Original Article
Brief Report
Uveitis Caused by Tropheryma whippelii (Whipple's Bacillus)
N Engl J Med 1995; 332:363-366February 9, 1995
- Article
Whipple's disease is a multisystem bacterial disease usually characterized by malabsorption, diarrhea, and polyarthritis. Ocular manifestations of Whipple's disease include blurred vision or visual loss with one or more of the following findings: vitritis, uveitis, retinitis, retinal hemorrhage, choroiditis, papilledema, optic atrophy, and keratitis.1 In general, these ocular manifestations occur in patients who also have gastrointestinal or central nervous system involvement.
We report a case of chronic, bilateral uveitis with unusual ophthalmologic features. The patient had no clinical evidence of gastrointestinal disease, and light microscopy of repeated duodenal-biopsy specimens was negative. A preliminary diagnosis of Whipple's disease was made on the basis of vitreous aspiration and light microscopy. Electron microscopy revealed bacilli that resembled those of Whipple's disease. The diagnosis was confirmed by polymerase-chain-reaction (PCR) assay, which detected 16S ribosomal RNA gene (rDNA) sequences corresponding to the Whipple's disease bacillus (Tropheryma whippelii) in the vitreous2 and a nearly identical gene sequence in the duodenal mucosa.
Case Report
In November 1989, a 59-year-old white woman was referred because of bilateral uveitis. She had had seronegative arthritis involving the wrists, knees, and ankles for 10 to 20 years, although she had been without symptoms for approximately 6 months, with normal plain radiographs in June 1989.
On presentation, the patient's visual acuity was 20/25 in the right eye and 20/50 in the left eye. There were 1 to 2+ vitreous cells in the right eye, a few small dot hemorrhages in the macula, and slight engorgement of the optic-nerve head. The left eye had 3+ anterior vitreous cells, an engorged disk, and cystoid macular edema. A fluorescein angiogram showed leakage in both nerve heads. She had an erythrocyte sedimentation rate of 39 mm per hour, normal total hemolytic complement and angiotensin-converting enzyme levels, and negative results on antinuclear-antibody, rheumatoid-factor, rapid plasma reagin, and fluorescent treponemal antibody absorption tests.
Magnetic resonance imaging of the head revealed cortical atrophy. There was a negative reaction to purified-protein derivative (without controls), a normal chest radiograph, and negative serologic tests for Lyme disease. The uveitis responded poorly to corticosteroid injections. In February 1990 a diagnostic vitrectomy of the left eye revealed reactive mononuclear cells but no atypical cells. Cultures for bacteria, fungi, and acid-fast bacilli were negative.
Over the ensuing year, the patient had persistent inflammation in both eyes, with cystoid macular edema. Cytologic tests, cultures, and staining after a diagnostic pars plana vitrectomy of the right eye were unrevealing.
The patient lost 7 kg in one year and had 7.4 g of fat in a 24-hour stool collection. In November 1990 and May 1992, endoscopic biopsies of the duodenum and terminal ileum revealed normal histologic features. Examination of the cerebrospinal fluid was unremarkable. Despite local corticosteroid therapy and the systemic administration of cyclosporine and cyclophosphamide, visual acuity deteriorated in both eyes over the next three years, and bilateral epiretinal membranes with substantial macular distortion, cataracts, and white fluffy corneal endothelial precipitates developed. One of several subsequent ophthalmologic surgical procedures revealed a thick exudative material over the right pars plana inferiorly and fine neovascularization of the optic nerve head.
In March 1993 the patient was found to have iris nodules in the right eye (Figure 1Figure 1
Slit-Lamp Photograph Taken in March 1993, Revealing Multiple Tan Iris Nodules in the Right Eye.). Flocculent, inflammatory corneal debris persisted (Figure 2Figure 2
Slit-Lamp Photograph of the Right Eye, Revealing Flocculent, Inflammatory Debris That Adhered to the Posterior Corneal Surface and Eventually Obscured the Optical Axis.), and there were new retinal nodular precipitates. Repeated vitreous examinations revealed lymphocytes, neutrophils, and foamy macrophages and slender rod-shaped structures suggestive of bacteria that were positive on periodic acid–Schiff (PAS) staining, but no malignant cells. A portion of vitreous obtained in March 1993 was studied by electron microscopy and PCR (see the Methods section).At that time, the patient reported difficulty in concentrating, memory loss, and occasional loose stools. A neurologic examination was otherwise negative, and the serum albumin level was normal. After vitreous cytopathologic features consistent with Whipple's disease had been confirmed, another endoscopic duodenal biopsy was performed in May 1993. The histologic features and the results of PAS staining were again normal. A tissue sample was also studied by PCR (see the Methods section). The patient was given a 14-day course of intravenous penicillin G (24 million units per day) and intramuscular streptomycin (1 g per day). She gained 5 kg, and the ocular inflammation improved dramatically. Her visual acuity improved to 20/100 in the right eye and 20/40 in the left eye. Because of intolerance to trimethoprim–sulfamethoxazole, she was treated with oral penicillin V potassium (500 mg every six hours) and probenecid and continued to do well.
