Original Article
Brief Report
Twin Boys with Major Histocompatibility Complex Class II Deficiency but Inducible Immune Responses
N Engl J Med 1995; 332:86-90January 12, 1995
- Article
The major histocompatibility complex (MHC) class II molecules are composed of two polypeptide chains (α and β). In humans the three distinct isotypes are designated HLA-DR, DP, and DQ. The different isotypes serve similar functions, and their expression on cells is regulated in coordinated fashion.1 MHC class II molecules are expressed on the surface of certain cells of the immune system, such as monocytes and macrophages, B cells, and dendritic cells, where they play an important part in the immune response.2
MHC class II deficiency is an autosomal recessive disease characterized by cellular and humoral immunodeficiency.3 Family studies show that the disease locus segregates independently of the MHC class II gene loci,4 so the defect is not in the MHC class II genes themselves. A regulatory defect at the level of MHC class II gene transcription has been identified.4-7 Despite the fact that affected families have different transcription defects,7,8 phenotypic expression of the disease has been uniform in all the patients described so far. A regulatory defect in the transcription of MHC class II genes leads to the absence of messenger RNA (mRNA) and protein for all three isotypes.4,9,10 Typically, patients have hypogammaglobulinemia and severe failure to thrive in the first year of life. They have severe bacterial, fungal, and viral infections. Since the disease is associated with a high rate of early mortality, bone marrow transplantation is considered the only possible treatment.3,11
We report the case of identical twin brothers with a defect in constitutive and inducible surface expression of MHC class II molecules on B cells, monocytes, and activated T cells. Unlike previously reported patients, the two infants did not have a regulatory defect in the coordinated control of MHC class II gene transcription. Low levels of HLA-DR α-chain and β-chain protein were detected and, most surprisingly, cellular and humoral immune responses were induced in both infants after tetanus vaccination. For more than 18 months the two boys have had a benign clinical course. They appear to represent a previously unrecognized phenotype of this rare genetic disease.
Case Report
Twin brothers were born at 34 weeks of gestation to unrelated healthy parents of Turkish origin. Their HLA haplotypes were identical. Cesarean section was performed because of premature rupture of the membranes, and both infants had low birth weight (Twin 1 weighed 1020 g, and Twin 2 weighed 2030 g). At 10 weeks of age the first twin was admitted to the hospital because of febrile seizures. Cultures of blood and cerebrospinal fluid were negative. He was admitted to the hospital again at the age of four months with pneumonia confirmed by radiologic examination. Immunologic examination revealed severely decreased serum IgG levels (132 mg per deciliter), low or nearly absent serum IgA (<3 mg per deciliter), and serum IgM levels within the normal range for age (80 mg per deciliter). The distribution of lymphocyte subgroups was normal for the infant's age: CD4 cells, 43 percent (1080 per cubic millimeter); CD8 cells, 23 percent (580 per cubic millimeter); CD3 cells, 62 percent (1560 per cubic millimeter); and CD19 cells, 27 percent (680 per cubic millimeter). The lymphoproliferative responses to mitogens were also normal for age (data not shown). The expression of HLA-DR on his peripheral-blood lymphocytes, however, was <1 percent (mean [±SD] value in 14 age-matched controls, 27±6 percent). Intravenous treatment with immune globulin (400 mg per kilogram of body weight every two weeks) was begun. The infant's clinical condition was uneventful thereafter.
Twin 2 has had an uneventful clinical course from birth. Immunologic examination at the age of seven months revealed a defect of HLA-DR expression comparable to that in his brother. He had lymphocytosis (9470 lymphocytes per cubic millimeter), but the relative distribution of lymphocyte subgroups (CD4 cells, 48 percent; CD8 cells, 29 percent; CD3 cells, 75 percent; and CD19 cells, 14 percent) and the lymphoproliferative responses to mitogens (data not shown) were within the normal ranges. Serum IgG and IgA levels were normal, but the serum IgM level was low (20 mg per deciliter).
