods
We have identified and followed 432 sets of twins affected by Hodgkin's disease. The number of cases of Hodgkin's disease observed before the age of 50 years in the healthy monozygotic and dizygotic twins of the patients with Hodgkin's disease was compared with the number expected from national age-specific incidence rates.
Results
None of the 187 pairs of dizygotic twins became concordant for Hodgkin's disease, whereas 10 of the 179 pairs of monozygotic twins did; in 5 of these pairs, the second case appeared after the original ascertainment. During the observation period, 0.1 (monozygotic) and 0.1 (dizygotic) cases in the unaffected twins were expected. Monozygotic twins of patients with Hodgkin's disease thus had a greatly increased risk (standardized incidence ratio, 99; 95 percent confidence interval, 48 to 182), whereas no increase in the risk for dizygotic twins of patients with Hodgkin's disease was observed.
Conclusions
Genetic susceptibility underlies Hodgkin's disease in young adulthood.
Media in This Article
Table 1
Occurrence of Hodgkin's Disease and Other Malignant Neoplasms in the Twins of Patients with Hodgkin's Disease or Non-Hodgkin's Lymphoma.Table 2
Characteristics of 10 Pairs of Monozygotic Twins Concordant for Hodgkin's Disease.Article Activity
- Article
Hodgkin's disease is likely to have different causes in young adulthood and old age.1 The characteristic clinical presentation and histopathological appearance suggest that in young adults the disease is initiated by an environmental exposure, possibly to an infectious agent. The age-specific incidence during young adulthood varies over time and according to place and social class, much like that of infections. Those affected have a small average number of siblings, may not have had the common childhood infections, and are likely to have a history of infectious mononucleosis.2 These findings have been interpreted to suggest that Hodgkin's disease may occur as a sequela of late infection by a childhood virus, in much the same way that paralytic poliomyelitis does.3 Although the particular virus cannot be specified, Epstein–Barr virus (EBV) has received special attention because of the link with mononucleosis,4 the elevated anti-EBV antibody titers that have been shown to precede the onset of the neoplasm,5 and the presence of EBV in Reed–Sternberg cells.6,7
However, Hodgkin's disease occurs preferentially in certain families,8,9 and heredity may also have a role. Pairs of twins concordant for the disease have been described,10 and increases in the risk of Hodgkin's disease in the families of these twins ranging from threefold (first-degree relatives) to sevenfold (siblings) have been reported.11,12 Links between Hodgkin's disease and HLA-A1, B5, B8, and B1813 have been invoked to explain the elevated risk.14 A comparison of the levels of concordance in pairs of monozygotic and dizygotic twins raised together permits an evaluation of the role of heredity. In a general search for twins with chronic disease, we have identified nearly 1000 in whom a lymphoma has been diagnosed; nearly half of these had Hodgkin's disease. The subsequent experience of their healthy twins provides the basis for this report.
Methods
Ascertainment and Validation
Between 1980 and 1992, weekly advertisements requesting that “twins with cancer” contact one of us by telephone or mail were placed in large newspapers and magazines across the United States and Canada. Each respondent, almost always a twin or the spouse or first-degree relative of a twin, was briefly interviewed by telephone and asked to provide information about the affected pair's birth date, sex, and perceived zygosity; the date and place of any diagnosis of chronic disease; and the date and place of death if either or both twins had died. After receiving permission from the patients or their families, we routinely sought the patients' medical records and coded their diagnoses according to the International Classification of Diseases for Oncology. 15 For all patients with lymphoma and for pairs of twins concordant for any type of cancer, histopathological slides were reviewed to ensure the accuracy of the diagnoses. Each pair of twins has been followed by means of questionnaires mailed approximately every 18 months since the diagnosis was confirmed. For the purposes of this report, follow-up was presumed to end at the time of the diagnosis of Hodgkin's disease in the twin of the proband, death, or last contact; the last contact occurred in 1990 or later in 87 percent of the monozygotic twins and 84 percent of the dizygotic twins.
Zygosity
Ordinary perceptions of zygosity by adult twins are now usually unambiguous and consistent; such perceptions have repeatedly been found to be over 90 percent accurate,16 although occasionally young monozygotic twins are erroneously believed to be dizygotic on the basis of reported placentation. We have previously used molecular methods to assess the accuracy of self-assessed zygosity in more than 40 pairs of adult twins with chronic disease17,18; all laboratory findings to date have been in agreement with the self-reports.
Assessment of Pairs Concordant for Hodgkin's Disease
Special efforts were made to assess each pair of twins reported to be concordant for Hodgkin's disease. By contacting one or both twins directly, we reaffirmed the diagnosis and the zygosity and collected additional information about the medical history of the twins and their families. Every effort was made to obtain the pathology report and diagnostic slides in each case. We reviewed these slides blindly, classified them according to a modified Lukes–Butler system,19 and resolved all differences between reviewers while maintaining the blinding. When adequate samples were available, the phenotype of Reed–Sternberg cells and background lymphocytes was determined with standard immunoperoxidase techniques.20 Specimens from the pairs of twins concordant for disease were evaluated for evidence of EBV with the polymerase chain reaction to detect viral DNA sequences (with primers SL1 5'GGACCTCAAAGAAGAGGGGG and SL3 GCTCCTGGTCTTCCGCCTCC and a probe specific for EBV nuclear antigen 1, SL2 GGACGAGGACGGGGAAGAGG), or by a method that is at least as sensitive, in situ hybridization (with a 30-base sequence, 5'AGACACCGTCCTCACCACCCGGGACTTGTA3', complementary to a portion of the EBER-1 gene that is actively transcribed in latently infected cells).7 In some cases both methods were used. To ensure that all EBV-negative specimens were suitable for use with the polymerase chain reaction, control genomic sequences were amplified.7 Specimens that were EBV-negative on the basis of in situ hybridization were hybridized with a poly-d(T) probe to verify the presence of adequate RNA.7
Quantification of Concordance
Pairwise concordance is used to measure the proportion of pairs who are concordant, whereas casewise concordance more usefully measures the probability, given a diagnosis in one twin, that the other twin will be affected.21,22 The interpretation of either measure rests on the assumption that the cumulative incidence has been accurately measured or, when groups are compared on the basis of zygosity, that the age distributions and the environmental exposures of the groups are similar.23
Part of the familial risk of Hodgkin's disease involves environmental factors rather than hereditary factors, and both the risk of Hodgkin's disease and the probability of ascertainment are age-dependent. For these reasons, we elected to assess the risk of Hodgkin's disease in groups of monozygotic and dizygotic twins simply by comparing the observed number of secondary cases with the number expected — the standardized incidence ratio. This approach also permits a distinction to be made between all cases and cases that were prospectively ascertained. Accordingly, the number of person-years at risk between the date of initial diagnosis or (when prospectively ascertained cases were analyzed) the date on which the diagnosis was ascertained and the date of last follow-up was analyzed in five-year age increments according to zygosity and sex. With the use of data from the Surveillance, Epidemiology, and End Results study (1985 to 1987)24 on U.S. national incidence rates according to age and sex, the number of cases expected to occur in the healthy twins of each zygosity group was estimated. When calculated in this manner, the standardized incidence ratio for dizygotic twins should provide a maximal estimate of the familial risk for a non-twin sibling (genetic plus nongenetic risk factors). For practical purposes, the sole difference in risk between a monozygotic and a dizygotic twin results from the effect of sharing the whole genome of the twin with Hodgkin's disease rather than just half of it.
