Original Article
Hepatitis C Infection in Patients with Primary Hypogammaglobulinemia after Treatment with Contaminated Immune Globulin
N Engl J Med 1994; 331:1607-1611December 15, 1994
- Abstract
Background
In Scandinavia many patients with primary hypogammaglobulinemia contracted non-A, non-B hepatitis after intravenous treatment with an immune globulin product that was later found to contain a non-A, non-B hepatitis virus.
Methods
We studied the prevalence and clinical course of hepatitis C virus (HCV) infection in a group of 55 Norwegian patients with primary hypogammaglobulinemia and investigated its association with the use of contaminated immune globulin. We used the polymerase chain reaction to detect HCV RNA and performed HCV genotyping. We also analyzed the responses to treatment with interferon.
Results
Of 20 patients who received the contaminated immune globulin, 17 were seropositive for HCV RNA. In addition, 1 of 35 patients not exposed to the contaminated immune globulin was HCV RNA-positive. HCV genotype V was found in all 12 patients for whom genotyping was performed, but 8 patients also had genotype II or III, or both. All HCV RNA-positive patients had abnormal results on biochemical liver tests. All liver-biopsy specimens (from 15 patients) were abnormal, with portal inflammation, bile-duct damage, and focal necrosis. In six patients there was cirrhosis. Two patients died of liver failure. In 4 of the 10 patients treated with interferon there were complete, though transient, biochemical responses, but the follow-up biopsy specimens showed evidence of histologic progression. The poorest responses to interferon were among the patients with multiple HCV genotypes. All but one patient remained positive for HCV RNA.
Conclusions
In patients with primary hypogammaglobulinemia there was a high rate of HCV infection after treatment with contaminated immune globulin. In these immunocompromised patients HCV infection has a severe and rapidly progressive course, and responses to interferon are poor.
Media in This Article
Table 1
Clinical Findings in 18 HCV RNA-Positive Patients with Primary Hypogammaglobulinemia.Table 2
HCV Genotypes of 14 Patients and Results of Treatment in Patients Receiving Interferon.Article Activity
- Article
Non-A, non-B hepatitis has been reported after substitution therapy with immune globulin in several patients with primary hypogammaglobulinemia1-6. In Scandinavia, one intravenous immune globulin product in particular (Gammonativ, KabiVitrum, Stockholm, Sweden) has been associated with the occurrence of non-A, non-B hepatitis5. The clinical importance of non-A, non-B hepatitis in patients with hypogammaglobulinemia is not well defined, but the impression is that the disease may progress more rapidly than it does in otherwise healthy patients5,7.
Most patients with transfusion-associated non-A, non-B hepatitis are infected with the hepatitis C virus (HCV)8. To establish a diagnosis of HCV infection in patients with primary hypogammaglobulinemia, detection of HCV RNA by the polymerase chain reaction (PCR) is mandatory, because one cannot rely on antibody tests in such patients. We report on the prevalence and clinical course of chronic HCV infection in patients with primary hypogammaglobulinemia, as well as on our experience with interferon as treatment for this infection.
Methods
Fifty-five Norwegian patients with primary hypogammaglobulinemia from whom at least one serum sample was available were included in the study. The diagnosis of primary hypogammaglobulinemia was based on established criteria9,10. The patients' diseases were classified clinically as described elsewhere11: 7 patients had X-linked agammaglobulinemia, 31 patients had common variable immunodeficiency, and 15 patients had congenital hypogammaglobulinemia. Two patients had the hyper-IgM syndrome, with very low levels of IgG and IgA. All 55 patients had severe hypogammaglobulinemia, with IgG levels below 2.0 g per liter before IgG substitution therapy. The median age of the patients was 35 years (range, 17 to 76); there were 34 male patients and 21 female patients.
We took histories of immune globulin substitution, tested for possible liver disease, and obtained the results of relevant radiologic investigations. Liver biochemical tests, including measurements of alanine aminotransferase, alkaline phosphatase, γ-glutamyltransferase, bilirubin, and albumin, were performed regularly. Isoenzymes of alkaline phosphatase were analyzed in selected patients. To be classified as having chronic liver disease, a patient had to have serum alanine aminotransferase levels more than twice the upper reference limit in at least three measurements over a period of more than six months.