Methods
Electron Microscopy
One hundred microliters of vitreous fluid was centrifuged at 10,000×g in a 0.5-ml microcentrifuge tube. The supernatant fluid was removed, and the pellet was fixed first in 1.5 percent glutaraldehyde and then in 2 percent osmium tetroxide, washed, dehydrated, and embedded in epoxy resin (LX-112, Ladd Research Industries, Burlington, Vt.). Thin sections were stained again in 2 percent uranyl acetate and 2 percent lead citrate and viewed in an electron microscope (H-600, Hitachi, Tokyo, Japan).
PCR Analysis
Samples of ocular and duodenal tissue were processed and analyzed by PCR as previously described,2,3 with the following modifications. Two hundred microliters of vitreous from a control patient with macular pucker and from the case patient were incubated overnight at 55°C with an equal volume of proteinase K digestion buffer. These samples were then subjected to sonic-wave disruption for five minutes in sealed tubes (Sonifier Cell Disruptor, Heat Systems Ultrasonics, Plainview, N.Y.). Finally, these vitreous samples were twice quick-frozen and thawed at 95°C for two minutes. Frozen and paraffin-embedded duodenal tissues from the case patient and from a patient with nontropical sprue were processed as described previously.2 Because the combination of T. whippelii 16S rDNA primers W3FE and W2RB failed to generate a visible product with these samples, a new antisense T. whippelii 16S rDNA primer, W4RB, was designed from a variable region closer than W2RB to W3FE. W4RB (5'CGGGATCCTGTGAGTCCCCGCCATTACGC3', corresponding approximately to Escherichia coli 16S ribosomal RNA [rRNA] positions 1155 to 1133) was used in conjunction with W3FE to amplify a 98-base-pair (bp) internal portion of the T. whippelii 16S rRNA gene (total amplicon length, 154 bp). With the hot-start technique, 40 PCR cycles were performed with an annealing temperature of 63°C, 20 nM of each primer, and 2 mM of magnesium ion.
The specificity and sensitivity of primers W3FE and W4RB were tested by analyzing K562 human cell DNA, digested formalin-fixed lymph-node tissue infected with Bartonella (formerly Rochalimaea) henselae, Rhodococcus equi cells, and Dermatophilus congolensis cells. All the samples were negative with these primers. Duodenal tissues from three patients with Whipple's disease (previously shown to be positive with primers W3FE and W2RB)2 were strongly positive with W3FE and W4RB; Arthrobacter globiformis cells were weakly positive (data not shown). In serial dilutions of cloned T. whippelii 16S rDNA mixed with digested uninfected tissue, PCR reactions with primers W3FE and W4RB could detect approximately 100 16S rRNA gene copies (data not shown).