In addition, we estimated the number of pairs of monozygotic twins expected by chance to be concordant for each histologic subtype of Hodgkin's disease and compared it with the observed number, using as a basis for estimation the distribution of disease subtypes among all affected monozygotic twins in the general population.
Results
More than 13,000 twins with cancer, among them 955 with lymphoma, were identified between 1980 and 1992. The first case of Hodgkin's disease in each of 432 sets of twins had been diagnosed from 1936 to 1993 (median year of diagnosis, 1978; 78 percent of cases were diagnosed from 1970 to 1989). At the time of diagnosis the patients ranged in age from 2 to 82 years (median age, 26 years; 87 percent were 13 to 50 years of age). Eighty-five percent of the patients signed consent forms authorizing the release of their medical records, and records, all confirmatory, were received for 77 percent. We requested permission to review the diagnostic slides for 70 percent of the confirmed cases and received interpretable slides for 76 percent of them. Including the concordant cases, the slides for 159 patients were reviewed; there was frank disagreement about the diagnosis of Hodgkin's disease in 2 patients, who were excluded; disagreements about the histologic subtype were almost entirely confined to cases with the “cellular phase” of nodular sclerosis.25
Interpretable histopathological slides were also obtained for 230 twins with non-Hodgkin's lymphoma; 227 of these cases were confirmed, and in no instance did the diagnostic alternatives include Hodgkin's disease.
The risk of Hodgkin's disease in the twins of patients with Hodgkin's disease was evaluated among those who were alive, of known zygosity, and younger than 50 years of age at the time the disease was diagnosed in the affected twin. One hundred seventy-nine monozygotic and 187 dizygotic unaffected twins were observed for an average of 14.1 and 14.3 years, respectively, after the diagnosis in the affected twins. On the basis of national age-specific incidence rates, 0.10 case would have been expected to occur by chance during that period in each zygosity group (Table 1Table 1
Occurrence of Hodgkin's Disease and Other Malignant Neoplasms in the Twins of Patients with Hodgkin's Disease or Non-Hodgkin's Lymphoma.); half would have been expected within seven years of the original diagnosis. In fact, 10 cases were reported among the monozygotic twins (7 male and 3 female), giving a pairwise concordance of 5.6 percent, a casewise concordance of 0.106, and a standardized incidence ratio of 99 (95 percent confidence interval, 48 to 182) — 115 for male twins and 83 for female twins. All but 1 of the 10 cases were reported directly by the twins or their parents. The analysis was then repeated with only the cases ascertained prospectively; 0.04 case was expected in each zygosity group, and 5 cases were observed in the monozygous group, giving a standardized incidence ratio of 128 (95 percent confidence interval, 42 to 299).No such difference between pairs of monozygotic and dizygotic twins was seen with respect to the occurrence of other cancers after the diagnosis of Hodgkin's disease in one twin. In pairs of twins in which one had non-Hodgkin's lymphoma or some other malignant condition, the same type of tumor subsequently occurred in the other twin no more than twice as often in the monozygotic group as in the dizygotic group.
All 20 cases of Hodgkin's disease in concordant twins were diagnosed before the age of 50 years (mean, 25.5), and the interval between diagnoses within pairs ranged from 6 months to 12 years (mean, 4.5 years). Overall, the standardized incidence ratio did not vary according to sex and was relatively constant over a period of 15 years after the diagnosis in the first twin.
After reaffirming each of the 20 diagnoses and the (unambiguous) perception of zygosity by telephone, we received permission to obtain the medical records of all 20 twins and 19 sets of diagnostic slides (for the remaining set, a detailed histologic diagnosis was available from the Roswell Park Cancer Institute, Buffalo, N.Y.).
One concordant pair of dizygotic twins was initially described, well after the death of both twins, by a sibling. Permission to review these medical records could not be obtained, but on both death certificates death was attributed to malignant lymphoma, and we presume these cases not to have been of Hodgkin's disease.
Six pairs of monozygotic twins were concordant for nodular sclerosis, a seventh was concordant for mixed cellularity, and one pair was unambiguously discordant (Table 2Table 2
Characteristics of 10 Pairs of Monozygotic Twins Concordant for Hodgkin's Disease.). In the ninth pair, the tumor from one twin showed nodular sclerosis, but the original biopsy slides of the other twin's tumor were lost, and the presence of extensive sclerosis in the available slides of splenic tissue precluded subcategorization. The final pair was originally described as concordant for mixed-cellularity disease; although both tumors had extensive eosinophilic infiltrates, the criteria for that diagnosis were not fully met in our blind review of one case. Thus, no fewer than seven, and no more than nine, of the pairs had the same histologic subtype of Hodgkin's disease.On the basis of the proportion of each histologic subtype in all discordant pairs of monozygotic twins in whom Hodgkin's disease was diagnosed before the age of 50 years, and including patients with the cellular phase of disease in the group with nodular sclerosis,25 4.6 concordant pairs would have been expected by chance. If the patients with the cellular phase of the disease were included in the group with mixed cellularity, as we have advocated on the grounds of epidemiology26 and as others have advocated on the grounds of molecular biology,27 3.8 concordant pairs would have been expected. Either way, a finding of eight or more observed pairs represents an increase unlikely to be due to chance (P<0.05 for Poisson distribution). The excess concordance is largely attributable to the six sets of twins concordant for nodular sclerosis, although concordance for mixed-cellularity Hodgkin's disease may also be increased.
Immunohistopathological studies were performed on specimens from nine patients (eight with nodular sclerosis), including three pairs of twins. The pattern of cell-membrane antigens expressed was consistent with that of other patients with Hodgkin's disease. Evidence of the EBV genome was detected in 4 of the 19 tumor specimens examined, including 3 of 4 with definite or possible mixed cellularity, but in only 1 of the 15 specimens examined with definite or possible nodular sclerosing Hodgkin's disease.
Relatives of the 10 pairs of concordant twins reported no first-degree relatives with another hematopoietic malignant condition or autoimmune disease and no other relatives with Hodgkin's disease.
Previous surveys of patients with nodular sclerosing Hodgkin's disease have found that roughly 15 percent have a history of infectious mononucleosis,28 and such a history of exposure was reported by five patients from four of the concordant pairs (Table 2). In one pair of twins concordant for nodular sclerosing Hodgkin's disease, infectious mononucleosis was reported to have occurred in a sibling rather than in the twins themselves. These twins were also concordant for lipoid nephrosis (minimal-change disease), an uncommon and idiopathic complication of Hodgkin's disease.29 Neither tumor showed evidence of the EBV genome in the Reed–Sternberg cells, even though both twins had highly elevated antibody titers to EBV capsid antigen (1:1280 and 1:10,240). Tumors from the three other twins with nodular sclerosis who were exposed to infectious mononucleosis were similarly negative.