Methods
The expression of surface-membrane antigens on peripheral-blood leukocytes, T cells activated with phytohemagglutinin, and mononuclear cells incubated for 48 hours in the presence of recombinant human interferon gamma (500 IU per milliliter; Genzyme, Cambridge, Mass.) was examined by flow cytometry (FACScan, Becton Dickinson, San Jose, Calif.) with the following monoclonal antibodies used in direct two-color immunofluorescence as specified by the manufacturer (Becton Dickinson): HLA-DR (L243), CD19 (Leu-12), CD3 (Leu-4), CD14 (Leu-M3), and CD25 (interleukin-2 receptor). HLA-DR, DP, and DQ molecules were examined on B-cell lines transformed by Epstein–Barr virus by indirect immunofluorescence with the monoclonal antibodies MID3 (Sera-Lab, Crawley Down, Sussex, United Kingdom), B7/21 (Becton Dickinson), and SPVL3 (Immunotech, Marseilles, France), respectively. We measured the proliferative response of isolated peripheral-blood mononuclear cells to stimulation with antigen (10 Lf units of tetanus toxoid per milliliter; Swiss Serum and Vaccine Institute, Berne) or mitogen (pokeweed mitogen, 1:1000; GIBCO, Grand Island, N.Y.) as previously described.12
Immunoblotting of lysates of peripheral-blood mononuclear cells from the patients and a healthy control subject was performed after proteins separated by sodium dodecyl sulfate–polyacrylamide-gel electrophoresis were transferred to nitrocellulose filters. We used a pool of monoclonal antibodies against the α chain of HLA-DR (DA6.147,13 5F2.3,14 and TAL-1B515) or the monoclonal antibody CR3/43, which is specific for the HLA-DR β chain. Horseradish–peroxidase-conjugated antimouse immunoglobulin (Amersham Life Science, Amersham Little Chalfont, Buckinghamshire, United Kingdom) was used as secondary antibody, and specific binding was visualized by Western blotting (ECL kit, Amersham).
We analyzed HLA-DR mRNA in peripheral-blood mononuclear cells by the reverse-transcribed polymerase chain reaction as previously described,16 using oligonucleotide primer pairs specific for HLA-DRα (exon 1, sense ATGGCCATAAGTGGAGTCCCTGTGC; exon 4, antisense CTGCGTTCTGCTGCATTGCTTTTGCGCACTCC17) and HLA-DRβ1 (sense GTCATTTCTTCAATGGGACGGAGCG, antisense CGCCGCTGCACTGTGAAGCTCTC18). Primer pairs specific for glyceraldehyde-3-phosphate dehydrogenase (sense CCACCCATGGCAAATTCCATGGCA, antisense TCTAGACGGCAGGTCAGGTCCACC19) were included as an internal control. The products generated by the polymerase chain reaction were fractionated on 1.5 percent ethidium bromide–agarose gels, validated by their conformity to the predicted size, blotted onto Hybond-N filter membranes, and hybridized with synthetic oligonucleotides specific for HLA-DRα (exon 3, CCTCAGTTGAGGGCAGGAAGGGGAGATAGTGG17), HLA-DRβ1 (CTCCCCCACGTCGCTGTCGAAGCG18), and glyceraldehyde-3-phosphate dehydrogenase (TCTAGACGGCAGGTCAGGTCCACC19). The internal probes were labeled at the 3' end with DNA deoxynucleotidylexotransferase (Boehringer–Mannheim Biochemica, Mannheim, Germany) and [α32P]deoxyadenosine triphosphate (Amersham), and the hybridization signals were examined by autoradiography at -80°C.