Results
Vitreous fluid obtained in November 1991 and March 1993 was found on light microscopy to contain foamy macrophages with delicate structures and clumped material that were positive on PAS staining, findings consistent with a diagnosis of Whipple's disease. In addition, bacillary structures highly suggestive of T. whippelii were detected in the 1993 sample by electron microscopy. Some of the bacilli appeared to be undergoing cell division, suggesting that they were viable at the time of vitrectomy (Figure 3Figure 3
Electron Micrograph Taken in March 1993, Revealing a Bacillary Structure in the Vitreous.).The sample of vitreous obtained in March 1993 was analyzed by PCR with oligonucleotide primers designed from variable regions of the T. whippelii 16S rRNA gene sequence. Because a previously described specific primer pair (W3FE and W2RB)2 failed to generate a visible product from these samples, a new antisense primer (W4RB) was designed, with the expectation that a smaller target would increase the sensitivity of detection. This hypothesis was confirmed (W3FE and W2RB, 10,000 targets; W3FE and W4RB, 100 targets) (data not shown). Primers W3FE and W4RB generated a visible product of the expected size (154 bp) from the patient's vitreous on several occasions (Figure 4Figure 4
PCR Detection of T. whippelii with Primers W3FEand W4RB., lane 5), but not from control vitreous (Figure 4, lane 3) or from other control samples. In addition, fresh-frozen duodenal mucosa from the case patient generated a visible PCR product of the expected size with W3FE and W4RB (Figure 4, lane 6). The histologic features of this duodenal tissue, obtained in May 1993, before antibiotic treatment, were entirely normal (data not shown). In contrast, duodenal tissue from a patient with nontropical sprue was negative by PCR (Figure 4, lane 4). The PCR products amplified from the patient's vitreous and duodenal tissue with W3FE and W4RB were cloned and sequenced. The DNA sequence of the vitreous product (98 internal nucleotide positions) was identical to the corresponding segment of the previously described T. whippelii 16S rDNA sequence (GenBank M87484). The sequence of the duodenal PCR product differed at one nucleotide position. This unpaired nucleotide position is invariant among at least 90 percent of the members of the bacterial gram-positive division, suggesting a Taq polymerase error in this cloned PCR product; however, we cannot rule out the presence of a variant strain or species.Discussion
Whipple's disease was first described in 1907 in a patient with migratory polyarthritis, cough, diarrhea with malabsorption, weight loss, and mesenteric lymphadenopathy.4 The disease most often involves the gastrointestinal tract and its lymphatic drainage, the heart, and the central nervous system. The diagnosis has been based on the finding of macrophages containing PAS-positive, diastase-resistant inclusions within the lamina propria of the small intestine. Similar PAS-positive mononuclear-cell infiltrates are found in other affected tissues, but the diagnosis of extraintestinal Whipple's disease has traditionally relied on visual demonstration of the unusual bacillus associated with the disease. This organism has never been reproducibly cultivated or purified in vitro; however, it has been identified from its 16S rDNA sequence, amplified from tissues of patients with Whipple's disease.2,5 The organism is an actinomycete for which the name T. whippelii has been proposed.
Whipple's disease with ocular involvement is rare but well described. In general, most cases of uveitis are probably not caused by T. whippelii. In his review of 696 patients with Whipple's disease,1 Dobbins found that 19 had evidence of ocular involvement. The most common ocular manifestations have included uveitis, vitritis, retinitis, and retrobulbar neuritis. In our patient, the diagnosis of ocular Whipple's disease was based on the traditional findings of a mononuclear-cell infiltrate in the vitreous composed primarily of foamy macrophages, as well as delicate intracellular and extracellular rod-like bacillary structures detected on both silver and PAS staining and by electron microscopy. The diagnosis was confirmed by PCR-based detection of T. whippelii 16S rDNA in the vitreous. A PCR-based diagnostic approach to Whipple's disease has been applied to duodenal tissue, lymph node, pleural-fluid cells, and peripheral blood.2,6-8 We have extended this application to the diagnosis of ocular disease. PCR-based methods may be useful in chronic inflammatory ocular syndromes involving fastidious microbial pathogens. In this case of Whipple's disease, PCR detection of T. whippelii suggests that ocular involvement was due to local bacterial infection rather than an immune-mediated process.9
The unique ophthalmologic features of this case of ocular Whipple's disease were the development of white corneal endothelial precipitates, iris nodules, pars plana exudation, retinal nodular precipitates, and disk neovascularization. Early or atypical presentations of extraintestinal Whipple's disease can mimic features of sarcoidosis and have led to confusion in a number of cases.10-13 The anterior-segment findings, especially iris nodules and greasy keratic precipitates, can be quite similar to those found in sarcoidosis. T. whippelii may share antigenic or structural features with other organisms that are capable of eliciting a sarcoidosis syndrome.14,15
Our patient had only scant clinical evidence of extraocular Whipple's disease. Although her weight loss, anorexia, and brief intermittent episodes of loose stools were consistent with gastrointestinal involvement, three upper endoscopies with small-bowel biopsies performed over a four-year period failed to reveal gross or microscopical evidence of Whipple's disease. Other cases of extraintestinal Whipple's disease without clinical manifestations of gastrointestinal disease have been described, especially cases involving the central nervous system.16-21 In addition, the intestinal pathologic lesions of Whipple's disease may be patchy22 or only submucosal.23 However, we know of no previous case of ocular disease in the absence of marked central nervous system and gastrointestinal manifestations.1
The role of bacterial replication and pathologic features in the pathogenesis of gastrointestinal Whipple's disease has been unclear.10 We have documented the presence of T. whippelii DNA in the duodenal mucosa of a patient with extraintestinal Whipple's disease who had no clinical, endoscopic, or histologic evidence of intestinal involvement. This finding suggests either an intestinal portal of entry for T. whippelii or strong tissue tropism; it also suggests that the presence of this organism or its DNA in the intestinal mucosa is not necessarily associated with a pathologic process. Our finding may explain some cases of malabsorption in the setting of normal histologic features.23
Whipple's disease was considered uniformly fatal until empirical trials indicated the therapeutic efficacy of systemic antibiotics.24-28 Most current recommendations include the use of antibiotics that penetrate the central nervous system.1 In patients with visual impairment, it would be prudent to use antimicrobial agents that penetrate the vitreous. Furthermore, our findings suggest that PCR may be the most sensitive indicator of persistent organisms in patients treated for this disease.