Discussion
Genetic Determination of Hodgkin's Disease
Although no pairs of dizygotic twins concordant for Hodgkin's disease were identified, the previously observed level of familial risk suggests that more than the number expected by chance should have occurred. If the highest reported estimate of risk among the siblings of a patient with Hodgkin's disease (a sevenfold increase)12 is correct, 0.7 case should have occurred among these dizygotic twins in comparison with the 0.1 expected. Had such been observed, the ratio of the standardized incidence ratio for monozygotic twins to the standardized incidence ratio for dizygotic twins would have been 99/7, or 14.
This observed elevation in concordance among monozygotic twins does not appear to be an artifact of ascertainment. A similar disparity between the number of cases observed in monozygotic twins and the number expected was seen when the analysis was restricted to cases identified prospectively. No such disparity was found among monozygotic twins whose status was ascertained and who were observed in the same way (Table 1) for other cancers after Hodgkin's disease, for non-Hodgkin's lymphoma, or for other forms of cancer as a group. In none of these comparisons was the risk more than twice that among dizygotic twins, whether observed prospectively or not. Nor is the elevation likely to be an artifact of differential survival. Because 20 percent of the initial cases of Hodgkin's disease were diagnosed before 1970, some before the introduction of effective therapy, it could be argued that for some unknown proportion of concordant pairs, neither twin survived long enough to be included in our analysis. However, the results are essentially unchanged if all the twins of patients in whom Hodgkin's disease was diagnosed before 1970 are eliminated (standardized incidence ratio for monozygotic twins, 110).
Given the unremarkable risk of Hodgkin's disease observed in dizygotic twins, the increased risk in monozygotic twins cannot be attributed to any increased risk resulting from twinship itself or to random errors in the assignment of zygosity; it must be assumed to reflect genetically determined susceptibility. The relatively young average age at diagnosis of the twins concordant for Hodgkin's disease and the relatively short average interval between diagnoses in each pair of twins are additional observations consistent with this explanation.
Genetic Determination of Nodular Sclerosis
Nodular sclerosing Hodgkin's disease accounts for a majority of the diagnoses in the pairs of concordant twins, and although we cannot be sure that the excess of concordance among monozygotic twins is limited to that subtype, such a finding would be consistent with the published findings on familial risk. A large majority of the 53 reported sibships with multiple cases of Hodgkin's disease10-12,30-41 consisted solely of or included multiple cases of nodular sclerosis. We have previously speculated on the grounds of descriptive epidemiology,26 as have others on the grounds of pathology and natural history,42 that nodular sclerosis is particularly distinct from the other histologic subtypes, including mixed cellularity.
Etiologic Heterogeneity of Hodgkin's Disease
Despite the unexpected level of concordance in monozygotic twins, 90 percent of the monozygotic twins of patients with Hodgkin's disease can be expected to remain unaffected, and no other cases are known to have occurred in the families of these concordant twins. Thus, either the overall penetrance for the susceptible genotype is rather low or only a subgroup is genetically susceptible. Either way, the difference in risk between monozygotic and dizygotic twins is larger than that expected if a major dominant gene were responsible.
The particularly low prevalence of EBV genome in the Reed–Sternberg cells of the tumors of twins concordant for nodular sclerosing Hodgkin's disease, especially in the face of clear evidence of past infection, is of interest and may also indicate etiologic heterogeneity. It is true that the average titer against EBV capsid antigen after diagnosis is no lower in nodular sclerosis than in other subtypes of Hodgkin's disease,43 and a history of infectious mononucleosis is as common in nodular sclerosis as it is in other histologic subtypes.4 However, whereas evidence of intracellular viral genome appears in the large majority of cases of mixed-cellularity Hodgkin's disease, it is present in only a minority of nodular sclerosing tumors6,7,27,44,45 and was nearly absent among the twins concordant for nodular sclerosis, even among those who had been infected with mononucleosis. Other familial cases of Hodgkin's disease with a low prevalence of the EBV genome in the tumor despite serologic evidence of past infection have been reported.46
Phenotypic Mechanism
The evidence of an inherited susceptibility to Hodgkin's disease is completely consistent with the evidence of an environmental determinant. If the disease does represent a genetically determined response to infection with a common childhood virus, it will be important to characterize the susceptibility phenotype. Although genetically determined physical and behavioral characteristics can determine the frequency of environmental exposures (i.e., unattractive or withdrawn children may have less interpersonal contact and thus less exposure to fomites), the magnitude of the effect found here suggests a much more fundamental genetic influence on pathophysiology. An underlying immune abnormality is suggested not only by the hypothesis that this disease represents an unusual response to a common infection, but also by the reported association with certain HLA haplotypes and the evidence of abnormal cytokine production in affected patients47 and of immune abnormalities in the close relatives of some patients.48 Moreover, lipoid nephrosis, which rarely accompanies Hodgkin's disease,49 occurred in both members of one concordant pair. This condition has been found in association with HLA-B850 and is characterized by altered cytokine levels51 and other derangements of immunity,52,53 including altered expression of the C3 complex, which includes the receptor for EBV.54 Although it is unlikely that any single HLA allele or haplotype is responsible for susceptibility to Hodgkin's disease, susceptibility might result from a particular DNA base sequence common to several alleles.
Supported by grants (CA 42581, CA 09492, and CA 50341) from the National Cancer Institute.
We are indebted to the subjects and the International Twin Study staff, to the health care providers and pathologists of 18 medical centers in 13 states for their cooperation, and to Drs. P. Scheerer (Phoenix), P.H.H. Anderson (Pittsburgh), J.A. Benda (Ames, Iowa), P. Marshall (Sheboygan, Wis.), M. Orjuela and B. Jamieson (New York), P. Gregersen and V. Vinceguerra (Manhasset, N.Y.), and D. Inwards, J.G. Strickler, and L.E. Wold (Rochester, Minn.).
Source Information
From the Departments of Preventive Medicine (T.M.M., W.C., A.S.H., D.M.D., E.B.R.) and Pathology (T.M.M., D.K.S., B.N.N., A.M.H, C.R.T.), University of Southern California School of Medicine, Los Angeles, and the Department of Pathology (L.M.W.), City of Hope Medical Center, Duarte, Calif.
Address reprint requests to Dr. Mack at 1420 San Pablo St., Los Angeles, CA 90033.
- References
References
1
MacMahon B . Epidemiology of Hodgkin's disease. Cancer Res 1966;26:1189-1201
Web of Science | Medline2
Gutensohn N ,Cole P . Epidemiology of Hodgkin's disease in the young. Int J Cancer 1977;19:595-604
CrossRef | Web of Science | Medline3
Mack TM. Epidemiology of Hodgkin's disease in young adults: compatibility with various infectious-disease models. In: Essex M, Todaro G, zur Hausen H, eds. Viruses in naturally occurring cancers. Vol. 7 of Cold Spring Harbor Conferences on Cell Proliferation. Book B. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory, 1980:1221-30.
