Original Article
Association of Epstein–Barr Virus with Leiomyosarcomas in Young People with AIDS
N Engl J Med 1995; 332:12-18January 5, 1995
- Abstract
Background
Children with the acquired immunodeficiency syndrome (AIDS) have an unusually high incidence of smooth-muscle tumors (leiomyomas and leiomyosarcomas) in addition to malignant lymphomas. We tested the hypothesis that the smooth-muscle tumors in these children are associated with the Epstein–Barr virus (EBV).
Methods
Tissue specimens of five leiomyosarcomas and two leiomyomas from five children and one young man with AIDS were studied for evidence of the human immunodeficiency virus (HIV) and EBV by in situ hybridization and quantitative polymerase chain reaction (PCR). Comparison specimens included samples of leiomyosarcoma and leiomyoma from HIV-negative children. EBV clonality of leiomyosarcomas was determined by Southern blot analysis with oligonucleotide probes for EBV terminal-repeat fragments. Tumor specimens were tested by immunoperoxidase staining for infiltration by B lymphocytes and expression of the EBV receptor. Serologic testing for EBV was performed.
Results
In situ hybridization showed EBV genomes in all muscle cells of the five leiomyosarcomas and the two leiomyomas from the six HIV-infected patients. Quantitative PCR demonstrated strikingly high levels of EBV in tumor tissue, with as many as 4.3 genome copies per cell. Two colonic leiomyosarcomas obtained from different sites at different times from one patient contained different episomal EBV clones, signifying the presence of distinct monoclonal EBV-related tumors. We found biclonal EBV infection in the leiomyosarcoma of another patient. No EBV was detected in normal muscle or tumor specimens from HIV-negative patients. Immunostaining for the EBV receptor was strongly positive in six of the seven leiomyomas and leiomyosarcomas from the patients with AIDS.
Conclusions
EBV can infect smooth-muscle cells, at least in patients with AIDS, and it may contribute to the pathogenesis of leiomyomas and leiomyosarcomas in patients with AIDS. EBV seems to play no part in smooth-muscle tumors in HIV-negative patients.
Media in This Article
Figure 2
Determination of Clonality of EBV Infection.Figure 3
Southern Blot Hybridization with the EcoRI I and XhoI a Probes from the Two Ends of the Linear EBV Genome.Article Activity
- Article
Adults with the acquired immunodeficiency syndrome (AIDS) have an increased susceptibility to Kaposi's sarcoma and B-cell lymphomas, especially central nervous system lymphoma.1-3 Although the incidence of these cancers in children with AIDS has not yet reached that seen in adults, the frequent occurrence of leiomyosarcomas has been unexpected and intriguing. Leiomyosarcoma is an extremely rare tumor in children; its annual incidence is less than 2 cases per 10 million children.4 The five leiomyosarcomas and two leiomyomas in the six patients with human immunodeficiency virus (HIV) infection described in this report (three of whom have been described previously) plus the seven cases reported by others amount to a frequency much higher than expected among the approximately 5000 children with AIDS in the United States.5-10 The predilection for sarcomatous involvement of the gastrointestinal tract and lungs is striking but unexplained. An intranodal leiomyoma has been reported in one adult patient with AIDS.11 A role has been suggested for the Epstein–Barr virus (EBV) in spindle-cell sarcomas after liver transplantation.12 To test the hypothesis that EBV or HIV may be a cofactor for the soft-tissue tumors of patients with AIDS, we evaluated tumor cells by in situ hybridization and quantitative polymerase chain reaction (PCR) for the presence of HIV and EBV and the clonality of EBV.
Methods
Patients
Three children and one young man who had AIDS and leiomyosarcoma, one child with AIDS and a leiomyoma, and a sixth child with AIDS and both a leiomyosarcoma and a leiomyoma were identified from 1988 through 1993 (Table 1Table 1
Clinical Data on the Patients with Smooth-Muscle Tumors.). These six patients represent all the cases of smooth-muscle tumors reported to the Pediatric AIDS Lymphoma Network. For comparison, samples of leiomyosarcoma from three HIV-negative children were obtained from the Pediatric Oncology Group Protocol 8653, a study of soft-tissue sarcomas. These three patients were similar to the five patients with AIDS and leiomyosarcoma with regard to age, sex, and race or ethnic group. Four samples of leiomyoma from HIV-negative children, representing all the cases of leiomyoma seen at Texas Children's Hospital over a period of 40 years, also served as comparison specimens. Tumor tissue suitable for in situ hybridization was available from all patients. Samples of tumor, peripheral-blood mononuclear cells, bone marrow mononuclear cells, and plasma from the HIV-positive patients were tested for EBV and HIV by quantitative PCR. Three tumor samples from two HIV-positive patients were evaluated for EBV clonality.EBV Serologic Testing
Anti-EBV antibodies in plasma were measured by standard immunofluorescence methods.13 These assays included tests for IgG, IgM, and IgA antibodies to viral capsid antigen (VCA-IgG, VCA-IgM, and VCA-IgA, respectively); IgG antibodies to early antigens, including both the diffuse and the restricted components; and IgG antibodies to Epstein–Barr nuclear antigen (EBNA).
In Situ Hybridization
Sections of tumors were prepared on glass slides by the methods of Chang et al. and were hybridized with biotinylated oligonucleotides complementary to three regions of the EBV EBER-1 (EBER) gene or the HIV gag gene.14 The genes were detected with the Detek Hrp Signal Generating System (Enzo Diagnostics, Farmingdale, N.Y.).
Quantitative PCR
Tumor samples, peripheral-blood mononuclear cells, and bone marrow mononuclear cells were obtained from Patient 4 at the time of tumor diagnosis and from Patient 5 during the period from 0.1 to 1.1 years after diagnosis. Plasma samples obtained from Patient 4 4.6 to 1.5 years before tumor diagnosis were available. Plasma samples obtained from Patient 6 at the time of tumor diagnosis and samples of peripheral-blood mononuclear cells and plasma from Patient 7 obtained 2.4 years after diagnosis also were tested.
Mononuclear cells were collected from the peripheral-blood samples and bone marrow aspirates by Ficoll–Hypaque density-gradient centrifugation. For PCR, cell samples were lysed15 and plasma was heated at 70°C for 45 seconds.16 Tumor specimens required DNA extraction by standard methods.
PCR was performed in a total volume of 20 μl with 5 μl of sample containing 100,000 cells, 0.67 μg of tumor DNA, or 1 μl of plasma diluted in standard PCR buffer. Primers W-1 (5'GTTCGCGTTGCTAGGCCACC3') and W-2b (5'TGGCGCTCTGATGCGACCAG3'), which amplify a 140-base-pair portion of the BamHI W fragment of EBV, were used to amplify EBV.17,18 Each PCR run included a set of copy-number controls consisting of 1 to 1000 copies of a plasmid containing the amplified region and converted to linear form, diluted in a background of 100,000 lysed, uninfected H9 cells. As an internal control, primers PCO4 and GH20, which amplify a conserved β-globin sequence, were included in each reaction.19 The cycling conditions were 94°C for 3 minutes, 40 cycles at 68°C for 2 minutes and 94°C for 1 minute, and a final incubation at 68°C for 10 minutes. Hybridization was performed with EBV probe BamHI W18 and β-globin probe 19A19 labeled with γ-[32P]ATP.
To amplify HIV, primers SK38 and SK39 were used.15 A plasmid containing the HIV-1 gag region and converted to linear form was used as a copy-number control.20 The cycling conditions were identical to those used to amplify EBV, except that annealing and extension were performed at 65°C. Radiolabeled probes SK19 (HIV) and 19A (β-globin) were used for hybridization.
Radioactivity in each band was measured with a Betascope imager (Betagen, Framingham, Mass.) and quantitated with a standard curve for each PCR run. The β-globin signal was used to correct the PCR signal for EBV or HIV in cell samples to correspond to 100,000 cell genomes. An average of six repeats of the BamHI W fragment was assumed for each EBV genome.21 Appropriate dilutions were made in all instances so that the number of copies of EBV or HIV in each sample was well within the standard curve.
EBV Clonality
Sufficient DNA to permit Southern blot analysis for EBV clonality was available from a single tumor-biopsy specimen from Patient 4 and from two colon-tumor specimens obtained at different times from Patient 5. Intracellular DNA was digested with BamHI, analyzed by Southern blotting, probed with a fragment of EcoRI I located near the terminal repeat at one end of the genome, and then stripped and probed with a fragment of XhoI a located near the opposite end of the genome.22
Immunostaining for EBV Receptor and Cell Phenotype
Tissue sections were deparaffinized and immunostained23 with mouse monoclonal anti-CD21 antibodies to the human EBV receptor (CD21)24 and anti-CD20 antibodies to the human B-cell antigen (CD20) (Becton Dickinson, San Jose, Calif.) with Vectastain Elite ABC–DAB Substrate kits (Vector Laboratories, Burlingame, Calif.). Two independent observers agreed on the grade of staining in all cases.
Results
Pathological Characterization of Smooth-Muscle Tumors
On light-microscopical examination, the leiomyosarcomas had a uniformly dense cellularity. The fusiform cells of the tumors were arranged in fascicles; their hyperchromatic nuclei had up to five mitotic figures per high-power field. Muscle-specific stains for actin and desmin were uniformly positive. The leiomyomas were composed of fusiform-to-spindle-shaped cells, with few mitotic figures or none.
Immunohistochemical stains were positive for antimuscle actin and desmin in all tumors. Electron-microscopical analysis of specimens from Patients 2, 4, and 5 (not shown) showed thin intracytoplasmic filaments with focal densities, abundant micropinocytotic vesicles, thin but definite external laminae, and folded nuclei. These features further confirmed the smooth-muscle origin of the tumor cells.