Results
The most prominent immunologic abnormality in the twin brothers was undetectable constitutive or inducible surface expression of MHC class II molecules on peripheral-blood mononuclear cells. Dual-color immunofluorescence staining demonstrated a lack of HLA-DR expression on the infants' B cells, monocytes, and activated T cells (Figure 1Figure 1
Defective Surface Expression of HLA-DR on B Cells, Activated T Cells, and Monocytes.). However, the activated T cells expressed normal levels of interleukin-2 receptor (CD25) (Figure 1). Furthermore, HLA-DR expression could not be induced on the infants' monocytes or lymphocytes by interferon gamma (Figure 2Figure 2
Defective Surface Expression of MHC Class II Molecules on Peripheral-Blood Mononuclear Cells Treated with Interferon Gamma and B Cells Transformed by Epstein–Barr Virus.). In both infants, B cells transformed by Epstein–Barr virus revealed defective expression of all three MHC class II isotypes (Figure 2), whereas the surface expression of MHC class I antigens on their lymphocytes and transformed B cells was normal (data not shown).Unexpectedly, both infants had the capacity to produce specific antibodies and to develop antigen-specific T-cell reactivity after vaccination. Before the second diphtheria and tetanus vaccination, serum antibodies specific for tetanus toxoid were undetectable or at very low levels (<0.02 IU per milliliter) in both infants. After the second vaccination, substantial antibody titers developed against tetanus toxoid, which were further increased by a booster vaccination at the age of 14 months (Figure 3Figure 3
Humoral and Cellular Immune Responses after Vaccination with Tetanus Toxoid.). Even though the dosage of the IgG-substitution therapy in Twin 1 remained unchanged, antibody titers against tetanus toxoid increased significantly after the second vaccination. In addition, both infants had substantial serum levels of antibodies against diphtheria toxin after vaccination (>0.3 IU per milliliter), and antibodies against poliovirus were also detectable after vaccination with inactivated-poliovirus vaccine (titer in Twin 1, 1:31; in Twin 2, 1:20).Although no substantial antigen-specific T-cell responses could be detected after the first two diphtheria and tetanus vaccinations (administered at the ages of 3 and 8 months), levels of tetanus-toxoid–specific T-cell proliferation after the third diphtheria and tetanus vaccination (administered at the age of 14 months) were similar to those in healthy adults (Figure 3). A monoclonal antibody (9-49)20 against a determinant expressed on HLA-DR, DP, and DQ completely blocked the tetanus-toxoid–specific proliferation of lymphocytes from the two infants. The inhibitory effect was seen in the antigen-induced proliferation of T cells, whereas mitogen-induced proliferation of T cells was unaffected (Figure 3).
Immunoblotting of protein extracts from the in-fants' peripheral-blood mononuclear cells demonstrated that the cells in both infants were capable of producing HLA-DR α-chain and β-chain protein. However, substantially less protein was detected than in a healthy control subject (Figure 4AFigure 4
Immunoblotting of HLA-DRα and HLA-DRβ and Polymerase-Chain-Reaction Analysis of mRNA Expression.). In the two infants, normal expression of mRNA for the α chain of HLA-DR could be demonstrated. In contrast, only trace amounts of mRNA were detected for the HLA-DR β chain (Figure 4B).Discussion
In previously described patients with MHC class II deficiency, the lack of expression of MHC class II molecules in cell surfaces has been ascribed to a defect in transcription that affects all three class II isotypes.4,9,10 The histologically identical twin brothers we describe have an MHC class II deficiency in which trace amounts of mRNA for the HLA-DR β chain and normal levels of HLA-DRα mRNA can be found in blood cells.
The transcriptional defect in HLA-DR β-chain expression clearly accounts for the substantially decreased levels of HLA-DRβ protein. However, the levels of HLA-DRα protein were decreased as well, although the levels of HLA-DRα mRNA were normal. The likely reason for the decreased amounts of α-chain protein is accelerated degradation of free α chain in the absence of normal β-chain production. Incomplete MHC class II complexes that lack any chains are not expressed on the cell surface but are retained in the cell and degraded there.21
Previously described patients with MHC class II deficiency had no ability to present antigen on MHC class II molecules, leading to a complete lack of T-cell responses to recall antigens and severe impairment in the production of specific antibodies.3,11,22 In contrast, the two infants we describe had the capacity to mount a specific antibody response after vaccination. Substantial serum levels of antibodies to a variety of different antigens could be detected in both infants.