4
Kvale G ,Hoiby EA ,Pedersen E . Hodgkin's disease in patients with previous infectious mononucleosis. Int J Cancer 1979;23:593-597
CrossRef | Web of Science | Medline5
Mueller N ,Evans A ,Harris NL , et al. Hodgkin's disease and Epstein-Barr virus: altered antibody pattern before diagnosis. N Engl J Med 1989;320:689-695
Full Text | Web of Science | Medline6
Jarrett R ,Onions D . Viruses and Hodgkin's disease. Leukemia 1992;6:Suppl 1:14-17
Web of Science | Medline7
Weiss LM ,Chen Y-Y ,Liu X-F ,Shibata D . Epstein-Barr virus and Hodgkin's disease: a correlative in situ hybridization and polymerase chain reaction study. Am J Pathol 1991;139:1259-1265
Web of Science | Medline8
Kerzin-Storrar L ,Faed MJ ,MacGillivray JB ,Smith PG . Incidence of familial Hodgkin's disease. Br J Cancer 1983;47:707-712
CrossRef | Web of Science | Medline9
Halazun JF ,Kerr SE ,Lukens JN . Hodgkin's disease in three children from an Amish kindred. J Pediatr 1972;80:289-291
CrossRef | Web of Science | Medline10
Shibuya H ,Tsukada K ,Takagi M ,Horiuchi JI ,Suzuki S ,Kamiyama RI . Synchronous Hodgkin's disease in monozygotic twins. Acta Radiol Oncol 1984;23:425-428
CrossRef | Medline11
Robertson SJ ,Lowman JT ,Grufferman S , et al. Familial Hodgkin's disease: a clinical and laboratory investigation. Cancer 1987;59:1314-1319
CrossRef | Web of Science | Medline12
Grufferman S ,Cole P ,Smith PG ,Lukes RJ . Hodgkin's disease in siblings. N Engl J Med 1977;296:248-250
Full Text | Web of Science | Medline13
Chakravarti A ,Halloran SL ,Bale SJ ,Tucker MA . Etiological heterogeneity in Hodgkin's disease: HLA linked and unlinked determinants of susceptibility independent of histological concordance. Genet Epidemiol 1986;3:407-415
CrossRef | Web of Science | Medline14
Risch N . Assessing the role of HLA-linked and unlinked determinants of disease. Am J Hum Genet 1987;40:1-14
Web of Science | Medline15
Percy C, Van Holten V, Muir C, eds. International classification of diseases for oncology. 2nd ed. Geneva: World Health Organization, 1990.
16
Kasriel J ,Eaves L . The zygosity of twins: further evidence on the agreement between diagnosis by blood groups and written questionnaires. J Biosoc Sci 1976;8:263-266
CrossRef | Web of Science | Medline17
Kumar D ,Gemayel NS ,Deapen D , et al. North-American twins with IDDM: genetic, etiological, and clinical significance of disease concordance according to age, zygosity, and the interval after diagnosis in first twin. Diabetes 1993;42:1351-1363
CrossRef | Web of Science | Medline18
Deapen D ,Escalante A ,Weinrib L , et al. A revised estimate of twin concordance in systemic lupus erythematosus. Arthritis Rheum 1992;35:311-318
CrossRef | Web of Science | Medline19
Lukes RJ ,Butler JJ . The pathology and nomenclature of Hodgkin's disease. Cancer Res 1966;26:1063-1083
Web of Science | Medline20
Sherrod AE ,Felder B ,Levy N , et al. Immunohistologic identification of phenotypic antigens associated with Hodgkin and Reed-Sternberg cells: a paraffin section study. Cancer 1986;57:2135-2140
CrossRef | Web of Science | Medline21
Allen G ,Hrubec Z . Twin concordance: a more general model. Acta Genet 1979;28:3-1322
McGue M . When assessing twin concordance, use the probandwise not the pairwise rate. Schizophr Bull 1992;18:171-176
Web of Science | Medline23
Kendler KS . Limitations of the ratio of concordance rates in monozygotic and dizygotic twins. Arch Gen Psychiatry 1989;46:477-478
Web of Science | Medline24
Miller BA, Reis LAG, Hankey BA, et al., eds. SEER cancer statistics review, 1973-1990. Bethesda, Md.: National Institutes of Health, 1993. (Report no. NIH-NCI-03-2789.)
25
Lukes RJ . Criteria for involvement of lymph node, bone marrow, spleen, and liver in Hodgkin's disease. Cancer Res 1971;31:1755-1767
Web of Science | Medline26
Cozen W ,Katz J ,Mack TM . Risk patterns of Hodgkin's disease in Los Angeles vary by cell type. Cancer Epidemiol Biomarkers Prev 1992;1:261-268
Web of Science | Medline27
Delsol G ,Brousset P ,Chittal S ,Rigal-Huguet F . Correlation of the expression of Epstein-Barr virus latent membrane protein and in situ hybridization with biotinylated BamHI-W probes in Hodgkin's disease. Am J Pathol 1992;140:247-253
Web of Science | Medline28
Gutensohn N ,Cole P . Childhood social environment and Hodgkin's disease. N Engl J Med 1981;304:135-140
Full Text | Web of Science | Medline29
Peces R ,Sanchez L ,Gorostidi M ,Alvarez J . Minimal change nephrotic syndrome associated with Hodgkin's lymphoma. Nephrol Dial Transplant 1991;6:155-158
Web of Science | Medline30
Armata J ,Balwierz W ,Tacik J . Hodgkin's disease in siblings. Lancet 1991;337:502-502
CrossRef | Web of Science | Medline31
Thorling K . Familial Hodgkin's disease. Dan Med Bull 1973;20:61-63
Web of Science | Medline32
Martin BJ ,Lennox IM ,McGowan A . Familial Hodgkins disease. Scott Med J 1985;30:239-240
Web of Science | Medline33
Gracz K ,Kofman S ,Economou SG . Hodgkin disease in monozygotic twins: a case report. J Surg Oncol 1979;12:221-226
CrossRef | Web of Science | Medline34
Olisa EG ,Kovi J ,Onuora CA . Familial Hodgkin disease. JAMA 1974;230:536-536
CrossRef | Web of Science | Medline35
Maldonado JE ,Taswell HF ,Kiely JM . Familial Hodgkin's disease. Lancet 1972;2:1259-1259
CrossRef | Web of Science | Medline36
Vianna NJ ,Davies JN ,Polan AK ,Wolfgang P . Familial Hodgkin's disease: an environmental and genetic disorder. Lancet 1974;2:854-857
CrossRef | Web of Science | Medline37
Creagan ET ,Fraumeni JF Jr . Familial Hodgkin's disease. Lancet 1972;2:547-547
CrossRef | Web of Science | Medline38
Donhuijsen-Ant R ,Abken H ,Bornkamm G , et al. Fatal Hodgkin and non-Hodgkin lymphoma associated with persistent Epstein-Barr virus in four brothers. Ann Intern Med 1988;109:946-952
Web of Science | Medline39
Lynch HT ,Saldivar VA ,Guirgis HA , et al. Familial Hodgkin's disease and associated cancer: a clinical-pathologic study. Cancer 1976;38:2033-2041
CrossRef | Web of Science | Medline40
Perlin E ,Levine PH ,McCoy J ,Dean J ,Herberman R . Hodgkin's disease in siblings: a family study. Oncology 1976;33:116-118
CrossRef | Web of Science | Medline41
Lin A ,Whitehouse J ,Shaw G ,Tucker M . Familial aggregation of Hodgkin's disease in a cohort of 48 families. Prog Proc Am Soc Clin Oncol 1993;12:184-184 abstract.42
Smithers DW . Hodgkin's disease: one entity or two? Lancet 1970;2:1285-1287
CrossRef | Web of Science | Medline43
Evans AS ,Gutensohn NM . A population-based case-control study of EBV and other viral antibodies among persons with Hodgkin's disease and their siblings. Int J Cancer 1984;34:149-157
CrossRef | Web of Science | Medline44
Gledhill S ,Gallagher A ,Jones DB , et al. Viral involvement in Hodgkin's disease: detection of clonal type A Epstein-Barr virus genomes in tumour samples. Br J Cancer 1991;64:227-232
CrossRef | Web of Science | Medline45
Weiss LM ,Movahed LA ,Warnke RA ,Sklar J . Detection of Epstein-Barr viral genomes in Reed-Sternberg cells of Hodgkin's disease. N Engl J Med 1989;320:502-506
Full Text | Web of Science | Medline46
Lin A ,Kingma D ,Lennette E , et al. Epstein-Barr virus (EBV) is not associated with familial Hodgkin's disease (FHD). Prog Proc Am Soc Clin Oncol 1994;13:185-185 abstract.