Supported by grants from the National Institutes of Health (EYO7366, to Dr. Freeman), the Lucille P. Markey Charitable Trust (to Dr. Relman), and the Stanford University Program in Molecular and Genetic Medicine Director's Research Fund (to Dr. Relman).
We are indebted to Dr. Jeffrey S. Rinkoff, Pittsburgh, for providing vitreous used as a control sample, and to Darlene J. Whitney, Stanford University, for expert assistance with electron microscopy.
Source Information
From the Division of Infectious Diseases, Epidemiology Unit, and the Department of Internal Medicine (L.S.R.), the Department of Ophthalmology (W.R.F., S.T.F.), and the Department of Pathology (V.R.), University of California, San Diego; Johns Hopkins University, Baltimore (W.R.G.); and the Departments of Medicine and Microbiology and Immunology, Stanford University, Stanford, Calif., and the Veterans Affairs Medical Center, Palo Alto, Calif. (J.S., D.A.R.).
Address reprint requests to Dr. Rickman at the University of California, San Diego, Medical Center, 200 W. Arbor Dr., San Diego, CA 92103-8951.
- References
References
1
Dobbins WO III. Whipple's disease. Springfield, Ill.: Charles C Thomas, 1987:242.
2
Relman DA ,Schmidt TM ,MacDermott RP ,Falkow S . Identification of the uncultured bacillus of Whipple's disease. N Engl J Med 1992;327:293-301
Full Text | Web of Science | Medline3
Relman DA. PCR-based detection of the uncultured bacillus of Whipple's disease. In: Persing DH, Smith TF, Tenover FC, White TJ, eds. Diagnostic molecular microbiology: principles and applications. Washington, D.C.: American Society for Microbiology, 1993:496-500.
4
Whipple GH . A hitherto undescribed disease characterized anatomically by deposits of fat and fatty acids in the intestinal and mesenteric lymphatic tissues. Bull Johns Hopkins Hosp 1907;18:382-391
Web of Science5
Wilson KH ,Blitchington R ,Frothingham R ,Wilson JA . Phylogeny of the Whipple's-disease-associated bacterium. Lancet 1991;338:474-475
CrossRef | Web of Science | Medline6
Muller C ,Stain C ,Burghuber O . Tropheryma whippelii in peripheral blood mononuclear cells and cells of pleural effusion. Lancet 1993;341:701-701
CrossRef | Web of Science | Medline7
Meier-Willersen HJ ,Maiwald M ,von Herbay A . Morbus Whipple in Assoziation mit opportunistischen Infektionen. Dtsch Med Wochenschr 1993;118:854-860
CrossRef | Web of Science | Medline8
Lowsky R ,Archer GL ,Fyles G , et al. Diagnosis of Whipple's disease by molecular analysis of peripheral blood. N Engl J Med 1994;331:1343-1346
Full Text | Web of Science | Medline9
Avila MP ,Jalkh AE ,Feldman E ,Trempe CL ,Schepens CL . Manifestations of Whipple's disease in the posterior segment of the eye. Arch Ophthalmol 1984;102:384-390
Web of Science | Medline10
Mansbach CM II ,Shelburne JD ,Stevens RD ,Dobbins WO . Lymph-node bacilliform bodies resembling those of Whipple's disease in a patient without intestinal involvement. Ann Intern Med 1978;89:64-66
Web of Science | Medline11
Cho C ,Linscheer WG ,Hirschkorn MA ,Ashutosh K . Sarcoidlike granulomas as an early manifestation of Whipple's disease. Gastroenterology 1984;87:941-947
Web of Science | Medline12
Southern JF ,Moscicki RA ,Magro C ,Dickersin GR ,Fallon JT ,Bloch KJ . Lymphedema, lymphocytic myocarditis, and sarcoidlike granulomatosis: manifestations of Whipple's disease. JAMA 1989;261:1467-1470
CrossRef | Web of Science | Medline13
Spapen HDM ,Segers O ,De Wit N , et al. Electron microscopic detection of Whipple's bacillus in sarcoidlike periodic acid-Schiff-negative granulomas. Dig Dis Sci 1989;34:640-643
CrossRef | Web of Science | Medline14