EBV Serologic Testing
Plasma samples obtained at the time of tumor diagnosis were available from three HIV-positive patients and one HIV-negative patient. All four patients had evidence of past EBV infection, as indicated by the presence of VCA-IgG antibodies and the absence of VCA-IgM antibodies. VCA-IgA antibodies were found at the minimal detectable dilution (1:8) in Patient 5, who had high VCA-IgG antibody titers (1:1280). Low levels of IgG antibodies to the restricted component of early antigen were found in Patients 4 and 7; Patient 5 had a high level of IgG antibodies to the diffuse component of early antigen (1:320). Two HIV-positive patients and the HIV-negative patient had antibodies to Epstein–Barr nuclear antigen.
In Situ Hybridization
None of the tumors from the HIV-positive or HIV-negative patients had evidence of intracellular HIV infection on in situ hybridization. In contrast, the five leiomyosarcoma specimens and two leiomyoma specimens from the patients with AIDS had strong nuclear staining for EBV in essentially all tumor cells (Figure 1AFigure 1
Photomicrographs of Tumor Specimens Studied to Detect EBV.). Treatment of the tissue sections with RNase-T1 prevented hybridization of the EBER probes (data not shown). Normal smooth muscle in the HIV-positive and HIV-negative patients was uniformly negative for EBER hybridization, indicating the absence of EBV. Nor did the three leiomyosarcomas and the four leiomyomas from the HIV-negative patients have evidence of EBER on in situ hybridization (Figure 1C).Quantitative PCR
Available samples of tumor, peripheral-blood mononuclear cells, bone marrow mononuclear cells, and plasma were analyzed by quantitative PCR for HIV and EBV (Table 2Table 2
PCR Quantitation of Copies of the EBV and HIV Genomes in Samples of Tumor, Plasma, Peripheral-Blood Mononuclear Cells, and Bone Marrow Mononuclear Cells.). Strikingly high levels of EBV were found in the two initial tumor samples: 282,422 and 426,455 copies per 100,000 cells (from Patients 4 and 5, respectively). If all the tumor cells were uniformly infected with EBV (as indicated by in situ hybridization), the average number of copies of the EBV genome per cell in the two samples would be 2.8 and 4.3. The levels of EBV in serial specimens of peripheral-blood mononuclear cells (range, 0 to 436,461 copies per 100,000 cells) and plasma (range, 0 to 16,740 copies per milliliter) varied and did not show a discernible trend (Table 2).The levels of HIV in the two tumor specimens at or near the time of tumor diagnosis were almost negligible (4 and 5 copies per 100,000 cells). HIV was detectable at low levels in subsequent specimens from Patient 5 (Table 2).
EBV Clonality
EBV clonality was assessed in tumors from the two patients for whom there were adequate tissue samples (Figure 2Figure 2
Determination of Clonality of EBV Infection. and Figure 3Figure 3Southern Blot Hybridization with the EcoRI I and XhoI a Probes from the Two Ends of the Linear EBV Genome.). Identical results were obtained with the EcoRI I and the XhoI a terminal probes; there was no evidence of EBV integration into the cell genome. Both the Raji and the B95-8 cell lines showed the expected monoclonal EBV bands; replicating forms of EBV were also found in B95-8 cells. Both tumor samples from Patient 5 yielded a single band on the Southern blot assay, indicating the presence of monoclonal EBV, but the differing sizes of these terminal-repeat bands indicated that there were separate EBV infections in each tumor. The tumor from Patient 4 had EBV genomes from two clones in approximately equal proportions, a finding consistent with either dual EBV infection or the presence of mixed monoclonal infections in equal numbers.Immunostaining for EBV Receptor and Cell Phenotype
Cells in all the leiomyosarcomas and leiomyomas from the HIV-positive and HIV-negative patients were positive for the EBV receptor (CD21) on immunostaining (Table 3Table 3
Results of Tumor Immunostaining for the Pan-B-Cell Antigen (CD20) and the EBV receptor (CD21).). Six of the seven tissue samples from the HIV-positive patients were strongly positive for the EBV receptor (Figure 1B). The samples of leiomyosarcoma and leiomyoma tissue from all seven HIV-negative patients were also positive for CD21, but generally at a lower intensity than that of the tumor samples from the HIV-positive patients (Figure 1D). Normal smooth muscle and normal striated muscle had some immunostaining with the CD21 antibody. None of the muscle tissues reacted with the pan-B-cell antibody (CD20). Tonsil epithelium reacted strongly with both CD20 and CD21.Discussion
EBV has been intimately associated, though not necessarily in a causal fashion, with endemic (African) Burkitt's lymphoma, nasopharyngeal carcinoma, Hodgkin's disease, and the B-cell lymphomas that arise in organ-transplant recipients and patients with immunodeficiency disorders, including AIDS.25,26 Gastric carcinoma, which is morphologically similar to nasopharyngeal carcinoma, has also been found to harbor EBV, particularly in patients who have a prominent lymphoid infiltration in the tumor stroma.27,28 There is a single report of the presence of EBV DNA in striated muscle29; muscle-biopsy specimens from 8 of 86 patients with the postviral fatigue syndrome contained 3 to 50 copies of EBV DNA per cellular equivalent of genomic DNA, as judged by Southern blot hybridization.
We found evidence of EBV infection in five leiomyosarcomas and two leiomyomas from six HIV-infected patients, but not in smooth-muscle tumors from HIV-negative patients. All the tumors we studied, regardless of source, contained the CD21 EBV receptor. Our results support the hypothesis that EBV has an etiologic role in the soft-tissue tumors that arise in patients with AIDS. EBV may contribute to smooth-muscle tumorigenesis in other immunosuppressed states as well.12
The results of EBV serologic testing in the four patients tested were consistent with past EBV infection. There was no specific evidence of acute infection or of the characteristic profile of anti-EBV antibodies found in patients with nasopharyngeal carcinoma or Burkitt's lymphoma.13
The EBV receptor (CD21) may be a prerequisite for EBV infection of smooth-muscle cells. However, some authors suggest that cell fusion with EBV-infected lymphocytes is the route of viral entry into nonlymphoid cells.30 We found no evidence of EBER-positive cells or lymphocytic infiltrates in tissue surrounding the tumors of the HIV-positive patients. If fusion between EBV-infected lymphocytes and muscle cells had indeed occurred, it must have been at such an early stage of tumor development that we could not detect it. The EBV receptor has been identified on striated-muscle and other cells.30
We found higher levels of the EBV receptor on tumor cells from HIV-infected patients than on tumor cells from HIV-negative patients or in normal smooth muscle (Table 3). This result suggests that perturbation of the immune system in AIDS can increase production of the EBV receptor. It is also possible that EBV infection itself causes increased expression of the receptor. It is not known whether the identical EBV receptor is found on smooth-muscle cells, epithelial cells, and B lymphocytes. Both the reactivity of the smooth-muscle tumors with a monoclonal antibody that detects the receptor on B cells and the presence of EBV in the tumor strongly suggest a biologically relevant association between the EBV receptor in smooth muscle and the virus.
Adequate amounts of specimens for quantitative PCR were available from three HIV-positive patients and one HIV-negative patient. The extraordinarily high copy numbers of EBV in the muscle-tumor cells from HIV-infected patients are consistent with the results of in situ hybridization, which showed EBV in all tumor cells. Burkitt's lymphoma cells also have high copy numbers of EBV.31 High levels of free EBV were detected in the plasma of all three HIV-infected patients who were tested. The finding of 16,740 and 3973 genome copies per milliliter of plasma at the time of tumor diagnosis in Patients 4 and 6, respectively, and 6315 genome copies per milliliter of plasma six weeks after diagnosis in Patient 5 indicates the high level of EBV replication in these patients. The negligible levels of HIV in tumor cells at or near the time of diagnosis in Patients 4 and 5 (4 and 5 genome copies per 100,000 tumor cells, respectively) are also consistent with the negative results of in situ hybridization for HIV.
We cannot tell whether EBV infected the smooth-muscle cells before they were transformed into leiomyosarcomas or whether EBV is causally related to the malignant transformation of the smooth-muscle cells. The high levels of EBV are indirect evidence of a biologically relevant association between the virus and the transformation of myocytes. The presence of EBV in both a leiomyoma and leiomyosarcoma in one patient (Patient 1) suggests that EBV infection precedes malignant transformation. Another important indication that EBV infected the muscle cells before their transformation is the monoclonality of the EBV in two tumor specimens from Patient 5, obtained at different times from different sites. The most plausible explanation of this result is that the tumors arose from two different EBV-infected myocytes (Figure 1A). The biclonal EBV in the tumor from Patient 4 is consistent with either a simultaneous infection of tumor cells by two different EBV viruses (an unlikely possibility) or a tumor-cell population derived from two EBV-infected precursor cells (a likely occurrence). The nearly identical intensity of the two bands representing the terminal fragments of EBV suggests that the extent of viral proliferation was similar in each clone. The lack of EBV polyclonality in these specimens argues against infection of the myocytes after they had been transformed into leiomyosarcomas. The finding of molecularly distinct viruses in two tumors from one of these patients (Patient 5) suggests that EBV infection of smooth-muscle cells is not uncommon in young people with AIDS. Decreased immune surveillance, increased expression of the EBV receptor, and high levels of EBV in plasma may all contribute to the pathogenesis of smooth-muscle tumors in such patients.
Supported by grants (CA56296, CA55507, CA30969, and CA29139) from the National Cancer Institute.
We are indebted to Edith Hawkins, M.D., David Parkam, M.D., Kiran Belani, M.D., Larry Frankel, M.D., Bruce Camitta, M.D., and Lolie Yu, M.D., for providing histopathological review, tissue samples, and clinical data; to Jacqueline Repetski, Patricia Dunhardt, Yasmin Ench, Ming-E Wang, Patrick Kelley, and Bonnie Finley for technical assistance; and to Peggy James for assistance in the preparation of the manuscript.