History of Immune Globulin Substitution Therapy
The majority of the 55 patients had received standard immune globulin intramuscularly for several years before receiving immune globulin intravenously. During the period from 1982 to 1986, 20 of the patients received the intravenous immune globulin preparation (Gammonativ) that has been shown to have been contaminated with a non-A, non-B hepatitis virus12. This product was an albumin-stabilized preparation of immune globulin derived from both U.S. and European plasma sources5 and prepared as follows: after fractionation in cold ethanol with 25 percent ethyl alcohol, the fraction II paste was dissolved and treated with diethylaminoethyl-Sephadex, stabilized with glycine, albumin, and glucose, and lyophilized. Cold-ethanol fractionation does not remove all HCV RNA from the fraction II used to prepare immune globulin13. Only plasma from patients negative for hepatitis B surface antigen was used.
After the contaminated immune globulin preparation was withdrawn from the market, most of our patients received intravenous treatment with two other immune globulins, neither of which has been associated with non-A, non-B hepatitis. For the past four to five years, most of our patients have been treated with subcutaneous infusions of standard immune globulin.
Virologic Investigation
The most recent serum sample available from each patient was assayed for HCV RNA by PCR. For patients being treated with interferon, the most recent serum sample obtained before interferon therapy was assayed. Serial serum samples were studied in selected patients in order to establish HCV RNA status longitudinally. In the case of patients exposed to the contaminated immune globulin product who were negative for HCV RNA in 1992 and 1993, previous serum samples were also assayed. In addition, all patients were examined for anti-HCV by a second-generation enzyme immunoassay (Abbott Diagnostika, Wiesbaden, Germany). Supplementary testing was performed with an assay (HCV Riba 3.0 SIA, Chiron, Emeryville, Calif.) that detects antibodies against antigens derived from putative nonstructural regions of the virus (recombinant antigens c33-c and NS5 and synthetic peptides c100-p and 5-1-1p) and against synthetic peptide c22-p, corresponding to the putative nucleocapsid viral protein. Serum samples from all patients were also examined for hepatitis B surface antigen (Ausria II-125, Abbott Laboratories Diagnostics Division, North Chicago, Ill.).
HCV RNA Detection and Genotyping
Serum samples were stored at -70 °C. RNA was extracted from 200 microliters of serum with a modified acid guanidinium thiocyanate-phenol-chloroform method, as described elsewhere,14-16 frozen immediately, and kept at -20 °C until use.
The primers for complementary DNA (cDNA) synthesis and the nested PCR were from the conserved 5' noncoding region of the HCV genome17. The sequences are 5'CGTTAGTATGAGTGTCGTGC3' (PT1, outer sense), 5'CGGTGTACTCACCGGTTCC3' (PT2, outer antisense), 5'AGTGTCGTGCAGCCTCCAGG3' (PT3, inner sense), and 5'CGGTTCCGCAGACCACTATG3' (PT4, inner antisense). RNA was reversibly translated into cDNA at 37 °C for 60 minutes in a 20-microliter reaction mixture according to a protocol described elsewhere15. Eighty-eight picomoles of the outer antisense primer was used. After inactivation of the reverse transcriptase (M-Mulv, Pharmacia, Freiburg, Germany) at 95 °C for five minutes, 50 pmol of outer sense primer was added to the cDNA and 1 unit of Amplitaq DNA polymerase (Perkin-Elmer Cetus, Norwalk, Conn.) in a volume of 80 microliters containing 50 mmol of potassium chloride, 10 mmol of TRIS-hydrochloric acid (pH 8.3), and 1.5 mmol of magnesium dichloride per liter of solution. The PCR was performed in a TempCycler (Coy, Ann Arbor, Mich.). The first reaction was run with 25 cycles of 1 minute at 95 °C, 1 minute at 45 °C, and 1 minute 40 seconds at 72 °C, with a final elongation step of 5 minutes at 72 °C.