Rook GA ,Stanford JL . Slow bacterial infections or autoimmunity? Immunol Today 1992;13:160-164
CrossRef | Medline15
Relman DA . The identification of uncultured microbial pathogens. J Infect Dis 1993;168:1-8
CrossRef | Web of Science | Medline16
Kitamura T . Brain involvement in Whipple's disease. Acta Neuropathol (Berl) 1975;33:275-278
CrossRef | Web of Science | Medline17
Romanul FC ,Radvany J ,Rosales RK . Whipple's disease confined to the brain: a case studied clinically and pathologically. J Neurol Neurosurg Psychiatry 1977;40:901-909
CrossRef | Web of Science | Medline18
Feurle GE ,Volk B ,Waldherr R . Cerebral Whipple's disease with negative jejunal histology. N Engl J Med 1979;300:907-908
Full Text | Web of Science | Medline19
Pollock S ,Lewis PD ,Kendall B . Whipple's disease confined to the nervous system. J Neurol Neurosurg Psychiatry 1981;44:1104-1109
CrossRef | Web of Science | Medline20
Adams M ,Rhyner PA ,Day J ,DeArmond S ,Smuckler EA . Whipple's disease confined to the central nervous system. Ann Neurol 1987;21:104-108
CrossRef | Web of Science | Medline21
Wroe SJ ,Pires M ,Harding B ,Youl BD ,Shorvon S . Whipple's disease confined to the CNS presenting with multiple intracerebral mass lesions. J Neurol Neurosurg Psychiatry 1991;54:989-992
CrossRef | Web of Science | Medline22
Moorthy S ,Nolley G ,Hermos JA . Whipple's disease with minimal intestinal involvement. Gut 1977;18:152-155
CrossRef | Web of Science | Medline23
Kuhajda FP ,Belitsos NJ ,Keren DF ,Hutchins GM . A submucosal variant of Whipple's disease. Gastroenterology 1982;82:46-50
Web of Science | Medline24
Paulley JW . A case of Whipple's disease (intestinal lipodystrophy). Gastroenterology 1952;22:128-133
Web of Science | Medline25
Trier JS ,Phelps PC ,Eidelman S ,Rubin CE . Whipple's disease: light and electron microscope correlation of jejunal mucosal histology with antibiotic treatment and clinical status. Gastroenterology 1965;48:684-707
Web of Science | Medline26
Maizel H ,Ruffin JM ,Dobbins WO III . Whipple's disease: a review of 19 patients from one hospital and a review of the literature since 1950. Medicine (Baltimore) 1970;49:175-205
Web of Science | Medline27
Knox DL ,Bayless TM ,Pittman FE . Neurologic disease in patients with treated Whipple's disease. Medicine (Baltimore) 1976;55:467-476
Web of Science | Medline28
Keinath RD ,Merrell DE ,Vlietstra R ,Dobbins WO III . Antibiotic treatment and relapse in Whipple's disease: long-term follow-up of 88 patients. Gastroenterology 1985;88:1867-1873
Web of Science | Medline
- Citing Articles (57)
Citing Articles
1
Rebecca Stephanie Hunter, Ann-Marie Lobo. (2012) Current Diagnostic Approaches to Infectious Anterior Uveitis. International Ophthalmology Clinics 51:4, 145-156
CrossRef2
Florence Fenollar, François Nicoli, Claire Paquet, Hubert Lepidi, Patrick Cozzone, Jean-Christophe Antoine, Jean Pouget, Didier Raoult. (2011) Progressive dementia associated with ataxia or obesity in patients with Tropheryma whipplei encephalitis. BMC Infectious Diseases 11:1, 171
CrossRef3
Benoit Desnues, Khatoun Al Moussawi, Florence Fenollar. (2010) New insights into Whipple’s disease and Tropheryma whipplei infections. Microbes and Infection 12:14-15, 1102-1110
CrossRef4
Jean-Christophe Lagier, Hubert Lepidi, Didier Raoult, Florence Fenollar. (2010) Systemic Tropheryma whipplei. Medicine 89:5, 337-345
CrossRef5
Ryan A. Scheurer, Gregory S. Kosmorsky, Gary S. Hoffman, Carol Farver, Michael S. Lee, Dean M. Cestari. (2010) Can't Hear, Can't See, and Too Sore to Play. Survey of Ophthalmology 55:3, 290-296
CrossRef6
Patricia S. Conville, Frank G. Witebsky. 2010. Nocardia and other Aerobic Actinomycetes. .