Source Information
From the Department of Pediatrics, Baylor College of Medicine, Houston (K.L.M.); the Department of Pediatrics, University of Texas Health Science Center at San Antonio (C.T.L., H.B.J.); the Department of Pathology and Laboratory Medicine, East Carolina University, Greenville, N.C. (V.V.J.); the Department of Pediatrics, University of Florida College of Medicine, Gainesville (B.H.P.); Carolinas Medical Center, Charlotte, N.C. (R.T.P.); the Department of Pathology, Children's Hospital of New Jersey, Newark (F.J.D.); and the Department of Pediatrics, Northwestern University Medical School and the Children's Memorial Hospital, Chicago (E.G.C., S.B.M.).
Address reprint requests to Dr. McClain at the Texas Children's Hospital, Children's Cancer Center MC 3-3320, 6621 Fannin St., Houston, TX 77030.
- References
References
1
Safai B ,Johnson KG ,Myskowski PL , et al. The natural history of Kaposi's sarcoma in the acquired immunodeficiency syndrome. Ann Intern Med 1985;103:744-750
Web of Science | Medline2
Knowles DM ,Chamulak GA ,Subar M , et al. Lymphoid neoplasia associated with the acquired immunodeficiency syndrome (AIDS): the New York University Medical Center experience with 105 patients (1981-1986). Ann Intern Med 1988;108:744-753
Web of Science | Medline3
Karp JE ,Broder S . Acquired immunodeficiency syndrome and non-Hodgkin's lymphomas. Cancer Res 1991;51:4743-4756
Web of Science | Medline4
Lack EE . Leiomyosarcomas in childhood: a clinical and pathologic study of 10 cases. Pediatr Pathol 1986;6:181-197
CrossRef | Medline5
Chadwick EG ,Connor EJ ,Hanson IC , et al. Tumors of smooth-muscle origin in HIV-infected children. JAMA 1990;263:3182-3184
CrossRef | Web of Science | Medline6
McLoughlin LC ,Nord KS ,Joshi VV ,DiCarlo FJ ,Kane MJ . Disseminated leiomyosarcoma in a child with acquired immune deficiency syndrome. Cancer 1991;67:2618-2621
CrossRef | Web of Science | Medline7
Orlow SJ ,Kamino H ,Lawrence RL . Multiple subcutaneous leiomyosarcomas in an adolescent with AIDS. Am J Pediatr Hematol Oncol 1992;14:265-268
CrossRef | Medline8
Ross JS ,Del Rosario A ,Bui HX ,Sonbati H ,Solis O . Primary hepatic leiomyosarcoma in a child with the acquired immunodeficiency syndrome. Hum Pathol 1992;23:69-72
CrossRef | Web of Science | Medline9
Mueller B, Shad AT, Magrath IT, Horowitz ME. Malignancies in children with HIV infection. In: Pizzo PA, Wilfert CM, eds. Pediatric AIDS: the challenge of HIV infection in infants, children, and adolescents. 2nd ed. Baltimore: Williams & Wilkins, 1994:603-22.
10
van Hoeven KH ,Factor SM ,Kress Y ,Woodruff JM . Visceral myogenic tumors: a manifestation of HIV infection in children. Am J Surg Pathol 1993;17:1176-1181
CrossRef | Web of Science | Medline11
Starasoler L ,Vuitch F ,Albores-Saavedra J . Intranodal leiomyoma: another distinctive primary spindle cell neoplasm of lymph node. Am J Clin Pathol 1991;95:858-862
Web of Science | Medline12
Lee E ,Dickman PS ,Jaffe R ,Alashari M ,Tzakis A ,Reyes J . Post-transplant spindle cell tumor (PTST): an entity associated with Epstein-Barr virus. Mod Pathol 1993;6:127A-127A abstract.13
Sumaya CV, Jenson HB. Epstein-Barr virus. In: Rose NR, de Macario EC, Fahey JL, Friedman H, Penn GM, eds. Manual of clinical laboratory immunology. 4th ed. Washington, D.C.: American Society for Microbiology, 1992:568-75.
14
Chang KL ,Albujar PF ,Chen Y-Y ,Johnson RM ,Weiss LM . High prevalence of Epstein-Barr virus in the Reed-Sternberg cells of Hodgkin's disease occurring in Peru. Blood 1993;81:496-501
Web of Science | Medline15
Ou C-Y ,Kwok S ,Mitchell SW , et al. DNA amplification for direct detection of HIV-1 in DNA of peripheral blood mononuclear cells. Science 1988;239:295-297[Erratum, Science 1988;240:240.]
CrossRef | Web of Science | Medline16
Frickhofen N ,Young NS . A rapid method of sample preparation for detection of DNA viruses in human serum by polymerase chain reaction. J Virol Methods 1991;35:65-72
CrossRef | Web of Science | Medline17
Cheung A ,Kieff E . Long internal direct repeat in Epstein-Barr virus DNA. J Virol 1982;44:286-294
Web of Science | Medline18
Peiper SC ,Myers JL ,Broussard EE ,Sixbey JW . Detection of Epstein-Barr virus genomes in archival tissues by polymerase chain reaction. Arch Pathol Lab Med 1990;114:711-714
Web of Science | Medline19
Saiki RK ,Gelfand DH ,Stoffel S , et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 1988;239:487-491
CrossRef | Web of Science | Medline20
Erickson-Viitanen S ,Manfredi J ,Viitanen P , et al. Cleavage of HIV-1 gag polyprotein synthesized in vitro: sequential cleavage by the viral protease. AIDS Res Hum Retroviruses 1989;5:577-591
CrossRef | Web of Science | Medline21
Allan GJ ,Rowe DT . Size and stability of the Epstein-Barr virus major internal repeat (IR-1) in Burkitt's lymphoma and lymphoblastoid cell lines. Virology 1989;173:489-498
CrossRef | Web of Science | Medline22
Raab-Traub N ,Flynn K . The structure of the termini of the Epstein-Barr virus as a marker of clonal cellular proliferation. Cell 1986;47:883-889
CrossRef | Web of Science | Medline23
Cattoretti G ,Becker MHG ,Key G , et al. Monoclonal antibodies against recombinant parts of the Ki-67 antigen (MIB1 and MIB3) detect proliferating cells in microwave-processed formalin-fixed paraffin sections. J Pathol 1992;168:357-363
CrossRef | Web of Science | Medline24
Fingeroth JD ,Weis JJ ,Tedder TF ,Strominger JL ,Biro PA ,Fearon DT . Epstein-Barr virus receptor of human B lymphocytes is the C3d receptor CR2. Proc Natl Acad Sci U S A 1984;81:4510-4514
CrossRef | Web of Science | Medline25
Levine PH ,Blattner WA . The epidemiology of human virus-associated hematologic malignancies. Leukemia 1992;6:Suppl 3:54S-59S
Web of Science | Medline26
Gaffey MJ ,Weiss LM . Association of Epstein-Barr virus with human neoplasia. Pathol Annu 1992;27:55-74
Web of Science | Medline27
Rowlands DC ,Ito M ,Mangham DC , et al. Epstein-Barr virus and carcinomas: rare association of the virus with gastric adenocarcinomas. Br J Cancer 1993;68:1014-1019
CrossRef | Web of Science | Medline28
Nakamura S ,Ueki T ,Yao T ,Ueyama T ,Tsuneyoshi M . Epstein-Barr virus in gastric carcinoma with lymphoid stroma: special reference to its detection by the polymerase chain reaction and in situ hybridization in 99 tumors, including a morphologic analysis. Cancer 1994;73:2239-2249
CrossRef | Web of Science | Medline29
Cunningham L ,Bowles NE ,Archard LC . Persistent virus infection of muscle in postviral fatigue syndrome. Br Med Bull 1991;47:852-871
Web of Science | Medline30
Timens W ,Boes A ,Vos H ,Poppema S . Tissue distribution of the C3d/EBV-receptor: CD21 monoclonal antibodies reactive with a variety of epithelial cells, medullary thymocytes, and peripheral T-cells. Histochemistry 1991;95:605-611
CrossRef | Medline31
Delecluse H-J ,Bartnizke S ,Hammerschmidt W ,Bullerdiek J ,Bornkamm GW . Episomal and integrated copies of Epstein-Barr virus coexist in Burkitt lymphoma cell lines. J Virol 1993;67:1292-1299
Web of Science | Medline
- Citing Articles (184)
Citing Articles
1
Teboho T. Mahlobo, Andrew Grieve, Jerome A. Loveland. (2012) Pediatric multifocal myofibroblastic tumors with involvement of the gallbladder: HIV- and Epstein-Barr virus–associated smooth muscle cell tumors. Journal of Pediatric Surgery 47:2, e1-e4
CrossRef2
Zachary D. Goodman, Luigi M. Terracciano, Aileen Wee. 2012. Tumours and tumour-like lesions of the liver. , 761-851.