In addition, the infants had a normal antigen-specific T-cell response after vaccination with tetanus toxoid, and this response was completely inhibited by the addition of a monoclonal antibody specific for MHC class II. Thus, the T-cell response to recall antigen was restricted to MHC class II. Amounts of MHC class II molecules too low to be detected by flow cytometry but sufficient to induce substantial T-cell memory are probably expressed on the surface of the infants' cells. T cells are known to be very sensitive and can recognize low concentrations of a specific antigen presented on MHC class II molecules, since probably fewer than 100 peptide–MHC complexes are required to trigger T-cell activation.23,24
The expression of MHC class II molecules on thymic stromal cells is important for the maturation of CD4 T cells.25 Although the usual phenotype of MHC class II deficiency presents with decreased CD4 T cells in peripheral blood,3,11 the two infants had normal levels of CD4 cells. It appears probable that, like their antigen-presenting cells, their thymic epithelial cells express MHC class II antigens in low quantities that are nonetheless sufficient to induce the maturation of normal numbers of CD4 T cells.
We are indebted to Erich Vogel and Elfriede Schaffer for performing the flow cytometry; to Dr. C.M. Steel, Western General Hospital, Edinburgh, Scotland, for the generous gift of monoclonal antibodies DA6.147 and 5F2.3; to Dr. J.G. Bodmer, Imperial Cancer Research Fund, London, for kindly providing monoclonal antibody TAL-1B5; and to Dr. R.F. Todd III, University of Wisconsin, for kindly providing monoclonal antibody 9-49.
Source Information
From the Institute of Immunology, University of Vienna (H.M.W., I.H., H.G., V.T., H.E., M.B.F., M.M.E.), and the Pediatric Department, Wilhelminenspital of the City of Vienna (S.F.) — both in Vienna, Austria.
Address reprint requests to Dr. Eibl at the Institute of Immunology, University of Vienna, Borschkegasse 8A, A-1090 Vienna, Austria.
- References
References
1
Glimcher LH ,Kara CJ . Sequences and factors: a guide to MHC class-II transcription. Annu Rev Immunol 1992;10:13-49
CrossRef | Web of Science | Medline2
Germain RN . MHC-dependent antigen processing and peptide presentation: providing ligands for T lymphocyte activation. Cell 1994;76:287-299
CrossRef | Web of Science | Medline3
Griscelli C, Lisowska-Grospierre B, Mach B. Combined immunodeficiency with defective expression in MHC class II genes. In: Rosen FS, Seligmann M, eds. Immunodeficiencies. Chur, Switzerland: Harwood Academic Publishers, 1993:141-54.
4
de Preval C ,Lisowska-Grospierre B ,Loche M ,Griscelli C ,Mach B . A trans-acting class II regulatory gene unlinked to the MHC controls expression of HLA class II genes. Nature 1985;318:291-293
CrossRef | Web of Science | Medline5
Yang Z ,Accolla RS ,Pious D ,Zegers BJM ,Strominger JL . Two distinct genetic loci regulating class II gene expression are defective in human mutant and patient cell lines. EMBO J 1988;7:1965-1972
Web of Science | Medline6
Hume CR ,Lee JS . Congenital immunodeficiencies associated with absence of HLA class II antigens on lymphocytes result from distinct mutations in trans-acting factors. Hum Immunol 1989;26:288-309
CrossRef | Web of Science | Medline7
Benichou B ,Strominger JL . Class II-antigen-negative patient and mutant B-cell lines represent at least three, and probably four, distinct genetic defects defined by complementation analysis. Proc Natl Acad Sci U S A 1991;88:4285-4288
CrossRef | Web of Science | Medline8