CrossRef7
Andrea Lo Monaco, Marcello Govoni, Angelo Zelante, Rosa Rinaldi, Anna Rita Scorrano, Michele Di Stefano, Francesco Trotta. (2009) Whipple Disease: Unusual Presentation of a Protean and Sometimes Confusing Disease. Seminars in Arthritis and Rheumatism 38:5, 403-406
CrossRef8
X. Puéchal. (2009) Maladie de Whipple. La Revue de Médecine Interne 30:3, 233-241
CrossRef9
Peter Jackuliak, Tomas Koller, Lahim Baqi, Lukas Plank, Zora Lasabova, Gabriel Minarik, Juraj Payer. (2008) Whipple’s Disease—Generalized Stage. Digestive Diseases and Sciences 53:12, 3250-3258
CrossRef10
S. Vehr, A. Nestler, A. Schütz, U. Halm, P. Meier. (2008) Uveitis intermedia bei Morbus Whipple. Der Ophthalmologe 105:11, 1046-1051
CrossRef11
Michel Drancourt, Pierre Berger, Céline Terrada, Bahram Bodaghi, John Conrath, Didier Raoult, Phuc LeHoang. (2008) High Prevalence of Fastidious Bacteria in 1520 Cases of Uveitis of Unknown Etiology. Medicine 87:3, 167-176
CrossRef12
Thomas Schneider, Verena Moos, Christoph Loddenkemper, Thomas Marth, Florence Fenollar, Didier Raoult. (2008) Whipple's disease: new aspects of pathogenesis and treatment. The Lancet Infectious Diseases 8:3, 179-190
CrossRef13
Ángel Cosme Jiménez, Evelia Ojeda Pérez, Fernando Neira, Manuel Vaquero Pérez, Luis Bujanda Fernández de Piérola, Isabel Montalvo, Nerea Muro Carral. (2007) Hipertrofia amigdalar y adenopatías mesentéricas como manifestaciones predominantes en un paciente con enfermedad de Whipple. Gastroenterología y Hepatología 30:7, 395-398
CrossRef14
Fenollar, Florence, Puéchal, Xavier, Raoult, Didier, . (2007) Whipple's Disease. New England Journal of Medicine 356:1, 55-66
Full Text15
Maurizio Ponz Leon, Athos Borghi, Francesca Ferrara, Miranda Contri, Luca Roncucci. (2006) Whipple’s disease in a father-son pair. Internal and Emergency Medicine 1:3, 254-256
CrossRef16
Chi-Chao Chan, DeFen Shen, Jingsheng Tuo. (2006) Polymerase Chain Reaction in the Diagnosis of Uveitis. International Ophthalmology Clinics 45:2, 41-55
CrossRef17
Paul W. Brazis, Michael Stewart, Andrew G. Lee. (2004) The Uveo-Meningeal Syndromes. The Neurologist 10:4, 171-184
CrossRef18
B Bodaghi, B Wechsler, L.T.H Du-Boutin, N Cassoux, P LeHoang, J.-C Piette. (2003) Uvéites chroniques sévères : classification, démarche diagnostique et principes thérapeutiques. La Revue de Médecine Interne 24:12, 794-802
CrossRef19
RUSSELL N. VAN GELDER. (2003) CME REVIEW: POLYMERASE CHAIN REACTION DIAGNOSTICS FOR POSTERIOR SEGMENT DISEASE. RETINA 23:4, 445-452
CrossRef20
Timothy L Jackson, Susannah J Eykyn, Elizabeth M Graham, Miles R Stanford. (2003) Endogenous bacterial endophthalmitis: A 17-year prospective series and review of 267 reported cases. Survey of Ophthalmology 48:4, 403-423
CrossRef21
Romana C. Maibach, Martin Altwegg. (2003) Cloning and sequencing an unknown gene of Tropheryma whipplei and development of two LightCycler® PCR assays. Diagnostic Microbiology and Infectious Disease 46:3, 181-187
CrossRef22
Marianna Papadopoulou, Michael Rentzos, Chryssoula Nicolaou, Vassiliki Ioannidou, Anastassios Ioannidis, Stylianos Chatzipanagiotou. (2003) Cerebral Whipple???s???Disease Diagnosed Using PCR. Molecular Diagnosis 7:3, 209-211
CrossRef23
John Lynch, Timothy Lynch. 2003. Whipple's Disease. , 748-750.