CrossRef3
Pratistadevi K Ramdial, Yetish Sing, Julian Deonarain, Jalaludin I Vaubell, Shaun Naicker, Clive Sydney, Larry G P Hadley, Bhugwan Singh, Erastus Kiratu, Brian Gundry, Vikash Sewram. (2011) Extra-uterine myoid tumours in patients with acquired immunodeficiency syndrome: a clinicopathological reappraisal. Histopathology 59:6, 1122-1134
CrossRef4
Komei Suzuki, Naoto Urushihara, Koji Fukumoto, Kentaro Watanabe, Naohiro Wada, Emi Takaba. (2011) A case of Epstein-Barr virus-associated pulmonary leiomyosarcoma arising five yr after a pediatric renal transplant. Pediatric Transplantation 15:7, E145-E148
CrossRef5
Vafi Salmasi, Douglas D. Reh, Ari M. Blitz, Pedram Argani, Masaru Ishii, Gary L. Gallia. (2011) Expanded endonasal endoscopic approach for resection of a skull base low-grade smooth muscle neoplasm. Child's Nervous System
CrossRef6
Gauri Kapoor, Kunal Das. (2011) Soft Tissue Sarcomas in Children. The Indian Journal of Pediatrics
CrossRef7
Michael T. Tetzlaff, Carl Nosek, Carrie L. Kovarik. (2011) Epstein-Barr virus-associated leiomyosarcoma with cutaneous involvement in an African child with human immunodeficiency virus: a case report and review of the literature. Journal of Cutaneous Pathology 38:9, 731-739
CrossRef8
Yasunori Fujimoto, Junko Hirato, Akatsuki Wakayama, Toshiki Yoshimine. (2011) Primary intracranial leiomyosarcoma in an immunocompetent patient: case report. Journal of Neuro-Oncology 103:3, 785-790
CrossRef9
Fredrik Petersson, Jingxiang Huang. (2011) Epstein-Barr Virus–Associated Smooth Muscle Tumor Mimicking Cutaneous Angioleiomyoma. The American Journal of Dermatopathology 33:4, 407-409
CrossRef10
Ronit Sarid, Shou-Jiang Gao. (2011) Viruses and human cancer: From detection to causality. Cancer Letters 305:2, 218-227
CrossRef11
Pratistadevi K Ramdial, Yetish Sing, Julian Deonarain, G P Hadley, Bhugwan Singh. (2011) Dermal Epstein Barr Virus–Associated Leiomyosarcoma: Tocsin of Acquired Immunodeficiency Syndrome in Two Children. The American Journal of Dermatopathology 33:4, 392-396
CrossRef12
Avinash K. Shetty, Yvonne A. Maldonado. 2011. Human Immunodeficiency Virus/Acquired Immunodeficiency Syndrome in the Infant. , 622-660.
CrossRef13
Seng-Choe Tham, Andrew E. Horvai, Thomas Link, Lynne Steinbach. (2011) Soft tissue mass at the infrascapular fossa. Skeletal Radiology 40:1, 123-124
CrossRef14
Bibianna Purgina, Uma N. M. Rao, Markku Miettinen, Liron Pantanowitz. (2011) AIDS-Related EBV-Associated Smooth Muscle Tumors: A Review of 64 Published Cases. Pathology Research International 2011, 1-10
CrossRef15
Bryan Corrin, Andrew G. Nicholson. 2011. Tumours. , 531-705.
CrossRef16
Jingxiang Huang, Kwok Seng Loh, Fredrik Petersson. (2010) Epstein-Barr Virus-Associated Smooth Muscle Tumor of the Larynx: Report of a Rare Case Mimicking Leiomyosarcoma. Head and Neck Pathology 4:4, 300-304
CrossRef17
Xiao Liang, Shi Xiao-Min, Xie Jiang-Ping, Yang Jie-Yu, Zhang Xiao-Jun, Fu Zhi-Ren, Ding Guo-Shan, Li Rui-Dong. (2010) Liver transplantation for primary hepatic leiomyosarcoma: a case report and review of the literatures. Medical Oncology 27:4, 1269-1272
CrossRef18
Mirco Belingheri, Patrizia Comoli, Franco Locatelli, Fausto Baldanti, Valentina Martina, Marisa Giani, Mariano Ferraresso, Lilla Cro, Alberto Edefonti, Luciana Ghio. (2010) Successful medical treatment of EBV smooth muscle tumor in a renal transplant recipient. Pediatric Transplantation 14:8, E101-E104
CrossRef19
T. Al Hussain, A Haleem, K. O. Alsaad. (2010) Synchronous hepatic, mesenteric and pulmonary Epstein-Barr virus-associated smooth muscle tumors in a renal transplant recipient. Clinical Transplantation 24:5, 579-584
CrossRef20
Peter Diak, Jeffrey Siegel, Lois La Grenade, Lauren Choi, Steven Lemery, Ann McMahon. (2010) Tumor necrosis factor α blockers and malignancy in children: Forty-eight cases reported to the food and drug administration. Arthritis & Rheumatism 62:8, 2517-2524
CrossRef21
Xiangli Yin, Taixiang Wu, Yuping Yan, Hongying Zhang, Hong Bu, Hong Bu. 2010. Treatment for leiomyosarcoma and leiomyoma in children with HIV infection. .
CrossRef22
Sweta Gupta, Peter L. Havens, James F. Southern, Selim Y. Firat, Sachin S. Jogal. (2010) Epstein-Barr Virus-associated Intracranial Leiomyosarcoma in an HIV-positive Adolescent. Journal of Pediatric Hematology/Oncology 32:4, e144-e147
CrossRef23
Martin P. Fernandez, Jennifer Krejci-Manwaring, Thomas L. Davis. (2010) Epstein-Barr virus is not associated with angioleiomyomas, or other cutaneous smooth muscle tumors in immunocompetent individuals. Journal of Cutaneous Pathology 37:4, 507-510
CrossRef24
M. Anthony Epstein, Dorothy H. Crawford. 2010. Gammaherpesviruses: Epstein-Barr Virus. .
CrossRef25
Jan Sunde, Shilpa Chetty-John, Oksana A. Shlobin, Charles R. Boice. (2010) Epstein-Barr Virus–Associated Uterine Leiomyosarcoma in an Adult Lung Transplant Patient. Obstetrics & Gynecology 115:Supplement, 434-436
CrossRef26
Andrea T. Deyrup. 2010. Smooth Muscle Tumors. , 119-130.
CrossRef27
Dimitris Zevgaridis, Christos Tsonidis, Nikiforos Kapranos, Ioannis Venizelos, Parmenion Tsitsopoulos, Philippos Tsitsopoulos. (2009) Epstein-Barr virus associated primary intracranial leiomyoma in organ transplant recipient: case report and review of the literature. Acta Neurochirurgica 151:12, 1705-1709
CrossRef28
K. Thway. (2009) Pathology of Soft Tissue Sarcomas. Clinical Oncology 21:9, 695-705
CrossRef29
Hong Yin, Ke Hu Yang, Xiang Yan, Bin Ma, Jin Hui Tian, Shao Liang Sun, Jun Li, Ruifeng Liu, Xiang Yan. 2009. Sodium ferulate for preventing the progression of diabetic kidney disease. .
CrossRef30
Xiangli Yin, Hongying Zhang, Taixiang Wu, Yuping Yan, Hong Bu, Hong Bu. 2009. Treatment for leiomyosarcoma and leiomyoma in children with HIV infection. .
CrossRef31
JASON L. HORNICK, ROBERT D. ODZE. 2009. Polyps of the Large Intestine. , 481-533.
CrossRef32
LAWRENCE M. WEISS. 2009. Soft Tissues. , 1717-1783.
CrossRef33
Ana M. Neves, Gertrude Thompson, Júlio Carvalheira, José Costa Trindade, José Rueff, Joaquim Machado Caetano, James W. Casey, Sylvie Hermouet. (2008) Detection and quantitative analysis of human herpesvirus in pilocytic astrocytoma. Brain Research 1221, 108-114
CrossRef34
Guy Lahat, Alexander Lazar, Dina Lev. (2008) Sarcoma Epidemiology and Etiology: Potential Environmental and Genetic Factors. Surgical Clinics of North America 88:3, 451-481
CrossRef35
Andrea T. Deyrup. (2008) Epstein-Barr virus–associated epithelial and mesenchymal neoplasms. Human Pathology 39:4, 473-483
CrossRef36
J. Calderaro, M. Polivka, S. Gallien, P. Bertheau, J. B. Thiebault, J. M. Molina, F. Gray. (2008) Multifocal Epstein Barr virus (EBV)-associated myopericytoma in a patient with AIDS. Neuropathology and Applied Neurobiology 34:1, 115-117
CrossRef37
Briana C. Gleason, Sara O. Vargas. (2008) Immunosuppression-Related Fibroproliferative Polyps: A Substantial Subset of Acquired Pediatric Mucocutaneous Polyps. Pediatric and Developmental Pathology 11:1, 30-34
CrossRef38
B. Sprangers, S. Smets, X. Sagaert, A. Wozniak, E. Wollants, M. Van Ranst, M. Debiec-Rychter, R. Sciot, Y. Vanrenterghem, D. R. Kuypers. (2008) Posttransplant Epstein-Barr Virus-Associated Myogenic Tumors: Case Report and Review of the Literature. American Journal of Transplantation 8:1, 253-258
CrossRef39
E C Gan, D P C Lau, K L Chuah. (2008) Epstein–Barr virus-associated smooth muscle tumour mimicking bilateral vocal process granuloma. The Journal of Laryngology & Otology 122:01,
CrossRef40
Kimberly Moore Dalal, Cristina R. Antonescu, Ronald P. DeMatteo, Robert G. Maki. (2008) EBV-Associated Smooth Muscle Neoplasms: Solid Tumors Arising in the Presence of Immunosuppression and Autoimmune Diseases. Sarcoma 2008, 1-6
CrossRef41