CrossRef47
Gause A ,Keymis S ,Scholz R , et al. Increased levels of circulating cytokines in patients with untreated Hodgkin's disease. Lymphokine Cytokine Res 1992;11:109-113
Medline48
Merk K ,Bjorkholm M ,Tullgren O ,Mellstedt H ,Holm G . Immune deficiency in family members of patients with Hodgkin's disease. Cancer 1990;66:1938-1943
CrossRef | Web of Science | Medline49
Dabbs DJ ,Striker LM ,Mignon F ,Striker G . Glomerular lesions in lymphomas and leukemias. Am J Med 1986;80:63-70
CrossRef | Web of Science | Medline50
Zwolinska D ,Morawski Z ,Makulska I ,Dmochowska D ,Jasniak K ,Morawski A . Histocompatibility antigens (HLA) in children with lipoid nephrosis. Pol Tyg Lek 1992;47:671-672
Medline51
Schnaper HW ,Aune TM . Identification of the lymphokine soluble immune response suppressor in urine of nephrotic children. J Clin Invest 1985;76:341-349
CrossRef | Web of Science | Medline52
Kelly CJ, Haverty T, Neilson EG. Control of the nephritogenic immune response. In: Wilson CB, Brenner BM, Stein JH, eds. Disease: immunopathology of renal disease. New York: Churchill Livingstone, 1988:35-56.
53
Shalhoub RJ . Pathogenesis of lipoid nephrosis: a disorder of T-cell function. Lancet 1974;2:556-560
CrossRef | Web of Science | Medline54
Cybulsky AV, Quigg RJ, Salant DJ. Role of the complement membrane attack complex in glomerular injury. In: Wilson CB, Brenner BM, Stein JH, eds. Disease: immunopathology of renal disease. New York: Churchill Livingstone, 1988:57-63.
- Citing Articles (84)
Citing Articles
1
C. Papadopoulou, C.N. Antonopoulos, T.N. Sergentanis, P. Panagopoulou, M. Belechri, E.T. Petridou. (2012) Is birth weight associated with childhood lymphoma? A meta-analysis. International Journal of Cancer 130:1, 179-189
CrossRef2
C.N. Antonopoulos, T.N. Sergentanis, C. Papadopoulou, E. Andrie, N. Dessypris, P. Panagopoulou, S. Polychronopoulou, A. Pourtsidis, F. Athanasiadou-Piperopoulou, M. Kalmanti, V. Sidi, M. Moschovi, E.T. Petridou. (2011) Maternal smoking during pregnancy and childhood lymphoma: A meta-analysis. International Journal of Cancer 129:11, 2694-2703
CrossRef3
W. Cozen, D. Li, T. Best, D. J. Van Den Berg, P.-A. Gourraud, V. K. Cortessis, A. D. Skol, T. M. Mack, S. L. Glaser, L. M. Weiss, B. N. Nathwani, S. Bhatia, F. R. Schumacher, C. K. Edlund, A. E. Hwang, S. L. Slager, Z. S. Fredericksen, L. C. Strong, T. M. Habermann, B. K. Link, J. R. Cerhan, L. L. Robison, D. V. Conti, K. Onel. (2011) A genome-wide meta-analysis of nodular sclerosis Hodgkin lymphoma identifies risk loci at 6p21.32. Blood
CrossRef4
Stephen M. Ansell. (2011) Hodgkin lymphoma: 2011 update on diagnosis, risk-stratification, and management. American Journal of Hematology 86:10, 851-858
CrossRef5
L. Moutsianas, V. Enciso-Mora, Y. P. Ma, S. Leslie, A. Dilthey, P. Broderick, A. Sherborne, R. Cooke, A. Ashworth, A. J. Swerdlow, G. McVean, R. S. Houlston. (2011) Multiple Hodgkin lymphoma-associated loci within the HLA region at chromosome 6p21.3. Blood 118:3, 670-674
CrossRef6
S. Saarinen, M. Aavikko, K. Aittomaki, V. Launonen, R. Lehtonen, K. Franssila, H. J. Lehtonen, E. Kaasinen, P. Broderick, J. Tarkkanen, B. J. Bain, F. Bauduer, A. Unal, A. J. Swerdlow, R. Cooke, M. J. Makinen, R. Houlston, P. Vahteristo, L. A. Aaltonen. (2011) Exome sequencing reveals germline NPAT mutation as a candidate risk factor for Hodgkin lymphoma. Blood 118:3, 493-498
CrossRef7
Michael Crump. 2011. Hodgkin Lymphoma. , 296-314.