The second PCR was performed in a 100-microliter reaction mixture according to the protocol described elsewhere,15 with 2 microliters of the first reaction product and 50 pmol each of the inner sense and inner antisense primers. The second reaction was similar to the first, but with annealing at 55 °C instead of 45 °C. The PCR products from the second round were visualized under ultraviolet light after electrophoresis in 2.5 percent agarose gel with 0.5 μg of ethidium bromide per milliliter of solution. The size of the HCV cDNA fragment expected from the second round of PCR was 59 base pairs (bp). Procedures designed to avert contamination18 were applied strictly throughout the study.
Genotyping was performed and interpreted according to the method of Okamoto et al19. In brief, a combined reverse transcription and PCR16 was performed by adding outer antisense primer 186 (5'ATGTACCCATGAGGTCGGC3') and mixed outer sense primers 256 (5'CGCGCGACTAGGAAGACTTC3') and 256V (5'CGCGCGACGCGTAAAACTTC3'). In order to differentiate the various HCV genotypes, a nested PCR was performed with mixed inner sense primers 104 (5'AGGAAGACTTCCGAGCGGTC3') and 104V (5'CGTAAAACTTCTGAACGGTC3'), as well as five antisense type-specific primers -- i.e., 296 (5'GGATAGGCTGACGTCTACCT3'), 133 (5'GAGCCATCCTGCCCACCCCA3'), 134 (5'CCAAGAGGGACGGGAACCTC3'), 135 (5'ACCCTCGTTTCCGTACAGAG3'), and 339 (5'GCTGAGCCCAGGACCGGTCT3') -- for the amplification of HCV genotypes I (49 bp), II (144 bp), III (174 bp), IV (123 bp), and V (88 bp), respectively.
Interferon Treatment
Ten HCV RNA-positive patients with active liver disease as determined by biochemical measurements and liver biopsy were treated with recombinant interferon alfa-2b (Intron A, Schering Plough, Kenilworth, N.J.). They received an initial dose of 3 million units three times weekly for the first month. Three patients received a lower maintenance dose (1 million units three times weekly) after the first month, whereas the other seven were given the same dose (3 million units three times weekly) for the entire treatment period of 12 months. HCV RNA analysis was performed at the start of interferon therapy, after 3, 9, and 12 months of therapy, and 3 and 12 months after therapy had ended. Serum alanine aminotransferase levels were measured monthly throughout treatment and during a three-month follow-up period. Thereafter, blood tests were performed every third month.
Liver Histology
A percutaneous-liver-biopsy specimen was obtained from HCV RNA-positive patients with signs of active liver disease. In patients treated with interferon, a specimen was obtained during the six months before the start of interferon therapy and, when possible, immediately after the cessation of therapy. Serial liver biopsies were performed, and specimens evaluated, in nine patients. A total of 33 specimens of liver tissue were examined. They were interpreted blindly by one pathologist, and the morphologic features were graded semiquantitatively and given scores ranging from 0 to 3 according to the severity of the findings.