Supaporn Suwiwat, Jintana Pradutkanchana, Takafumi Ishida, Winyou Mitarnun. (2007) Quantitative analysis of cell-free Epstein-Barr virus DNA in the plasma of patients with peripheral T-cell and NK-cell lymphomas and peripheral T-cell proliferative diseases. Journal of Clinical Virology 40:4, 277-283
CrossRef42
Morgan McDonald, Thomas McLean, Thomas Belhorn, Scott Victor Smith, Lynn Ansley Fordham, Charles Woods, Julie Blatt. (2007) Thymic carcinoma in a child with HIV infection. Pediatric Blood & Cancer 49:7, 1004-1007
CrossRef43
S. M. Aalto, E. Juvonen, J. Tarkkanen, L. Volin, H. Haario, T. Ruutu, K. Hedman. (2007) Epstein-Barr Viral Load and Disease Prediction in a Large Cohort of Allogeneic Stem Cell Transplant Recipients. Clinical Infectious Diseases 45:10, 1305-1309
CrossRef44
S. KHUNAMORNPONG, K. SUKPAN, P. SUPRASERT, S. SHUANGSHOTI, J. PINTONG, S. SIRIAUNKGUL. (2007) Epstein-Barr virus–associated smooth muscle tumor presenting as a vulvar mass in an acquired immunodeficiency syndrome patient: a case report. International Journal of Gynecological Cancer 17:6, 1333-1337
CrossRef45
Colan Ho-Yen, Fuju Chang, Jon van der Walt, Sebastian Lucas. (2007) Gastrointestinal Malignancies in HIV-infected or Immunosuppressed Patients. Advances in Anatomic Pathology 14:6, 431-443
CrossRef46
Yin-Hua Zhu, Ye-Sheng Wei, Hong Li, Wei-Bo Liang, Bing Du, Geng-Qian Zhang, Lin Zhang. (2007) Construction and characterization of monoclonal antibodies specific for the R transactivator 185 of Epstein-Barr virus. Journal of Virological Methods 144:1-2, 12-16
CrossRef47
Samina Nur, Warren D. Rosenblum, Uma Devi Katta, Humayun Islam, Kathy Brown, Gita Ramaswamy. (2007) Epstein–Barr Virus–associated Multifocal Leiomyosarcomas Arising in a Cardiac Transplant Recipient: Autopsy Case Report and Review of the Literature. The Journal of Heart and Lung Transplantation 26:9, 944-952
CrossRef48
Sara O. Vargas, Antonio R. Perez-Atayde, Bonnie L. Padwa, Kimberley M. Springer. (2007) Immunosuppression-Related Fibroproliferative Polyps of the Tongue. Pediatric and Developmental Pathology 10:4, 256-265
CrossRef49
Alexander Chak Lam Chan, Chun Sang Li, Wah Cheuk, John Kwok Cheung Chan. (2007) Epstein–Barr virus associated leiomyosarcoma in a patient with systemic lupus erythematosus. Pathology 39:3, 358-361
CrossRef50
Srilatha Atluri, Kathleen Neville, Mary Davis, Kent A. Robertson, Francis E. Marshalleck, Dennis P. O??Malley, Rebecca H. Buckley, Robert P. Nelson. (2007) Epstein-Barr???associated Leiomyomatosis and T-cell Chimerism After Haploidentical Bone Marrow Transplantation for Severe Combined Immunodeficiency Disease. Journal of Pediatric Hematology/Oncology 29:3, 166-172
CrossRef51
V Blatière, CM De Boever, W Jacot, L Durand, B Guillot. (2007) Cutaneous malignant fibrous histiocytoma in an HIV-positive patient. Journal of the European Academy of Dermatology and Venereology 21:1, 106-107
CrossRef52
Frank Berthold, Uta Dirksen, Ulrich Gö Bel, Norbert Graf, Barbara Hero, Heribert Jü Rgens, Thomas Klingebiel, Ewa Koscielniak, Dietrich Von Schweinitz, Thorsten Simon, Regina Wieland, Johannes Wolff. 2007. Solide Tumoren. , 805-870.
CrossRef53
Jorge R. Toro, Lois B. Travis, Hongyu Julian Wu, Kangmin Zhu, Christopher D.M. Fletcher, Susan S. Devesa. (2006) Incidence patterns of soft tissue sarcomas, regardless of primary site, in the surveillance, epidemiology and end results program, 1978–2001: An analysis of 26,758 cases. International Journal of Cancer 119:12, 2922-2930
CrossRef54
Elliot Sambol, Danielle Patterson, Rafael Rivera, Dariusz Borys, M. Alba Greco, Aditya Kaul, Evan P. Nadler. (2006) An appendiceal leiomyoma in a child with acquired immunodeficiency syndrome. Pediatric Surgery International 22:10, 865-868
CrossRef55
Cabot, Richard C.Harris, Nancy Lee, Shepard, Jo-Anne O., Rosenberg, Eric S., Cort, Alice M., Ebeling, Sally H.Peters, Christine C., Scadden, David T., Muse, Victorine V., Hasserjian, Robert P., . (2006) Case 30-2006. New England Journal of Medicine 355:13, 1358-1368
Full Text56
G. Mechtersheimer, R. Penzel, W. J. Hofmann, P. Schirmacher. (2006) Primäre Sarkome und Sarkommetastasen in der Leber. Der Pathologe 27:4, 251-262
CrossRef57
Sana Yokoi, Toshihiko Iizasa, Kenzo Hiroshima, Yukio Saitoh, Takehiko Fujisawa. (2006) Pulmonary Artery Leiomyosarcoma Expressing Epstein-Barr Virus in an Immunocompetent Individual. The Annals of Thoracic Surgery 81:5, 1897-1899
CrossRef58
Miho Hatano, Hidetoshi Takada, Akihiko Nomura, Shouichi Ohga, Koichi Ohshima, Isamu Saeki, Tatsuro Tajiri, Tomoaki Taguchi, Sachiyo Suita, Toshiro Hara. (2006) Epstein-Barr virus-associated bronchial leiomyoma in a boy with cellular immunodeficiency. Pediatric Pulmonology 41:4, 371-373
CrossRef59
James F. Jones. 2006. Diseases Possibly Associated with Epstein–Barr Virus. , 335-352.
CrossRef60
Hal B. Jenson. 2006. Leiomyosarcoma. , 297-310.
CrossRef61
Richard F. Ambinder. 2006. Epstein–Barr Virus and HIV. , 175-186.
CrossRef62
J.L. Kutok, F. Wang. (2006) SPECTRUM OF EPSTEIN-BARR VIRUS–ASSOCIATED DISEASES. Annual Review of Pathology: Mechanisms of Disease 1:1, 375-404
CrossRef63
Yvonne A. Maldonado. 2006. Acquired Immunodeficiency Syndrome in the Infant. , 667-692.
CrossRef64
Apostolia-Maria Tsimberidou, Michael J. Keating, Carlos E. Bueso-Ramos, Razelle Kurzrock. (2006) Epstein-Barr virus in patients with chronic lymphocytic leukemia: A pilot study. Leukemia & Lymphoma 47:5, 827-836
CrossRef65
Andrea T Deyrup, Victor K Lee, Charles E Hill, Wah Cheuk, Han Chong Toh, Sittampalam Kesavan, Errol Wei??en Chan, Sharon W Weiss. (2006) Epstein-Barr Virus-Associated Smooth Muscle Tumors Are Distinctive Mesenchymal Tumors Reflecting Multiple Infection Events. The American Journal of Surgical Pathology 30:1, 75-82
CrossRef66
TOBY J. COLEGATE-STONE, AMRITH R. RAO, PAUL S. CALLAGHAN. (2006) Epstein-Barr virus infection in sarcomatoid renal cell carcinoma tissues. BJU International 97:1, 197-198
CrossRef67
Clark, Matthew A., Fisher, Cyril, Judson, Ian, Thomas, J. Meirion, . (2005) Soft-Tissue Sarcomas in Adults. New England Journal of Medicine 353:7, 701-711
Full Text68
C. Suankratay, S. Shuangshoti, A. Mutirangura, V. Prasanthai, S. Lerdlum, S. Shuangshoti, J. Pintong, H. Wilde. (2005) Epstein-Barr Virus Infection-Associated Smooth-Muscle Tumors in Patients with AIDS. Clinical Infectious Diseases 40:10, 1521-1528
CrossRef69
Joao Seda Neto, Camila Macedo, Ronald Jaffe, George V. Mazariegos, Rakesh Sindhi, Geoffrey J. Bond, Kareem Abu-Elmagd, Jorge Reyes. (2005) Carcinoma of donor origin after liver-intestine transplantation in a child. Pediatric Transplantation 9:2, 244-248
CrossRef70
S David Hudnall, Yimin Ge, Longxing Wei, Ning-Ping Yang, Hui-Quin Wang, Tiansheng Chen. (2005) Distribution and phenotype of Epstein–Barr virus-infected cells in human pharyngeal tonsils. Modern Pathology 18:4, 519-527
CrossRef71
Helen Kest, Susan Brogly, George McSherry, Barry Dashefsky, James Oleske, George R. Seage. (2005) Malignancy in Perinatally Human Immunodeficiency Virus-Infected Children in the United States. The Pediatric Infectious Disease Journal 24:3, 237-242
CrossRef72
Naoyuki ISOBE, Shuichi OKI, Masayuki SUMIDA, Yukari KANOU, Shinya NABIKA, Yosuke WATANABE, Yuzo HAYASHI, Yoshiro TACHIYAMA. (2005) Metastatic Leiomyosarcoma of the Brain Manifesting as Multiple Hemorrhages. Neurologia medico-chirurgica 45:1, 44-48
CrossRef73
Nana Rokutanda, Fujio Makita, Susumu Ohwada, Ichiro Sakamoto, Sumihiko Yoshimura, Nozomi Togo, Izumi Takeyoshi, Yasuo Morishita. (2005) Primary Hepatic Leiomyosarcoma with Giant Cyst Formation: A Case Report. The Kitakanto Medical Journal 55:2, 165-168
CrossRef74
Winyou Mitarnun, Vannarat Saechan, Supaporn Suwiwat, Jintana Pradutkanchana, Satomi Takao, Takafumi Ishida. (2004) Hepatic cytotoxic T-cell infiltrates in patients with peripheral T-cell proliferative diseases/lymphomas: Clinicopathological and molecular analysis. Pathology International 54:11, 819-829