CrossRef24
D.G James, M.C.I Lipman. (2002) Whipple's disease: a granulomatous masquerader. Clinics in Chest Medicine 23:2, 513-519
CrossRef25
Xavier Puéchal. (2002) Whipple’s disease. Joint Bone Spine 69:2, 133-140
CrossRef26
Mark B. Skeen. (2002) Neurologic Manifestations of Gastrointestinal Disease. Neurologic Clinics 20:1, 195-225
CrossRef27
John H. Yardley, Hubert Lepidi, Blaire L. Baisden, Didier Raoult, Pedram Argani, J. Stephen Dumler. (2002) Diagnosis of Whipple Disease by Immunohistochemical Analysis A Sensitive and Specific Method for the Detection of Tropheryma whipplei (the Whipple Bacillus) in Paraffin-Embedded Tissue. American Journal of Clinical Pathology 118:5, 742-748
CrossRef28
Silvia Morgenegg, Romana Maibach, David-Nicolas Chaperon, Kathrin Herzog, Martin Altwegg. (2001) Antibodies against recombinant heat shock protein 65 of Tropheryma whipplei in patients with and without Whipple's disease. Journal of Microbiological Methods 47:3, 299-306
CrossRef29
Russell N Van Gelder. (2001) Applications of the Polymerase Chain Reaction to Diagnosis of Ophthalmic Disease. Survey of Ophthalmology 46:3, 248-258
CrossRef30
BAHRAM BODAGHI, NATHALIE CASSOUX, BERTRAND WECHSLER, DANIELE HANNOUCHE, CHRISTINE FARDEAU, THOMAS PAPO, DU LE THI HUONG, JEAN-CHARLES PIETTE, PHUC LEHOANG. (2001) Chronic Severe Uveitis. Medicine 80:4, 263-270
CrossRef31
L. J. Strausbaugh, M. Maiwald, D. A. Relman. (2001) Whipple's Disease and Tropheryma whippelii: Secrets Slowly Revealed. Clinical Infectious Diseases 32:3, 457-463
CrossRef32
Xavier Pu??chal. (2001) Whipple disease and arthritis. Current Opinion in Rheumatology 13:1, 74-79
CrossRef33
Mark C. Flemmer, Ronald W. Flenner. (2000) Toward a new understanding of Whipple’s disease. Current Gastroenterology Reports 2:4, 299-304
CrossRef34
JAMES L. SMITH. (2000) WHIPPLE'S DISEASE: IS TROPHERYMA WHIPPELII (WHIPPLE'S BACILLUS) FOODBORNE?. Journal of Food Safety 20:2, 65-84
CrossRef35
Swartz, Morton N., . (2000) Whipple's Disease — Past, Present, and Future. New England Journal of Medicine 342:9, 648-650
Full Text36
Peter Bauerfeind, Hans-Rudolf Koelz, Martin Altwegg. (1999) PCR for Tropheryma whippelii. The Lancet 354:9188, 1476-1477
CrossRef37
Esther Gras, Xavier Matias-Guiu, Arnald Garcia, Rossmary Arg
elles, I
CrossRef38
Hans-Ulrich Ehrbar, Peter Bauerfeind, Fabrizio Dutly, Hans-Rudolf Koelz, Martin Altwegg. (1999) PCR-positive tests for Tropheryma whippelii in patients without Whipple's disease. The Lancet 353:9171, 2214
CrossRef39
J. Desmond O'Duffy, W. Leroy Griffing, Chin-Yang Li, Manal F. Abdelmalek, David H. Persing. (1999) Whipple's arthritis: Direct detection ofTropheryma whippelii in synovial fluid and tissue. Arthritis & Rheumatism 42:4, 812-817
CrossRef40
Richard A. Watts. (1999) Systemic disorders with rheumatic manifestations. Current Opinion in Rheumatology 11:1, 59-61
CrossRef41
Simo Nikkari, David A. Relman. (1999) Molecular approaches for identification of infectious agents in Wegenerʼs granulomatosis and other vasculitides. Current Opinion in Rheumatology 11:1, 11-16
CrossRef42