Results
HCV RNA and Anti-HCV Status
Of the 55 patients, 18 (33 percent) proved to be HCV RNA-positive by PCR. Serial blood samples obtained from 1987 through 1993 from 6 of the 18 were examined, and all the samples were HCV RNA-positive. One patient (Patient 18 in Table 1Table 1
Clinical Findings in 18 HCV RNA-Positive Patients with Primary Hypogammaglobulinemia.) was positive for hepatitis B surface antigen. One patient was positive for anti-HCV antibody in a single serum sample, but negative in three subsequent samples.HCV Genotyping
The HCV genotypes of 14 patients were studied. The samples from 2 patients could not be typed, but genotype V was detected in the samples from each of the remaining 12 patients. Six of them were infected with two strains, and two with three strains; the other strains detected were genotypes II and III (Table 2Table 2
HCV Genotypes of 14 Patients and Results of Treatment in Patients Receiving Interferon.).Exposure to Contaminated Immune Globulin and HCV RNA Status
As can be seen from Table 3Table 3
Prevalence of Liver Disease According to Positivity or Negativity for HCV RNA and Exposure to Contaminated Immune Globulin., 20 patients were exposed to the contaminated immune globulin, and 17 of them (85 percent) were positive for HCV RNA. One patient (Patient 18) who was HCV RNA-positive had not been exposed to this preparation of immune globulin but had a history of intravenous drug abuse. Seventeen patients had received the contaminated immune globulin (7.5 to 17.5 g monthly) for more than 1.5 years. The other three patients received only two to five infusions of the product. Three patients exposed to the contaminated immune globulin had also received other blood products through transfusions of blood or plasma; in each case the transfusions occurred more than three years before the exposure to contaminated immune globulin.Three patients were negative for HCV RNA despite having received the contaminated immune globulin. Two had received the preparation regularly for three years, whereas one had received only two infusions.
Liver Disease in HCV RNA-Positive Patients
Except for Patient 2, who had cholangiographic findings compatible with sclerosing cholangitis, and Patient 18, who was coinfected with the hepatitis B and hepatitis D viruses, the HCV RNA-positive patients had normal liver findings before their exposure to the contaminated immune globulin. Liver findings became abnormal in eight patients during the period of exposure, whereas abnormal results occurred in the remaining eight two months to seven years after administration of the contaminated immune globulin had ended (Table 1). Only two patients had signs and symptoms of acute hepatitis, with nausea, asthenia, moderate jaundice, and significantly increased levels of alanine aminotransferase and bilirubin in serum.
Two patients had increased levels of alanine aminotransferase 4.5 and 7 years after the last infusion of contaminated immune globulin. One of these patients was positive for HCV RNA more than three years before biochemical signs of liver disease became apparent. As Table 1 shows, all HCV RNA-positive patients had abnormal results on liver tests, and in most of them alanine aminotransferase levels were persistently more than twice the upper limit of the reference values. Most patients had biochemical signs of cholestatic liver disease (increased serum levels of alkaline phosphatase and γ-glutamyltransferase), but only 1 had cholangiographic findings indicative of bile-duct involvement (endoscopic retrograde cholangiography was performed in 7 of the 18 patients). Four patients died during the observation period, two of liver failure (Table 1).
Clinical Course of HCV Infection in Hypogammaglobulinemia Subgroups
Of five patients with common variable immunodeficiency, four had cirrhosis and severe liver disease, and the fifth died of chronic active hepatitis (Table 1). Both patients who died of end-stage liver disease had common variable immunodeficiency. Among six patients with X-linked hypogammaglobulinemia, cirrhosis and end-stage liver disease were seen only in the patient coinfected with the hepatitis B and hepatitis D viruses.
Liver-Biopsy Findings
Liver biopsies were performed in 15 of the 18 HCV RNA-positive patients. All specimens revealed pathologic features (Table 4Table 4
Liver-Biopsy Findings in 15 Patients Positive for HCV RNA Who Had Hypogammaglobulinemia.). Portal inflammation, bile-duct damage with partial bile-duct loss, parenchymal activity with inflammation, and focal liver necrosis were frequently seen. Cirrhosis or probable cirrhosis was demonstrated in six patients (Table 1). In four patients not treated with interferon, serial liver-biopsy specimens revealed substantial progression in three patients and stable disease in one.Interferon Treatment
In 1 of the 10 patients, interferon was discontinued after two months because of increasing signs and symptoms of decompensated liver cirrhosis. In two patients treatment was discontinued after three and six months because of complications probably not associated with the use of interferon. One patient who had a history of psychiatric illness committed suicide during interferon therapy.
Four patients had complete biochemical responses, with their alanine aminotransferase levels becoming normal after four to six weeks of interferon therapy. However, only one patient with a complete response had a sustained biochemical response (i.e., persistently normal alanine aminotransferase values 12 and 24 months after the cessation of treatment). In four patients alanine aminotransferase levels were reduced by more than half during the treatment period (a partial response), and in all four these levels subsequently increased, indicating that the effect of interferon was only temporary. Two patients, one of whom did not undergo genotyping, did not have a response.