CrossRef75
Yoshihiko Hoshida, Katsuyuki Aozasa. (2004) Malignancies in organ transplant recipients. Pathology International 54:9, 649-658
CrossRef76
Pailin Lerttumnongtum, Malai Muttarak, Pannee Visrutaratna, Charin Ya-in. (2004) Imaging features of unusual adrenal masses. Australasian Radiology 48:2, 107-113
CrossRef77
William H Meyer, Sheri L Spunt. (2004) Soft tissue sarcomas of childhood. Cancer Treatment Reviews 30:3, 269-280
CrossRef78
Qian Tao, Keith D Robertson. (2003) Stealth technology: how Epstein–Barr virus utilizes DNA methylation to cloak itself from immune detection. Clinical Immunology 109:1, 53-63
CrossRef79
Elizabeth Y. Chiao, Susan E. Krown. (2003) Update on non???acquired immunodeficiency syndrome???defining malignancies. Current Opinion in Oncology 15:5, 389-397
CrossRef80
Lorenzo Ferri, Rick Fraser, Louis Gaboury, David Mulder. (2003) Epstein-Barr virus-associated pulmonary leiomyosarcoma arising twenty-nine years after renal transplantation. The Journal of Thoracic and Cardiovascular Surgery 126:3, 877-879
CrossRef81
Sam M Mbulaiteye, D.Maxwell Parkin, Charles S Rabkin. (2003) Epidemiology of AIDS-related malignancies. Hematology/Oncology Clinics of North America 17:3, 673-696
CrossRef82
Richard F. Little, Robert Yarchoan. (2003) Treatment of gammaherpesvirus-related neoplastic disorders in the immunosuppressed host. Seminars in Hematology 40:2, 163-171
CrossRef83
KATHRIN MUEGGE, HOWARD YOUNG, FRANCIS RUSCETTI, JUDY MIKOVITS. (2003) Epigenetic Control during Lymphoid Development and Immune Responses. Annals of the New York Academy of Sciences 983:1, 55-70
CrossRef84
Martin Häusler, Simone Scheithauer, Klaus Ritter, Michael Kleines. (2003) Molecular diagnosis of Epstein-Barr virus. Expert Review of Molecular Diagnostics 3:1, 81-92
CrossRef85
Jaap M. Middeldorp, Antoinette A.T.P Brink, Adriaan J.C van den Brule, Chris J.L.M Meijer. (2003) Pathogenic roles for Epstein–Barr virus (EBV) gene products in EBV-associated proliferative disorders. Critical Reviews in Oncology/Hematology 45:1, 1-36
CrossRef86
Hirokazu Kanegane, Keiko Nomura, Toshio Miyawaki, Giovanna Tosato. (2002) Biological aspects of Epstein–Barr virus (EBV)-infected lymphocytes in chronic active EBV infection and associated malignancies. Critical Reviews in Oncology/Hematology 44:3, 239-249
CrossRef87
Fabiola S. Balarezo, Vijay V. Joshi. (2002) Proliferative and Neoplastic Disorders in Children With Acquired Immunodeficiency Syndrome. Advances in Anatomic Pathology 9:6, 360-370
CrossRef88
Sharon W. Weiss. (2002) Smooth Muscle Tumors of Soft Tissue. Advances in Anatomic Pathology 9:6, 351-359
CrossRef89
S. Ingen-housz-Oro, H. Bachelez, J. Mikol, M. Viguier, P. Marandas, L. Dubertret. (2002) Laryngeal leiomyosarcoma in a patient with Sezary syndrome. British Journal of Dermatology 147:4, 809-810
CrossRef90
J.Y-F. Chang, C-S. Wang, C-C. Hung, T-F. Tsai, C-H. Hsiao. (2002) Multiple Epstein-Barr virus-associated subcutaneous angioleiomyomas in a patient with acquired immunodeficiency syndrome. British Journal of Dermatology 147:3, 563-567
CrossRef91
Victor Levitsky, Maria G Masucci. (2002) Manipulation of immune responses by Epstein–Barr virus. Virus Research 88:1-2, 71-86
CrossRef92
Andre M. Oliveira, Bernd W. Scheithauer, Diva R. Salomao, Joseph E. Parisi, Peter C. Burger, Antonio G. Nascimento. (2002) Primary Sarcomas of the Brain and Spinal Cord. The American Journal of Surgical Pathology 26:8, 1056-1063
CrossRef93
Winyou Mitarnun, Supaporn Suwiwat, Jintana Pradutkanchana, Vannarat Saechan, Takafumi Ishida, Satomi Takao, Atsumi Mori. (2002) Epstein-Barr virus-associated peripheral T-Cell and NK-Cell proliferative disease/lymphoma: clinicopathologic, serologic, and molecular analysis. American Journal of Hematology 70:1, 31-38
CrossRef94
Rathi Ramakrishnan, S.A. Pradhan, Sangeeta Desai, R.F. Chinoy. (2002) Leiomyosarcoma masquerading as a thyroid mass in a 3-year-old child. Medical and Pediatric Oncology 38:2, 131-132
CrossRef95
CHARLES T. LEACH, BRAD H. POLLOCK, KENNETH L. MCCLAIN, RICHARD T. PARMLEY, SHARON B. MURPHY, HAL B. JENSON. (2002) Human herpesvirus 6 and cytomegalovirus infections in children with human immunodeficiency virus infection and cancer. The Pediatric Infectious Disease Journal 21:2, 125-132
CrossRef96
Lane F. Donnelly. 2002. Pediatric Gastrointestinal Neoplasms: Tumors of the Pediatric Gastrointestinal Tract. , 760-778.
CrossRef97
Harry L. Ioachim. 2002. Immune Deficiency: Opportunistic Tumors. , 469-485.
CrossRef98
Markku Miettinen, Leslie H. Sobin. (2001) Gastrointestinal Stromal Tumors in the Appendix. The American Journal of Surgical Pathology 25:11, 1433-1437
CrossRef99
K.H Antman. (2001) New biology and therapies in soft tissue sarcomas. Biomedicine & Pharmacotherapy 55:9-10, 553-557
CrossRef100
Bénédicte Brichard, Françoise Smets, Etienne Sokal, Philippe Clapuyt, Christiane Vermylen, Guy Cornu, Jacques Rahier, Jean Bernard Otte. (2001) Unusual evolution of an Epstein-Barr�virus-associated leiomyosarcoma occurring after liver transplantation. Pediatric Transplantation 5:5, 365-369
CrossRef101
Petri S Mattila, Sanna M Aalto, Lasse Heikkila, Severi Mattila, Markku Nieminen, Eeva Auvinen, Klaus Hedman, Jussi Tarkkanen. (2001) Malignancies after heart transplantation: presence of Epstein-Barr virus and cytomegalovirus. Clinical Transplantation 15:5, 337-342
CrossRef102
G. Bertalot, V. Villanacci, M. Gramegna, E. Orvieto, R. Negrini, A. Saleri, C. Terraroli, P. Ravelli, R. Cestari, G. Viale. (2001) Evidence of Epstein-Barr virus infection in ulcerative colitis. Digestive and Liver Disease 33:7, 551-558
CrossRef103
S.J. Mentzer, S.P. Perrine, D.V. Faller. (2001) Epstein-Barr virus post-transplant lymphoproliferative disease and virus-specific therapy: pharmacological re-activation of viral target genes with arginine butyrate. Transplant Infectious Disease 3:3, 177-185
CrossRef104
A Hiraki, N Fujii, K Masuda, K Ikeda, M Tanimoto. (2001) Genetics of Epstein-Barr virus infection. Biomedicine & Pharmacotherapy 55:7, 369-372
CrossRef105
K.L McClain. (2001) Epstein-Barr virus and HIV-AIDS-associated diseases. Biomedicine & Pharmacotherapy 55:7, 348-352
CrossRef106
M.A. Epstein. (2001) Reflections on Epstein–Barr Virus: Some Recently Resolved Old Uncertainties. Journal of Infection 43:2, 111-115
CrossRef107
M.A. Nalesnik. (2001) The diverse pathology of post-transplant lymphoproliferative disorders: the importance of a standardized approach. Transplant Infectious Disease 3:2, 88-96
CrossRef108
Gerald Niedobitek, Nadine Meru, Henri-Jacques Delecluse. (2001) Epstein-Barr virus infection and human malignancies. International Journal of Experimental Pathology 82:3, 149-170
CrossRef109
Rubin Wang, Yong-Jie Lu, Cyril Fisher, Julia A. Bridge, Janet Shipley. (2001) Characterization of chromosome aberrations associated with soft-tissue leiomyosarcomas by twenty-four-color karyotyping and comparative genomic hybridization analysis. Genes, Chromosomes and Cancer 31:1, 54-64
CrossRef110
Robert E. Cunningham, Susan L. Abbondanzo, Wei-Sing Chu, Theresa S. Emory, Leslie H. Sobin, Timothy J. O'Leary. (2001) Apoptosis, bcl-2 Expression, and p53 Expression in Gastrointestinal Stromal/Smooth Muscle Tumors. Applied Immunohistochemistry & Molecular Morphology 9:1, 19-23
CrossRef111
Emmanuel Papillon, Alain Rolachon, Alain Calender, Olivier Chabre, Rapha??lle Barnoud, Jacques Fournet. (2001) A malignant gastrointestinal stromal tumour in a patient with multiple endocrine neoplasia type 1. European Journal of Gastroenterology & Hepatology 13:2, 207-211
CrossRef112
B??n??dicte Brichard, Christiane Vermylen, Serge Gosseye, Jean Bernard Otte, Guy Cornu. (2001) Smooth Muscle Tumor Developing in an Immunocompromised Child After Therapy for Leukemia. Journal of Pediatric Hematology/Oncology 23:2, 139-141