CrossRef8
Uwe Schneider, Marcin Sumila, Judith Robotka. (2011) Site-specific dose-response relationships for cancer induction from the combined Japanese A-bomb and Hodgkin cohorts for doses relevant to radiotherapy. Theoretical Biology and Medical Modelling 8:1, 27
CrossRef9
Victor Enciso-Mora, Peter Broderick, Yussanne Ma, Ruth F Jarrett, Henrik Hjalgrim, Kari Hemminki, Anke van den Berg, Bianca Olver, Amy Lloyd, Sara E Dobbins, Tracy Lightfoot, Flora E van Leeuwen, Asta Försti, Arjan Diepstra, Annegien Broeks, Jayaram Vijayakrishnan, Lesley Shield, Annette Lake, Dorothy Montgomery, Eve Roman, Andreas Engert, Elke Pogge von Strandmann, Katrin S Reiners, Ilja M Nolte, Karin E Smedby, Hans-Olov Adami, Nicola S Russell, Bengt Glimelius, Stephen Hamilton-Dutoit, Marieke de Bruin, Lars P Ryder, Daniel Molin, Karina Meden Sorensen, Ellen T Chang, Malcolm Taylor, Rosie Cooke, Robert Hofstra, Helga Westers, Tom van Wezel, Ronald van Eijk, Alan Ashworth, Klaus Rostgaard, Mads Melbye, Anthony J Swerdlow, Richard S Houlston. (2010) A genome-wide association study of Hodgkin's lymphoma identifies new susceptibility loci at 2p16.1 (REL), 8q24.21 and 10p14 (GATA3). Nature Genetics 42:12, 1126-1130
CrossRef10
Wolfgang Dörffel, Dieter Körholz. 2010. Hodgkin's Lymphoma. , 130-148.
CrossRef11
Jane E. Churpek, Kenan Onel. (2010) Heritability of Hematologic Malignancies: From Pedigrees to Genomics. Hematology/Oncology Clinics of North America 24:5, 939-972
CrossRef12
Peter Broderick, David Cunningham, Jayaram Vijayakrishnan, Rosie Cooke, Alan Ashworth, Anthony Swerdlow, Richard Houlston. (2010) IRF4 polymorphism rs872071 and risk of Hodgkin lymphoma. British Journal of Haematology 148:3, 413-415
CrossRef13
Mehmet Sonmez, Nergiz Erkut, Fahri Ucar, Kurtulus Buruk, Umit Cobanoglu, Muhterem Bahce, Ali Ugur Ural. (2010) Familial Hodgkin's Lymphoma from the Perspective of HLA. Internal Medicine 49:6, 607-610
CrossRef14
Haresh Mani, Elaine S. Jaffe. (2009) Hodgkin Lymphoma: An Update on Its Biology With New Insights Into Classification. Clinical Cancer Reviews 3:1, 54-64
CrossRef15
W. Cozen, A. S. Hamilton, P. Zhao, M. T. Salam, D. M. Deapen, B. N. Nathwani, L. M. Weiss, T. M. Mack. (2009) A protective role for early oral exposures in the etiology of young adult Hodgkin lymphoma. Blood 114:19, 4014-4020
CrossRef16
Vassiliki Mollaki, Thomas Georgiadis, Anna Tassidou, Maria Ioannou, Zoe Daniil, Aggeliki Koutsokera, Aphrodite A Papathanassiou, Elias Zintzaras, George Vassilopoulos. (2009) Polymorphisms and haplotypes in TLR9 and MYD88 are associated with the development of Hodgkin's lymphoma: a candidate–gene association study. Journal of Human Genetics 54:11, 655-659
CrossRef17
KAREN L. CHANG, DANIEL A. ARBER, LAWRENCE M. WEISS. 2009. Lymph Nodes. , 1431-1511.
CrossRef18
Dong Pang, Robert D. Alston, Tim O.B. Eden, Jillian M. Birch. (2008) Cancer risks among relatives of children with Hodgkin and non‐Hodgkin lymphoma. International Journal of Cancer 123:6, 1407-1410
CrossRef19
W. Cozen, P. S. Gill, M. T. Salam, A. Nieters, R. Masood, M. G. Cockburn, W. J. Gauderman, O. Martinez-Maza, B. N. Nathwani, M. C. Pike, D. J. Van Den Berg, A. S. Hamilton, D. M. Deapen, T. M. Mack. (2008) Interleukin-2, interleukin-12, and interferon- levels and risk of young adult Hodgkin lymphoma. Blood 111:7, 3377-3382
CrossRef20
R. F. Ambinder. (2008) Hodgkin twins: double good, double trouble. Blood 111:7, 3310-3310
CrossRef21
Uwe Schneider, Linda Walsh. (2008) Cancer risk estimates from the combined Japanese A-bomb and Hodgkin cohorts for doses relevant to radiotherapy. Radiation and Environmental Biophysics 47:2, 253-263
CrossRef22
Hye Sook Min, Im-Soon Lee, Seong Hoe Park. (2008) Mutual regulation of EBV LMP1 and CD99 in the pathogenesis of EBV-associated Hodgkin lymphomas. Basic and Applied Pathology 1:1, 4-8
CrossRef23
Jalil Ur Rehman, Ikram A. Burney, Salam Al Kindi, Sandy Raeburn. (2008) Familial lymphoma in an Omani kindred with identical class II HLA type. Leukemia & Lymphoma 49:7, 1407-1410
CrossRef24
Ora Paltiel. (2008) Family matters in Hodgkin lymphoma. Leukemia & Lymphoma 49:7, 1234-1235
CrossRef25
Eleni Th. Petridou, Stavroula K. Dikalioti, Alkistis Skalkidou, Elisabeth Andrie, Nick Dessypris, Dimitrios Trichopoulos, . (2007) Sun exposure, birth weight, and childhood lymphomas: a case control study in Greece. Cancer Causes & Control 18:9, 1031-1037
CrossRef26
Sally L. Glaser, Ellen T. Chang, Sandra J. Horning, Christina A. Clarke. (2007) Understanding the validity of self-reported positive family history of lymphoma in extended families to facilitate genetic epidemiology and clinical practice. Leukemia & Lymphoma 48:6, 1110-1118
CrossRef27
A Altieri, K Hemminki. (2006) The familial risk of Hodgkin's lymphoma ranks among the highest in the Swedish Family-Cancer Database. Leukemia 20:11, 2062-2063
CrossRef28
O. Landgren, E. A. Engels, R. M. Pfeiffer, G. Gridley, L. Mellemkjaer, J. H. Olsen, K. F. Kerstann, W. Wheeler, K. Hemminki, M. S. Linet, L. R. Goldin. (2006) Autoimmunity and Susceptibility to Hodgkin Lymphoma: A Population-Based Case-Control Study in Scandinavia. JNCI Journal of the National Cancer Institute 98:18, 1321-1330
CrossRef29
Nina S. Kadan-Lottick, Toana Kawashima, Gail Tomlinson, Debra L. Friedman, Yutaka Yasui, Ann C. Mertens, Leslie L. Robison, Louise C. Strong. (2006) The risk of cancer in twins: A report from the childhood cancer survivor study. Pediatric Blood & Cancer 46:4, 476-481
CrossRef30
E. Petridou, E. Andrie, N. Dessypris, S. K. Dikalioti, D. Trichopoulos, . (2006) Incidence and Characteristics of Childhood Hodgkin’s Lymphoma in Greece: A Nationwide Study (Greece). Cancer Causes & Control 17:2, 209-215