Of five patients treated with interferon for whom serial biopsy specimens were available, two had histologic improvement after the treatment. Biopsy specimens obtained one to two years later have, however, demonstrated further progression in these two patients. In the other three patients histologic findings showed progression of disease during interferon therapy despite complete biochemical responses in two of them.
One patient seroconverted from positive to negative for HCV RNA after six months of interferon treatment. However, only one negative sample was obtained before the patient committed suicide. All the other patients treated with interferon remained HCV RNA-positive throughout treatment and the 12-month follow-up period.
The relation between the response to interferon therapy and the configuration of HCV genotypes is shown in Table 2. The presence of more than one strain of HCV may indicate a poor response to interferon treatment.
Discussion
We report a high prevalence of HCV infection in patients with primary hypogammaglobulinemia who received intravenous treatment with an immune globulin product that was later found to be contaminated with non-A, non-B hepatitis virus5,12. The fact that only 1 of the 35 patients not exposed to the contaminated immune globulin was positive for HCV RNA is in accordance with the low prevalence of HCV infection in Norway20.
Intravenous therapy with this HCV-contaminated immune globulin product apparently carried a very high risk of infection. The observed rate of infectivity was much higher than that reported by Bjorkander et al., who found that hepatitis developed in 16 of 77 patients after treatment with the same contaminated immune globulin5. This discrepancy may reflect the much longer observation period in our study and more precise virologic diagnosis due to the availability of HCV RNA analysis by PCR.
A striking finding was the presence of more than one genotype in the majority of the patients. Multiple exposures to different batches of immune globulin, each prepared from blood from a large number of donors, may explain this. The immunodeficiency of the patients may also have allowed infection with more than one genotype. The frequent finding of genotype V (corresponding to genotype 3 in Simmonds's classification21), which is not very common in Europe,22 may have occurred because a large plasma pool used for the production of immune globulin was infected with this particular genotype. This genotype may be more prevalent in other parts of the world that supplied plasma for the production of the contaminated immune globulin. The absence of HCV antibodies in serum samples from our HCV-infected patients is as would be expected because of their hypogammaglobulinemia. The reason why three patients exposed to the contaminated immune globulin remained negative for HCV RNA may be that they were not treated with infected batches or that they were less susceptible to HCV infection.
The long-term effect of transfusion-associated non-A, non-B hepatitis on morbidity and mortality is not fully known. In one study overall mortality was no higher in the group with transfusion-associated non-A, non-B hepatitis than in a control group23. Our study clearly indicates that HCV is a potent etiologic agent of liver disease that is often severe in patients with primary hypogammaglobulinemia. The more aggressive clinical course in patients with hypogammaglobulinemia may be related to several factors, including a reduced capacity for clearing or neutralizing virus, impaired T-cell and monocyte function,24 and the presence of multiple genotypes and coexistent liver disease25. Sclerosing cholangitis may occur in immunodeficient patients,26 but cholangiographic findings compatible with sclerosing cholangitis were seen in only one of our HCV RNA-positive patients. Liver-biopsy specimens showed cholestasis in only a few patients, even though most patients had markedly elevated levels of alkaline phosphatase and γ-glutamyltransferase. Our data suggest that the clinical course of disease may be most aggressive in patients with common variable hypogammaglobulinemia, but the numbers are too small to permit statistical analysis.
There is a brief report of treatment with lymphoblastoid interferon in three cases of non-A, non-B hepatitis in patients with hypogammaglobulinemia,27 but we know of no study of interferon treatment for well-defined HCV infection in such patients. Our patients had a relatively high rate of biochemical response, as compared with otherwise healthy patients28. However, both liver-biopsy findings and HCV RNA data indicate poorer responses,29,30 which probably reflect, at least in part, the immunodeficiency in these patients. Recent reports describe differences in the response to interferon according to HCV genotype,31,32 and the presence of more than one genotype was associated with poorer responses in our study.