CrossRef113
Siao Kate Ong, Shao-an Xue, Elizabeth Molyneux, Robin L. Broadhead, Eric Borgstein, M.H. Ng, Beverly E. Griffin. (2001) African Burkitt's lymphoma: a new perspective. Transactions of the Royal Society of Tropical Medicine and Hygiene 95:1, 93-96
CrossRef114
J. Kanitakis, E. Carbonnel, B. Chouvet, B. Labeille, A. Claudy. (2000) Cutaneous leiomyomas (piloleiomyomas) in adult patients with human immunodeficiency virus infection. British Journal of Dermatology 143:6, 1338-1340
CrossRef115
A W Bates, R M Feakins, I Scheimberg. (2000) Congenital gastrointestinal stromal tumour is morphologically indistinguishable from the adult form, but does not express CD117 and carries a favourable prognosis. Histopathology 37:4, 316-322
CrossRef116
Cohen, Jeffrey I., . (2000) Epstein–Barr Virus Infection. New England Journal of Medicine 343:7, 481-492
Full Text117
Ka Fai To, Fernand M. M. Lai, Angela Y. M. Wang, Chi Bon Leung, Paul C. L. Choi, Cheuk Chun Szeto, Sui Fai Lui, Alex W. Y. Yu, Philip Kam Tao Li. (2000) Posttransplant Epstein-Barr virus-associated myogenic tumors involving bone. Cancer 89:2, 467-472
CrossRef118
Hermann Rogatsch, Hugo Bonatti, Anne Menet, Clara Larcher, Hans Feichtinger, Stephan Dirnhofer. (2000) Epstein-Barr Virus-Associated Multicentric Leiomyosarcoma in an Adult Patient After Heart Transplantation. The American Journal of Surgical Pathology 24:4, 614-621
CrossRef119
Sergio Britto Garcia, Marco Novelli, Nicholas A. Wright. (2000) The clonal origin and clonal evolution of epithelial tumours. International Journal of Experimental Pathology 81:2, 89-116
CrossRef120
Joe L Hsu, Sally L Glaser. (2000) Epstein–Barr virus-associated malignancies: epidemiologic patterns and etiologic implications. Critical Reviews in Oncology/Hematology 34:1, 27-53
CrossRef121
Ann M. Ritter, Barbara H. Amaker, R. Scott Graham, William C. Broaddus, John D. Ward. (2000) Central nervous system leiomyosarcoma in patients with acquired immunodeficiency syndrome. Journal of Neurosurgery 92:4, 688-692
CrossRef122
Jean Louis Stéphan, Claire Galambrun, Simone Boucheron, F. Varlet, E. Delabesse, E. MacIntyre. (2000) Epstein-Barr Virus-Positive Undifferentiated Thymic Carcinoma in a 12-Year-Old White Girl. Journal of Pediatric Hematology/Oncology 22:2, 162-166
CrossRef123
Kenneth L. McClain, Charles T. Leach, Hal B. Jenson, Vijay V. Joshi, Brad H. Pollock, Robert E. Hutchison, Sharon B. Murphy. (2000) Molecular and Virologic Characteristics of Lymphoid Malignancies in Children With AIDS. JAIDS Journal of Acquired Immune Deficiency Syndromes 23:2, 152-159
CrossRef124
Kenneth L. McClain, Charles T. Leach, Hal B. Jenson, Vijay V. Joshi, Brad H. Pollock, Robert E. Hutchison, Sharon B. Murphy. (2000) Molecular and Virologic Characteristics of Lymphoid Malignancies in Children With AIDS. Journal of Acquired Immune Deficiency Syndromes 23:2, 152-159
CrossRef125
Richard F. Ambinder. (2000) Gammaherpesviruses and “Hit-and-Run” Oncogenesis. The American Journal of Pathology 156:1, 1-3
CrossRef126
J
rn Bullerdiek. (1999) Leiomyoma?do viruses play the main role?. Genes, Chromosomes and Cancer 26:2, 181-181
CrossRef127
W.-S. Hsieh, M.V. Lemas, R.F. Ambinder. (1999) The biology of Epstein-Barr virus in post-transplant lymphoproliferative disease. Transplant Infectious Disease 1:3, 204-212
CrossRef128
BRIGITTA U. MUELLER. (1999) HIV-Associated Malignancies in Children. AIDS Patient Care and STDs 13:9, 527-533
CrossRef129
M. Bonnet, J.-M. Guinebretiere, E. Kremmer, V. Grunewald, E. Benhamou, G. Contesso, I. Joab. (1999) Detection of Epstein-Barr Virus in Invasive Breast Cancers. JNCI Journal of the National Cancer Institute 91:16, 1376-1381
CrossRef130
Luc Y. Dirix, Allan T. Van Oosterom. (1999) Soft tissue sarcoma in adults. Current Opinion in Oncology 11:4, 285
CrossRef131
Nicolas de Saint Aubain Somerhausen, Christopher D.M. Fletcher. (1999) Leiomyosarcoma of Soft Tissue in Children. The American Journal of Surgical Pathology 23:7, 755
CrossRef132
IGNACIO I. WISTUBA, CARMEN BEHRENS, ADI F. GAZDAR. (1999) Pathogenesis of Non-AIDS-Defining Cancers: A Review. AIDS Patient Care and STDs 13:7, 415-426
CrossRef133
Asma Tulbah, Fouad Al-Dayel, Ibrahim Fawaz, Juan Rosai. (1999) Epstein-Barr Virus-Associated Leiomyosarcoma of the Thyroid in a Child With Congenital Immunodeficiency. The American Journal of Surgical Pathology 23:4, 473-476
CrossRef134
Alberto S. Papp, David M. Parham, Bhaskar N. Rao, Thom E. Lobe. (1999) Soft tissue sarcomas in children. Seminars in Surgical Oncology 16:2, 121-143
CrossRef135
Charles T. Leach, Christopher Frantz, David R. Head, Shou-Jiang Gao, Kenneth L. McClain, Maimon Cohen, Andrew B. Campbell, Brad H. Pollock, Sharon B. Murphy, Hal B. Jenson. (1999) Human herpesvirus-8 (HHV-8) associated with small non-cleaved cell lymphoma in a child with AIDS. American Journal of Hematology 60:3, 215-221
CrossRef136
A Khurshid, J T Joseph, J Rachlin, T P Cooley, J Kleefield, B J Dezube. (1999) Meningioma in four patients with human immunodeficiency virus infection.. Mayo Clinic Proceedings 74:3, 253-257
CrossRef137
Hal B. Jenson, Eduardo A. Montalvo, Kenneth L. McClain, Yasmin Ench, Patty Heard, Barbara A. Christy, Pamela J. Dewalt-Hagan, Mary Pat Moyer. (1999) Characterization of natural Epstein-Barr virus infection and replication in smooth muscle cells from a leiomyosarcoma. Journal of Medical Virology 57:1, 36-46
CrossRef138
RAMESH KRISHNAN, JOHN A. FREEMAN, ANDREW J. CREAGER. (1999) EPSTEIN-BARR VIRUS INDUCED RENAL LEIOMYOMA. The Journal of Urology212
CrossRef139
RAMESH KRISHNAN, JOHN A. FREEMAN, ANDREW J. CREAGER. (1999) EPSTEIN-BARR VIRUS INDUCED RENAL LEIOMYOMA. The Journal of Urology 161:1, 212
CrossRef140
Sergio Britto Garcia, Hyun Sook Park, Marco Novelli, Nicholas A. Wright. (1999) Field cancerization, clonality, and epithelial stem cells: the spread of mutated clones in epithelial sheets. The Journal of Pathology 187:1, 61-81
CrossRef141
Ghassan K. Bejjani, Bernard Stopak, Arnold Schwartz, Rita Santi. (1999) Primary Dural Leiomyosarcoma in a Patient Infected with Human Immunodeficiency Virus: Case Report. Neurosurgery 44:1, 199-202
CrossRef142
Gino R. Somers, Andrea A. Tesoriero, Elizabeth Hartland, Colin F. Robertson, Philip J. Robinson, Deon J. Venter, C. W. Chow. (1998) Multiple Leiomyosarcomas of Both Donor and Recipient Origin Arising in a Heart-Lung Transplant Patient. The American Journal of Surgical Pathology 22:11, 1423-1428
CrossRef143
Agostino Bazzichi, Francesco Vigna Guidi, Laura Rindi, Marina Incaprera, Carlo Garzelli. (1998) PCR ELISA for the quantitative detection of Epstein–Barr virus genome. Journal of Virological Methods 74:1, 15-20
CrossRef144
Javier Anguita, Mar??a-Luisa Rico, Jes??s Palomo, Patricia Mu??oz, Victoria Preciado, Javier Men??rguez. (1998) MYOCARDIAL EPSTEIN-BARR VIRUS-ASSOCIATED CARDIAC SMOOTH-MUSCLE NEOPLASM ARISING IN A CARDIAC TRANSPLANT RECIPIENT1. Transplantation 66:3, 400-401
CrossRef145
James J Goedert, Timothy R Coté, Phillip Virgo, Steven M Scoppa, Douglas W Kingma, Mitchell H Gail, Elaine S Jaffe, Robert J Biggar. (1998) Spectrum of AIDS-associated malignant disorders. The Lancet 351:9119, 1833-1839
CrossRef146
T COOK, S FOSKO. (1998) Unusual cutaneous malignancies. Seminars in Cutaneous Medicine and Surgery 17:2, 114-132
CrossRef147
Bette K Kleinschmidt-Demasters, Gary W Mierau, Chun-I Sze, Robert E Breeze, Brian Greffe, Kevin O Lillehei, Janet K Stephens. (1998) Unusual dural and skull-based mesenchymal neoplasms: A report of four cases. Human Pathology 29:3, 240-245
CrossRef148
TUULA LEHTINEN, MATTI LEHTINEN. (1998) Common and emerging infectious causes of hematological malignancies in the young. APMIS 106:1-6, 585-597
CrossRef149