Bahram Bodaghi, Catherine Dauga, Nathalie Cassoux, Bertrand Wechsler, Hélène Merle-Beral, Jean-Dominique Poveda, Jean-Charles Piette, Phuc LeHoang. (1998) Whipple’s syndrome (uveitis, B27-negative spondylarthropathy, meningitis, and lymphadenopathy) associated with Arthrobacter sp. infection. Ophthalmology 105:10, 1891-1896
CrossRef43
Petro E. Petrides, Josef Muller-Hocker, David N. Fredricks, David A. Relman. (1998) PCR analysis of T. whippelii DNA in a case of whipple's disease: effect of antibiotics and correlation with histology. The American Journal of Gastroenterology 93:9, 1579-1582
CrossRef44
Mamdouh L. Nakla, Karen F. Heffler. (1998) OPHTHALMOLOGIC EFFECTS OF BOWEL DISEASE. Gastroenterology Clinics of North America 27:3, 697-711
CrossRef45
Julie K. Nishimura, Briggs E. Cook, John M. Pach. (1998) Whipple disease presenting as posterior uveitis without prominent gastrointestinal symptoms. American Journal of Ophthalmology 126:1, 130-132
CrossRef46
James S. Louie, Michael R. Liebling. (1998) THE POLYMERASE CHAIN REACTION IN INFECTIOUS AND POST-INFECTIOUS ARTHRITIS. Rheumatic Disease Clinics of North America 24:2, 227-236
CrossRef47
T. Lynch, J. Odel, D. N. Fredericks, E. D. Louis, S. Forman, H. Rotterdam, S. Fahn, D. A. Relman. (1997) Polymerase chain reaction?based detection ofTropheryma whippelii in central nervous system Whipple's disease. Annals of Neurology 42:1, 120-124
CrossRef48
DENIS VITAL DURAND, CLAIRE LECOMTE, PASCAL CATHEBRAS, HUGUES ROUSSET, PIERRE GODEAU. (1997) Whipple Disease. Medicine 76:3, 170-184
CrossRef49
Antonio Bañares, Juan A. Jover, Benjamín Fernández-Gutiérrez, Jose M. Benítez Del Castillo, Javier García, Emilio Vargas, César Hernández-García. (1997) Patterns of uveitis as a guide in making rheumatologic and immunologic diagnoses. Arthritis & Rheumatism 40:2, 358-370
CrossRef50
A. H. Rajput, J. D. McHattie. (1997) Ophthalmoplegia and leg myorhythmia in Whipple's disease: Report of a case. Movement Disorders 12:1, 111-114
CrossRef51
E. D. Louis, T. Lynch, P. Kaufmann, S. Fahn, J. Odel. (1996) Diagnostic guidelines in central nervous system Whipple's disease. Annals of Neurology 40:4, 561-568
CrossRef52
Thomas Marth, David Fredricks, Warren Strober, David A Relman. (1996) Limited role for PCR-based diagnosis of Whipple's disease from peripheral blood mononuclear cells. The Lancet 348:9019, 66-67
CrossRef53
L. Cohen, K. Berthet, C. Dauga, L. Thivart, C. Pierrot-Deseilligny. (1996) Polymerase chain reaction of cerebrospinal fluid to diagnose Whipple's disease. The Lancet 347:8997, 329
CrossRef54
Kashyap B. Kansupada, Scott M. Whitcup. (1996) Intermediate Uveitis. Seminars in Ophthalmology 11:1, 25-37
CrossRef55
Maria S. A. Suttorp-Schulten, Martine J. Jager, Aize Kijlstra. (1996) Recent Developments in the Treatment of Posterior Uveitis. Ocular Immunology and Inflammation 4:4, 207-217
CrossRef56
B Wechsler, R Fior, I Reux, N Cassou, Phuc Le Hoang, H Merle-Beral, J.M. Ziza, P Godeau. (1995) Uvéite: complication tardive d'une maladie de Whipple méconnue. La Revue de Médecine Interne 16:9, 687-690
CrossRef57
Dobbins, William O. III, . (1995) The Diagnosis of Whipple's Disease. New England Journal of Medicine 332:6, 390-392
Full Text