Immune globulins that are currently available for intravenous use are considered to have a high degree of safety with respect to HCV contamination. Most manufacturers use only anti-HCV-negative plasma donors, and virus-inactivating procedures are increasingly included in the manufacturing process.
We are indebted to Bjorg-Guri Gutigard and Bodil Lunden for their excellent technical assistance.
Source Information
From the Section of Clinical Immunology and Infectious Diseases (K.B., S.S.F.) and the Section of Hepatology and Gastroenterology (K.B.), Medical Department A, and the Department of Pathology (T.H.), National Hospital, Oslo, Norway; the Department of Virology, National Institute of Public Health, Oslo (H.H.S.); and the Institute for Clinical Virology, Karolinska Institute, Huddinge Hospital, Stockholm, Sweden (Z.Y.).
Address reprint requests to Dr. Bjoro at Medical Department A, National Hospital, 0027 Oslo, Norway.
- References
References
1
Lane RS . Non-A, non-B hepatitis from intravenous immunoglobulin. Lancet 1983;2:974-975
CrossRef | Web of Science | Medline2
Lever AML ,Brown D ,Webster ADB ,Thomas HC . Non-A, non-B hepatitis occurring in agammaglobulinaemic patients after intravenous immunoglobulin. Lancet 1984;2:1062-1064
CrossRef | Web of Science | Medline3
Webster ADB ,Lever AML . Non-A, non-B hepatitis after intravenous gammaglobulin. Lancet 1986;1:322-322
CrossRef | Web of Science | Medline4
Weiland O ,Mattsson L ,Glaumann H . Non-A, non-B hepatitis after intravenous gammaglobulin. Lancet 1986;1:976-977
CrossRef | Web of Science | Medline5
Bjorkander J ,Cunningham-Rundles C ,Lundin P ,Olsson R ,Soderstrom R ,Hanson LA . Intravenous immunoglobulin prophylaxis causing liver damage in 16 of 77 patients with hypogammaglobulinemia or IgG subclass deficiency. Am J Med 1988;84:107-111
CrossRef | Web of Science | Medline6
Williams PE ,Yap PL ,Gillon J ,Crawford RJ ,Urbaniak SJ ,Galea G . Transmission of non-A, non-B hepatitis by pH4-treated intravenous immunoglobulin. Vox Sang 1989;57:15-18
CrossRef | Web of Science | Medline7
Webster ADB ,Spickett GP ,Thomson BJ ,Farrant J . Viruses and antibody deficiency syndromes. Immunol Invest 1988;17:93-105
CrossRef | Web of Science | Medline8
Alter HJ, Jett BW, Polito AJ. Analysis of the role of hepatitis C virus in transfusion-associated hepatitis. In: Hollinger FB, Lemon SM, Margolis HS, eds. Viral hepatitis and liver disease. Baltimore: Williams & Wilkins, 1992:396-402.
9
Spickett GP ,Misbah SA ,Chapel HM . Primary antibody deficiency in adults. Lancet 1991;337:281-284
CrossRef | Web of Science | Medline10
Primary immunodeficiency disease: WHO scientific group reportImmunodefic Rev 1989;1:173-205
Medline11
Aukrust P ,Froland SS ,Muller F . Raised serum neopterin levels in patients with primary hypogammaglobulinaemia: correlation to other immunological parameters and to clinical and histological features. Clin Exp Immunol 1992;89:211-216
CrossRef | Web of Science | Medline12
Iwarson S ,Wejstal R ,Ruttimann E . Non-A, non-B hepatitis associated with the administration of intravenous immunoglobulin -- transmission studies in chimpanzees. Serodiagn Immunother 1987;1:261-266
CrossRef13
Yei S ,Yu MW ,Tankersley DL . Partitioning of hepatitis C virus during Cohn-Oncley fractionation of plasma. Transfusion 1992;32:824-828
CrossRef | Web of Science | Medline14
Chomczynski P ,Sacchi N . Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162:156-159
CrossRef | Web of Science | Medline15
Garson JA ,Ring CJA ,Tuke PW . Improvement of HCV genome detection with “short” PCR products. Lancet 1991;338:1466-1467
CrossRef | Web of Science | Medline16
Yun ZB ,Lindh G ,Weiland O ,Johansson B ,Sonnerborg A . Detection of hepatitis C virus (HCV) RNA by PCR related to HCV antibodies in serum and liver histology in Swedish blood donors. J Med Virol 1993;39:57-61
CrossRef | Web of Science | Medline17
Skaug K ,Li H ,Jonassen TO ,Larsen J ,Figenschau KJ . Hepatitis C virus (HCV) RNA among anti-HCV-positive blood donors and their recipients. Vox Sang 1993;64:215-219
CrossRef | Web of Science | Medline18
Kwok S ,Higuchi R . Avoiding false positives with PCR. Nature 1989;339:237-238[Erratum, Nature 1989;339:490.]