Seidl C ,Saraiya C ,Osterweil Z ,Fu YP ,Lee JS . Genetic complexity of regulatory mutants defective for HLA class II gene expression. J Immunol 1992;148:1576-1584
Web of Science | Medline9
de Preval C ,Hadam MR ,Mach B . Regulation of genes for HLA class II antigens in cell lines from patients with severe combined immunodeficiency. N Engl J Med 1988;318:1295-1300
Full Text | Web of Science | Medline10
Steimle V ,Otten LA ,Zufferey M ,Mach B . Complementation cloning of an MHC class II transactivator mutated in hereditary MHC class II deficiency (or bare lymphocyte syndrome). Cell 1993;75:135-146
Web of Science | Medline11
Klein C ,Lisowska-Grospierre B ,LeDeist F ,Fischer A ,Griscelli C . Major histocompatibility complex class II deficiency: clinical manifestations, immunologic features, and outcome. J Pediatr 1993;123:921-928
CrossRef | Web of Science | Medline12
Wolf HM ,Pum M ,Jager R ,Istvan L ,Mannhalter JW ,Eibl MM . Cellular and humoral immune responses in haemophiliacs after vaccination against tick-borne encephalitis. Br J Haematol 1992;82:374-383
CrossRef | Web of Science | Medline13
Guy K ,Van Heyningen V ,Cohen BB ,Deane DL ,Steel CM . Differential expression and serologically distinct subpopulations of human Ia antigens detected with monoclonal antibodies to Ia alpha and beta chains. Eur J Immunol 1982;12:942-948
CrossRef | Web of Science | Medline14
Cohen BB ,Crichton DN ,Steel CM . A new set of monoclonal antibodies to human MHC class II α chains demonstrates that most α epitopes are inaccessible on the living cell surface. Immunology 1987;61:255-260
Web of Science | Medline15
Adams TE ,Bodmer JG ,Bodmer WF . Production and characterization of monoclonal antibodies recognizing the α-chain subunits of human Ia alloantigens. Immunology 1983;50:613-624
Web of Science | Medline16
Fischer MB ,Hauber I ,Vogel E ,Wolf HM ,Mannhalter JW ,Eibl MM . Defective interleukin-2 and interferon-γ gene expression in response to antigen in a subgroup of patients with common variable immunodeficiency. J Allergy Clin Immunol 1993;92:340-352
CrossRef | Web of Science | Medline17
Das HK ,Lawrance SK ,Weissman SM . Structure and nucleotide sequence of the heavy chain gene of HLA-DR. Proc Natl Acad Sci U S A 1983;80:3543-3547
CrossRef | Web of Science | Medline18
Baxter-Lowe LA ,Hunter JB ,Casper JT ,Gorski J . HLA gene amplification and hybridization analysis of polymorphism: HLA matching for bone marrow transplantation of a patient with HLA-deficient severe combined immunodeficiency syndrome. J Clin Invest 1989;84:613-618
CrossRef | Web of Science | Medline19
Maier JAM ,Voulalas P ,Roeder D ,Maciag T . Extension of the life-span of human endothelial cells by an interleukin-1α antisense oligomer. Science 1990;249:1570-1574
CrossRef | Web of Science | Medline20
Todd RF III ,Meuer SC ,Romain PL ,Schlossman SF . A monoclonal antibody that blocks class II histocompatibility-related immune interactions. Hum Immunol 1984;10:23-40
CrossRef | Web of Science | Medline21
Nijenhuis M ,Neefjes J . Early events in the assembly of major histocompatibility complex class II heterotrimers from their free subunits. Eur J Immunol 1994;24:247-256
CrossRef | Web of Science | Medline22
Smith CIE ,Bremard-Oury C ,Le Deist F , et al. The antibody spectrum in individuals with defect expression of HLA class II and the LFA-1 glycoprotein family genes. Clin Exp Immunol 1988;74:449-453
Web of Science | Medline23
Demotz S ,Grey HM ,Sette A . The minimal number of class II MHC-antigen complexes needed for T cell activation. Science 1990;249:1028-1030