M Okano. (1998) Epstein-Barr virus infection and its role in the expanding spectrum of human diseases. Acta Paediatrica 87:1, 11-18
CrossRef150
Jeffrey M. Bluhm, Eunhee S. Yi, Gonzalo Diaz, Thomas V. Colby, Henri G. Colt. (1997) Multicentric endobronchial smooth muscle tumors associated with the epstein-barr virus in an adult patient with the acquired immunodeficiency syndrome. Cancer 80:10, 1910-1913
CrossRef151
Jean-Pierre de Chadarévian, John H. Wolk, Susan Inniss, Harold W. Lischner, Francesco d'Amore, Eric N. Faerber, Glenn C. Isaacson. (1997) A newly recognized cause of wheezing: AIDS-related bronchial leiomyomas. Pediatric Pulmonology 24:2, 106-110
CrossRef152
Patrick Widrick, Ann Boguniewicz, Tipu NAZEER, SCOTC. Remick. (1997) Breast Cancer in a Man With Human Immunodeficiency Virus Infection. Mayo Clinic Proceedings 72:8, 761-764
CrossRef153
Wendy Trzyna, Mary McHugh, Peter McCue, Kirk M. McHugh. (1997) Molecular determination of the malignant potential of smooth muscle neoplasms. Cancer 80:2, 211-217
CrossRef154
Michael A. Hill, Juan C. Araya, Michelle W. Eckert, A. Tod Gillespie, Jay D. Hunt, Edward A. Levine. (1997) Tumor specific Epstein-Barr virus infection is not associated with leiomyosarcoma in human immunodeficiency virus negative individuals. Cancer 80:2, 204-210
CrossRef155
Ignacio Yanguas, Jaime Goday, Magdalena González-Giiemes, Matías Lozano, Ricardo Soloeta. (1997) Cutaneous Leiomyosarcoma in a Child. Pediatric Dermatology 14:4, 281-283
CrossRef156
Frederic Clayton, Carol H. Clayton. (1997) GASTROINTESTINAL PATHOLOGY IN HIV-INFECTED PATIENTS. Gastroenterology Clinics of North America 26:2, 191-240
CrossRef157
GERALD NIEDOBITEK, ANGELO AGATHANGGELOU, HERMANN HERBST, LUCIE WHITEHEAD, DENNIS H. WRIGHT, LAWRENCE S. YOUNG. (1997) EPSTEIN-BARR VIRUS (EBV) INFECTION IN INFECTIOUS MONONUCLEOSIS: VIRUS LATENCY, REPLICATION AND PHENOTYPE OF EBV-INFECTED CELLS. The Journal of Pathology 182:2, 151-159
CrossRef158
SooHo Choi, Michael L. Levy, Mark D. Krieger, J. Gordon McComb. (1997) Spinal Extradural Leiomyoma in a Pediatric Patient with Acquired Immunodeficiency Syndrome: Case Report. Neurosurgery 40:5, 1080-1082
CrossRef159
Susan Morgello, Angeliki Kotsianti, Jeffrey P. Gumprecht, Frank Moore. (1997) Epstein—Barr virus—associated dural leiomyosarcoma in a man infected with human immunodeficiency virus. Journal of Neurosurgery 86:5, 883-887
CrossRef160
Kerstin I. Falk, Jie-Zhi Zou, Erik Lucht, Annika Linde, Ingemar Ernberg. (1997) Direct identification by PCR of EBV types and variants in clinical samples. Journal of Medical Virology 51:4, 355-363
CrossRef161
REN-DE ZHANG, MINGXU GUAN, YOUNG PARK, RICK TAWADROS, JYH-YUAN YANG, BERT GOLD, BRIAN WU, EARL E. HENDERSON. (1997) Synergy between Human Immunodeficiency Virus Type 1 and Epstein-Barr Virus in T Lymphoblastoid Cell Lines. AIDS Research and Human Retroviruses 13:2, 161-171
CrossRef162
Gary W. Mierau, Brian S. Greffe, Douglas A. Weeks. (1997) Primary Leiomyosarcoma of Brain in an Adolescent with Common Variable Immunodeficiency Syndrome. Ultrastructural Pathology 21:3, 301-305
CrossRef163
D. W. Kingma, A. Shad, M. Tsokos, T. Fest, T. Otsuki, K. Frekko, E. Werner, A. Werner, I. Magrath, M. Raffeld, E. S. Jaffe. (1996) Epstein-Barr Virus (EBV)-associated Smooth-muscle Tumor Arising in a Post-transplant Patient Treated Successfully for Two PT-EBV-associated Large-cell Lymphomas. The American Journal of Surgical Pathology 20:12, 1511-1519
CrossRef164
Tony W.H. Shek, E. Y.F. Leung, Ivy S.C. Luk, Florence Loong, Alexander C.L. Chan, Y. H. Yik, L. K. Lam. (1996) Lymphoepithelioma-like Carcinoma of the Skin. The American Journal of Dermatopathology 18:6, 637-644
CrossRef165
Michael R. Bye. (1996) HIV IN CHILDREN. Clinics in Chest Medicine 17:4, 787-796
CrossRef166
Joseph G Sinkovics. (1996) Contradictory concepts in the etiology and regression of kaposi’s sarcoma. Pathology & Oncology Research 2:4, 249-267
CrossRef167
Jenson, Hal B., Leach, Charles T., Montalvo, Eduardo A., , Lin, Jung-Chung, , Murphy, Sharon B., . (1996) Absence of Herpesvirus in AIDS-Associated Smooth-Muscle Tumors. New England Journal of Medicine 335:22, 1690-1690
Full Text168
Brigitte Le Bail, Delphine Morel, Patrick Mérel, François Comeau, Jean-Philippe Merlio, Jacques Carles, Hervé Trillaud, Paulette Bioulac-Sage. (1996) Cystic Smooth-muscle Tumor of the Liver and Spleen Associated with Epstein-Barr Virus after Renal Transplantation. The American Journal of Surgical Pathology 20:11, 1418-1425
CrossRef169
Scot C. Remick. (1996) NON–AIDS-DEFINING CANCERS. Hematology/Oncology Clinics of North America 10:5, 1203-1213
CrossRef170
Kenneth L. McClain, Vijay V. Joshi, Sharon B. Murphy. (1996) CANCERS IN CHILDREN WITH HIV INFECTION. Hematology/Oncology Clinics of North America 10:5, 1189-1201
CrossRef171
Yoshito Sadahira, Takuya Moriya, Teruo Shirabe, Tsuyoshi Matsuno, Toshiaki Manabe. (1996) Epstein-Barr virus-associated post-transplant primary smooth muscle tumor of the liver: Report of an autopsy case. Pathology International 46:8, 601-604
CrossRef172
Tony W.H Shek, I.S.C Luk, Irene O.L Ng, C.Y Lo. (1996) Lymphoepithelioma-like carcinoma of the thyroid gland: Lack of evidence of association with Epstein-Barr virus. Human Pathology 27:8, 851-853
CrossRef173
Bayardo Perez-Ordonez, Robert A. Erlandson, Juan Rosai. (1996) Follicular Dendritic Cell Tumor. The American Journal of Surgical Pathology 20:8, 944-955
CrossRef174
Jean-Gabriel Judde, Gordon Spangler, Ian Magrath, Kishor Bhatia. (1996) Use of Epstein-Barr Virus Nuclear Antigen-1 in Targeted Therapy of EBV-Associated Neoplasia. Human Gene Therapy 7:5, 647-653
CrossRef175
Andrew M. Davidoff, Andre Hebra, Bernard J. Clark, John E. Tomaszewski, Kathleen T. Montone, Eduardo Ruchelli, Henry T. Lau. (1996) EPSTEIN-BARR VIRUS-ASSOCIATED HEPATIC SMOOTH MUSCLE NEOPLASM IN A CARDIAC TRANSPLANT RECIPIENT. Transplantation 61:3, 515-517
CrossRef176
Tsung-teh Wu, Steven H Swerdlow, Joseph Locker, David Bahler, Parmjeet Randhawa, Eduardo J Yunis, Paul S Dickman, Michael A Nalesnik. (1996) Recurrent Epstein-Barr virus-associated lesions in organ transplant recipients. Human Pathology 27:2, 157-164
CrossRef177
Richard Longnecker, Cheryl L. Miller. (1996) Regulation of Epstein—Barr virus latency by latent membrane protein 2. Trends in Microbiology 4:1, 39-42
CrossRef178
Israel Penn. (1996) Posttransplantation de novo tumors in liver allograft recipients. Liver Transplantation and Surgery 2:1, 52-59
CrossRef179
Suk-King Wan, John K. C. Chan, Wai-Hon Lau, Timothy T. C. Yip. (1995) Basaloid-squamous carcinoma of the nasopharynx. An epstein–barr virus–associated neoplasm compared with morphologically identical tumors occurring in other sites. Cancer 76:10, 1689-1693
CrossRef180
Charles F. Timmons, D. Brian Dawson, C. Sue Richards, Walter S. Andrews, Julie A. Katz. (1995) Epstein–Barr virus–associated leiomyosarcomas in liver transplantation recipients. Origin from either donor or recipient tissue. Cancer 76:8, 1481-1489
CrossRef181
Daniel A Arber, Onsi W Kamel, Matt van de Rijn, R.Eric Davis, L.Jeffrey Medeiros, Elaine S Jaffe, Lawrence M Weiss. (1995) Frequent presence of the epstein-barr virus in inflammatory pseudotumor. Human Pathology 26:10, 1093-1098
CrossRef182
van Gelder, T., Vuzevski, V.D., Weimar, W., . (1995) Epstein–Barr Virus in Smooth-Muscle Tumors. New England Journal of Medicine 332:25, 1719-1719
Full Text183
Liebowitz, David, . (1995) Epstein–Barr Virus — An Old Dog with New Tricks. New England Journal of Medicine 332:1, 55-57
Full Text184
Jose A. Jimenez-Heffernan, David Hardisson, Jose Palacios, Manuel Garcia-Viera, Carlos Gamallo, Manuel Nistal. (1995) Adrenal Gland Leiomyoma in a Child with Acquired Immunodeficiency Syndrome. Fetal & Pediatric Pathology 15:6, 923-929
CrossRef
- Letters