CrossRef | Web of Science | Medline19
Okamoto H ,Tokita H ,Sakamoto M , et al. Characterization of the genomic sequence of type V (or 3a) hepatitis C virus isolates and PCR primers for specific detection. J Gen Virol 1993;74:2385-2390
CrossRef | Web of Science | Medline20
Nordoy I ,Schrumpf E ,Elgjo K , et al. Liver disease in anti-hepatitis C virus-positive Norwegian blood donors. Scand J Gastroenterol 1994;29:77-81
CrossRef | Web of Science | Medline21
Simmonds P ,Holmes EC ,Cha T-A , et al. Classification of hepatitis C virus into six major genotypes and a series of subtypes by phylogenetic analysis of the NS-5 region. J Gen Virol 1993;74:2391-2399
CrossRef | Web of Science | Medline22
Dusheiko G ,Schmilovitz-Weiss H ,Brown D , et al. Hepatitis C virus genotypes: an investigation of type-specific differences in geographic origin and disease. Hepatology 1994;19:13-18
CrossRef | Web of Science | Medline23
Seeff LB ,Buskell-Bales Z ,Wright EC , et al. Long-term mortality after transfusion-associated non-A, non-B hepatitis. N Engl J Med 1992;327:1906-1911
Full Text | Web of Science | Medline24
Reinherz EL ,Rubinstein A ,Geha RS ,Strelkauskas AJ ,Rosen FS ,Schlossman SF . Abnormalities of immunoregulatory T cells in disorders of immune function. N Engl J Med 1979;301:1018-1022
Full Text | Web of Science | Medline25
Cunningham-Rundles C . Clinical and immunologic analyses of 103 patients with common variable immunodeficiency. J Clin Immunol 1989;9:22-33
CrossRef | Web of Science | Medline26
Forbes A ,Blanshard C ,Gazzard B . Natural history of AIDS related sclerosing cholangitis: a study of 20 cases. Gut 1993;34:116-121
CrossRef | Web of Science | Medline27
Thomson BJ ,Doran M ,Lever AML ,Webster ADB . Alpha-interferon therapy for non-A, non-B hepatitis transmitted by gammaglobulin replacement therapy. Lancet 1987;1:539-541
CrossRef | Web of Science | Medline28
Tine F ,Magrin S ,Craxi A ,Pagliaro L . Interferon for non-A, non-B chronic hepatitis: a meta-analysis of randomised clinical trials. J Hepatol 1991;13:192-199
CrossRef | Web of Science | Medline29
Hagiwara H ,Hayashi N ,Mita E , et al. Detection of hepatitis C virus RNA in serum of patients with chronic hepatitis C treated with interferon-α. Hepatology 1992;15:37-41
CrossRef | Web of Science | Medline30
Shindo M ,Di Bisceglie AM ,Cheung L , et al. Decrease in serum hepatitis C viral RNA during alpha-interferon therapy for chronic hepatitis C. Ann Intern Med 1991;115:700-704
Web of Science | Medline31
Chemello L ,Alberti A ,Rose K ,Simmonds P . Hepatitis C serotype and response to interferon therapy. N Engl J Med 1994;330:143-143
Full Text | Web of Science | Medline32
Gerolami V ,Halfon P ,Bourliere M , et al. Hepatitis C virus genotypes in chronic hepatitis and response to interferon-α therapy. J Infect Dis 1993;168:1328-1329
CrossRef | Web of Science | Medline
- Citing Articles (135)
Citing Articles
1
Andre Kaplan. (2012) Complications of Apheresis. Seminars in Dialysisno-no
CrossRef2
Hans L. Tillmann, John G. McHutchison. 2012. Hepatitis C. , 564-598.