CrossRef31
S. M. Ansell, J. O. Armitage. (2006) Management of Hodgkin Lymphoma. Mayo Clinic Proceedings 81:3, 419-426
CrossRef32
Ola Landgren, Magnus Björkholm, Scott M. Montgomery, Henrik Hjalgrim, Jan Sjöberg, Lynn R. Goldin, Johan Askling. (2006) Personal and family history of autoimmune diabetes mellitus and susceptibility to young-adult-onset Hodgkin lymphoma. International Journal of Cancer 118:2, 449-452
CrossRef33
E. T. Chang, K. E. Smedby, H. Hjalgrim, B. Glimelius, H.-O. Adami. (2006) Reliability of Self-Reported Family History of Cancer in a Large Case-Control Study of Lymphoma. JNCI Journal of the National Cancer Institute 98:1, 61-68
CrossRef34
Doru T. Alexandrescu, Alexandria Garino, Kelly A. Brown-Balem, Peter H. Wiernik. (2006) Anticipation in families with Hodgkin's and non-Hodgkin's lymphoma in their pedigree. Leukemia & Lymphoma 47:10, 2115-2127
CrossRef35
Khawla Al-Kuraya, Rajeswari Narayanappa, Fouad Al-Dayel, Hassan El-Solh, Adnan Ezzat, Hoda Ismail, Asim Belgaumi, Prashant Bavi, Valerie Atizado, Guido Sauter, Ronald Simon. (2006) Epstein – Barr virus infection is not the sole cause of high prevalence for Hodgkin's lymphoma in Saudi Arabia. Leukemia & Lymphoma 47:4, 707-713
CrossRef36
E. T. Chang, K. E. Smedby, H. Hjalgrim, A. Porwit-MacDonald, G. Roos, B. Glimelius, H.-O. Adami. (2005) Family History of Hematopoietic Malignancy and Risk of Lymphoma. JNCI Journal of the National Cancer Institute 97:19, 1466-1474
CrossRef37
Julie Osborne, Annette Lake, Freda E. Alexander, G. Malcolm Taylor, Ruth F. Jarrett. (2005) Germline mutations and polymorphisms in theNFKBIA gene in Hodgkin lymphoma. International Journal of Cancer 116:4, 646-651
CrossRef38
Duncan C. Thomas, Robert W. Haile, David Duggan. (2005) Recent Developments in Genomewide Association Scans: A Workshop Summary and Review. The American Journal of Human Genetics 77:3, 337-345
CrossRef39
A. Diepstra, M. Niens, G. J. Te Meerman, S. Poppema, A. Berg. (2005) Genetic susceptibility to Hodgkin's lymphoma associated with the human leukocyte antigen region. European Journal of Haematology 75, 34-41
CrossRef40
A Diepstra, M Niens, E Vellenga, GW van Imhoff, IM Nolte, M Schaapveld, G van der Steege, A van den Berg, RE Kibbelaar, GJ te Meerman, S Poppema. (2005) Association with HLA class I in Epstein-Barr-virus-positive and with HLA class III in Epstein-Barr-virus-negative Hodgkin's lymphoma. The Lancet 365:9478, 2216-2224
CrossRef41
Peter M. Kamper, Eigil Kjeldsen, Niels Clausen, Knud Bendix, Stephen Hamilton-Dutoit, Francesco d'Amore. (2005) Epstein-Barr virus-associated familial Hodgkin lymphoma: paediatric onset in three of five siblings. British Journal of Haematology 129:5, 615-617
CrossRef42
A. Unal, I. Sari, K. Deniz, M. Ozkan, O. Kontas, B. Eser, M. Cetin. (2005) Familial nodular lymphocyte predominant Hodgkin lymphoma: Successful treatment with CHOP plus rituximab. Leukemia & Lymphoma 46:11, 1613-1617
CrossRef43
Rina Siddiqui, Kenan Onel, Flavia Facio, Kenneth Offit. (2004) The genetics of familial lymphomas. Current Oncology Reports 6:5, 380-387
CrossRef44
Lynn R. Goldin, Ruth M. Pfeiffer, Gloria Gridley, Mitchell H. Gail, Xinjun Li, Lene Mellemkjaer, J
rgen H. Olsen, Kari Hemminki, Martha S. Linet. (2004) Familial aggregation of Hodgkin lymphoma and related tumors. Cancer 100:9, 1902-1908
CrossRef45
Maher K. Gandhi, Judy T. Tellam, Rajiv Khanna. (2004) Epstein-Barr virus-associated Hodgkin's lymphoma. British Journal of Haematology 125:3, 267-281
CrossRef46
Roman K Thomas, Daniel Re, Jürgen Wolf, Volker Diehl. (2004) Part I: Hodgkin's lymphoma—molecular biology of Hodgkin and Reed-Sternberg cells. The Lancet Oncology 5:1, 11-18
CrossRef47
Kari Hemminki, Xinjun Li, Kamila Czene. (2004) Familial risk of cancer: Data for clinical counseling and cancer genetics. International Journal of Cancer 108:1, 109-114
CrossRef48
Daniel Molin. (2004) Bystander Cells and Prognosis in Hodgkin Lymphoma. Upsala Journal of Medical Sciences 109:3, 179-228
CrossRef49
Gavin NS Campbell, Josephine Lloyd, Andrew Wotherspoon, Carmel Coulter, Barbara J Bain. (2004) Nodular Lymphocyte Predominant Hodgkin Lymphoma in Siblings. Leukemia & Lymphoma 45:3, 609-611
CrossRef50
Punam Pahwa, Helen H. McDuffie, James A. Dosman, Diane Robson, John R. McLaughlin, John J. Spinelli, Shirley Fincham. (2003) Exposure to Animals and Selected Risk Factors Among Canadian Farm Residents with Hodgkin’s Disease, Multiple Myeloma, or Soft Tissue Sarcoma. Journal of Occupational and Environmental Medicine 45:8, 857-868
CrossRef51
A. J. Swerdlow. (2003) Epidemiology of Hodgkin's disease and non-Hodgkin's lymphoma. European Journal of Nuclear Medicine and Molecular Imaging 30:S1, S3-S12
CrossRef52
Im-Soon Lee, Seok Hyung Kim, Hyung Geun Song, Seong Hoe Park. (2003) The Molecular Basis for the Generation of Hodgkin and Reed-Sternberg Cells in Hodgkin’s Lymphoma. International Journal of Hematology 77:4, 330-335
CrossRef53
Charles Stiller. (2002) Epidemiology of cancer in adolescents. Medical and Pediatric Oncology 39:3, 149-155
CrossRef54
Kari Hemminki, Xinjun Li. (2002) Cancer risks in twins: Results from the Swedish family-cancer database. International Journal of Cancer 99:6, 873-878
CrossRef55
J. Teruya-Feldstein, J. Greene, L. Cohen, L. Popplewell, Nathan A. Ellis, K. Offit. (2002) Analysis of Mismatch Repair Defects in the Familial Occurrence of Lymphoma and Colorectal Cancer. Leukemia & Lymphoma 43:8, 1619-1626
CrossRef56