CrossRef | Web of Science | Medline24
Harding CV ,Unanue ER . Quantitation of antigen-presenting cell MHC class II/peptide complexes necessary for T-cell stimulation. Nature 1990;346:574-576
CrossRef | Web of Science | Medline25
Hugo P ,Kappler JW ,Marrack PC . Positive selection of TcRαβ thymocytes: is cortical thymic epithelium an obligatory participant in the presentation of major histocompatibility complex protein? Immunol Rev 1993;135:133-155
CrossRef | Web of Science | Medline
- Citing Articles (14)
Citing Articles
1
Giuseppina Aloj, Giuliana Giardino, Leopoldo Valentino, Filomena Maio, Vera Gallo, Tiziana Esposito, Roberta Naddei, Emilia Cirillo, Claudio Pignata. (2012) Severe Combined Immunodeficiences: New and Old Scenarios. International Reviews of Immunology 31:1, 43-65
CrossRef2
Thomas Prod’homme, Benjamin Dekel, Giovanna Barbieri, Barbara Lisowska-Grospierre, Rina Katz, Dominique Charron, Catherine Alcaide-Loridan, Shimon Pollack. (2003) Splicing defect in RFXANK results in a moderate combined immunodeficiency and long-duration clinical course. Immunogenetics 55:8, 530-539
CrossRef3
Hagop Youssoufian, Reed E. Pyeritz. (2002) Mechanisms and consequences of somatic mosaicism in humans. Nature Reviews Genetics 3:10, 748-758
CrossRef4
JEAN VILLARD, KRZYSZTOF MASTERNAK, BARBARA LISOWSKA-GROSPIERRE, ALAIN FISCHER, WALTER REITH. (2001) MHC Class II Deficiency. Medicine 80:6, 405-418
CrossRef5
Hermann M. Wolf, Vojtech Thon, Heinz Gulle, Sonja Lechleitner, Martha M. Eibl, Peter Petzelbauer. (2001) Residual expression of functional MHC class II molecules in twin brothers with MHC class II deficiency is cell type specific. British Journal of Haematology 115:2, 460-471
CrossRef6
Walter Reith, Bernard Mach. (2001) T
HE BARE LYMPHOCYTE SYNDROME AND THE REGULATION OF MHC EXPRESSION . Annual Review of Immunology 19:1, 331-373
CrossRef7
Catherine Alcaïde-Loridan, Ana-Maria Lennon, Maria-Rosa Bono, Ridha Barbouche, Koussay Dellagi, Marc Fellous. (1999) Differential expression of MHC class II isotype chains. Microbes and Infection 1:11, 929-934
CrossRef8
Shigeaki Nonoyama, Amos Etzioni, Hano Toru, Dennis P. Ruggerie, David Lewis, Shimon Pollack, Alejandro Aruffo, Jun-Ichi Yata, Hans D. Ochs. (1998) Diminished expression of CD40 ligand may contribute to the defective humoral immunity in patients with MHC class II deficiency. European Journal of Immunology 28:2, 589-598
CrossRef9
Villard, Jean, Lisowska-Grospierre, Barbara, van den Elsen, Peter, Fischer, Alain, Reith, Walter, Mach, Bernard, . (1997) Mutation of RFXAP, a Regulator of MHC Class II Genes, in Primary MHC Class II Deficiency. New England Journal of Medicine 337:11, 748-753
Full Text10
Ilona Hauber, Hermann M. Wolf, Aysen Samstag, Barbara Pein, Thomas R. Kreil, Heinz Gulle, Michael B. Fischer, Martha M. Eibl. (1997) Inhibition of IL-10 Protein Synthesis Induces Major Histocompatibility Complex Class II Gene Expression in Class II-Deficient Patients. Cellular Immunology 180:2, 95-103
CrossRef11
R. Elhasid, A. Etzioni. (1996) Major histocompatibility complex class II deficiency: a clinical review. Blood Reviews 10:4, 242-248
CrossRef12
Hauber, Ilona, Wolf, Hermann M., Eibl, Martha M., , Wahn, Volker, . (1996) More on MHC Class II Deficiency. New England Journal of Medicine 335:13, 977-978
Full Text13
Judith G Hall. (1996) Twinning: mechanisms and genetic implications. Current Opinion in Genetics & Development 6:3, 343-347
CrossRef14
Mach, Bernard, . (1995) MHC Class II Regulation — Lessons from a Disease. New England Journal of Medicine 332:2, 120-123
Full Text