Im-Soon Lee, Young Kee Shin, Doo Hyun Chung, Seong Hoe Park. (2001) LMP1-Induced Downregulation of CD99 Molecules in Hodgkin and Reed-Sternberg Cells. Leukemia & Lymphoma 42:4, 587-594
CrossRef57
A WHITTEMORE, M SHIH. (2000) Pseudoautosomal Linkage of Hodgkin Disease. The American Journal of Human Genetics 67:2, 535-537
CrossRef58
Lichtenstein, Paul, Holm, Niels V., Verkasalo, Pia K., Iliadou, Anastasia, Kaprio, Jaakko, Koskenvuo, Markku, Pukkala, Eero, Skytthe, Axel, Hemminki, Kari, . (2000) Environmental and Heritable Factors in the Causation of Cancer — Analyses of Cohorts of Twins from Sweden, Denmark, and Finland. New England Journal of Medicine 343:2, 78-85
Full Text59
Ora Paltiel, Tal Schmit, Bella Adler, Eliezer A. Rachmilevitz, Aaron Polliack, Amos Cohen, Nissim Haim, Menachem Ben Shachar, Ron Epelbaum, Micha Barchana, Ronit Cohen, Dina Ben Yehuda. (2000) The incidence of lymphoma in first-degree relatives of patients with Hodgkin disease and non-Hodgkin lymphoma. Cancer 88:10, 2357-2366
CrossRef60
Joe L Hsu, Sally L Glaser. (2000) Epstein–Barr virus-associated malignancies: epidemiologic patterns and etiologic implications. Critical Reviews in Oncology/Hematology 34:1, 27-53
CrossRef61
Thomas M Mack, Dennis Deapen, Ann S Hamilton. (2000) Representativeness of a roster of volunteer North American twins with chronic disease. Twin Research and Human Genetics 3:1, 32-42
CrossRef62
Maurizio Arico, Kim Nichols, James A. Whitlock, Robert Arceci, Riccardo Haupt, Uwe Mittler, Thomas Kuhne, Alessandra Lombardi, Eiichi Ishii, R. Maarten Egeler, Cesare Danesino. (1999) Familial clustering of Langerhans cell histiocytosis. British Journal of Haematology 107:4, 883-888
CrossRef63
Fernando Marco, Raquel Manjon, Carlos Richard, Francisco Mazorra, Ana Garcia-Valtuille, M. Dolores Delgado, M. Luisa Loyo, M. Angeles Cuadrado, Alberto Zubizarreta. (1999) Simultaneous occurrence of follicular lymphoma in two monozygotic twins. British Journal of Haematology 107:2, 461-462
CrossRef64
Marshall Horwitz, Peter H. Wiernik. (1999) Pseudoautosomal Linkage of Hodgkin Disease. The American Journal of Human Genetics 65:5, 1413-1422
CrossRef65
Claudia P
CrossRef66
Christel Wihlborg, Jan Sjoberg, Monica Intaglietta, Ulla Axdorph, Eva K. Pisa, Pavel Pisa. (1999) Tumour necrosis factor-alpha cytokine promoter gene polymorphism in Hodgkin's disease and chronic lymphocytic leukaemia. British Journal of Haematology 104:2, 346-349
CrossRef67
D PELEG, M BENAMI. (1998) LYMPHOMA AND LEUKEMIA COMPLICATING PREGNANCY. Obstetrics and Gynecology Clinics of North America 25:2, 365-383
CrossRef68
Kim E. Nichols, Frederick P. Li, Daniel A. Haber, Lisa Diller. (1998) Childhoood cancer predisposition: Applications of molecular testing and future implications. The Journal of Pediatrics 132:3, 389-397
CrossRef69
TUULA LEHTINEN, MATTI LEHTINEN. (1998) Common and emerging infectious causes of hematological malignancies in the young. APMIS 106:1-6, 585-597
CrossRef70
AJ Swerdlow, BL De Stavola, MA Swanwick, NES Maconochie. (1997) Risks of breast and testicular cancers in young adult twins in England and Wales: evidence on prenatal and genetic aetiology. The Lancet 350:9093, 1723-1728
CrossRef71
R. Beverly Raney. (1997) Hodgkinʼs Disease in Childhood. Journal of Pediatric Hematology/Oncology 19:6, 502-509
CrossRef72
Tine Westergaard, Mads Melbye, Jakob B. Pedersen, Morten Frisch, Jørgen H. Olsen, Per K. Andersen. (1997) Birth order, sibship size and risk of Hodgkin's disease in children and young adults: A population-based study of 31 million person-years. International Journal of Cancer 72:6, 977-981
CrossRef73
Bassem I. Razzouk, Yan J. Gan, Carmen Mendonça, Jesse J. Jenkins, Qing Liu, Melissa Hudson, John W. Sixbey, Raul C. Ribeiro. (1997) Epstein-Barr virus in pediatric Hodgkin disease: Age and histiotype are more predictive than geographic region. Medical and Pediatric Oncology 28:4, 248-254
CrossRef74
Ofer Shpilberg, Janice S. Dorman, Avner Shahar, Lewis H. Kuller. (1997) Molecular epidemiology of hematological neoplasms—Present status and future directions. Leukemia Research 21:4, 265-284
CrossRef75
Alexandra M. Levine. (1996) HIV-ASSOCIATED HODGKIN'S DISEASE. Hematology/Oncology Clinics of North America 10:5, 1135-1148
CrossRef76
Peter Greenwald. (1996) Cancer risk factors for selecting cohorts for large-scale chemoprevention trials. Journal of Cellular Biochemistry 63:S25, 29-36
CrossRef77
KL Chang, LM Weiss. (1996) The association of the Epstein-Barr virus with malignant lymphoma. Biomedicine & Pharmacotherapy 50:9, 459-467
CrossRef78
Yasuhiko Tomita, Masahiko Ohsawa, Hiroyuki Kanno, Michiko Hashimoto, Akio Ohnishi, Hirofumi Nakanishi, Katsuyuki Aozasa. (1996) Epstein-Barr virus in Hodgkin's disease patients in Japan. Cancer 77:1, 186-192
CrossRef79
Sørensen, Thorkild I.A., . (1995) Is There an Inherited General Susceptibility to Cancer?. New England Journal of Medicine 333:24, 1633-1635
Full Text80
Dennis H. Wright. (1995) Editorial. The Journal of Pathology 177:4, 331-333
CrossRef81
Hummel, Michael, Ziemann, KatharinaLammert, HettyPileri, Stefano, Sabattini, Elena, Stein, Harald, . (1995) Hodgkin's Disease with Monoclonal and Polyclonal Populations of Reed–Sternberg Cells. New England Journal of Medicine 333:14, 901-906
Full Text82
(1995) Genetic Predisposition to Hodgkin's Disease. New England Journal of Medicine 333:1, 64-65
Full Text83
Henry T. Lynch, Joseph N. Marcus. (1995) Genetics and environment in Hodgkin's disease. Nature Medicine 1:4, 298-300
CrossRef84
Diehl, Volker, Tesch, Hans, . (1995) Hodgkin's Disease — Environmental or Genetic?. New England Journal of Medicine 332:7, 461-463
Full Text
- Letters