CrossRef3
V. Edwards, A. W. Tarr, R. Urbanowicz, J. Ball. (2011) The role of neutralising antibodies in hepatitis C virus infection. Journal of General Virology
CrossRef4
Ingi Lee, Russell Localio, Colleen M. Brensinger, Emily A. Blumberg, Ebbing Lautenbach, Leanne Gasink, Valerianna K. Amorosa, Vincent Lo Re. (2011) Decreased post-transplant survival among heart transplant recipients with pre-transplant hepatitis C virus positivity. The Journal of Heart and Lung Transplantation 30:11, 1266-1274
CrossRef5
L.J. Maarschalk-Ellerbroek, I.M. Hoepelman, P.M. Ellerbroek. (2011) Immunoglobulin treatment in primary antibody deficiency. International Journal of Antimicrobial Agents 37:5, 396-404
CrossRef6
Prodromos Hytiroglou. 2011. Hepatitis C. , 225-233.
CrossRef7
Hakan M. Gürcan, Derin B. Keskin, A. Razzaque Ahmed. (2010) Information for healthcare providers on general features of IGIV with emphasis on differences between commercially available products. Autoimmunity Reviews 9:8, 553-559
CrossRef8
P. M. Vaitla, E. M. McDermott. (2010) The role of high-dose intravenous immunoglobulin in rheumatology. Rheumatology 49:6, 1040-1048
CrossRef9
Nazish Bostan, Tariq Mahmood. (2010) An overview about hepatitis C: A devastating virus. Critical Reviews in Microbiology 36:2, 91-133
CrossRef10
P. Imbach, A. H. Lazarus, T. Kühne. (2010) Intravenous immunoglobulins induce potentially synergistic immunomodulations in autoimmune disorders. Vox Sanguinis 98:3p2, 385-394
CrossRef11
M. Ballow. (2009) Clinical experience with Flebogamma ® 5% DIF: a new generation of intravenous immunoglobulins in patients with primary immunodeficiency disease. Clinical & Experimental Immunology 157, 22-25
CrossRef12
Barbara Rehermann. (2009) Hepatitis C virus versus innate and adaptive immune responses: a tale of coevolution and coexistence. Journal of Clinical Investigation 119:7, 1745-1754
CrossRef13
Thomas H. Brannagan. (2009) Current treatments of chronic immune-mediated demyelinating polyneuropathies. Muscle & Nerve 39:5, 563-578
CrossRef14
Mary Ellen Conley, A. Kerry Dobbs, Dana M. Farmer, Sebnem Kilic, Kenneth Paris, Sofia Grigoriadou, Elaine Coustan-Smith, Vanessa Howard, Dario Campana. (2009) Primary B Cell Immunodeficiencies: Comparisons and Contrasts. Annual Review of Immunology 27:1, 199-227
CrossRef15
Robert M. Pascuzzi. (2009) Peripheral Neuropathy. Medical Clinics of North America 93:2, 317-342
CrossRef16
Maria Garcia-Lloret, Sean McGhee, Talal A. Chatila. (2008) Immunoglobulin Replacement Therapy in Children. Immunology and Allergy Clinics of North America 28:4, 833-849
CrossRef17
Barbara Roe, William W. Hall. (2008) Cellular and molecular interactions in coinfection with hepatitis C virus and human immunodeficiency virus. Expert Reviews in Molecular Medicine 10,
CrossRef18
Shigeaki Ishii, Margaret James Koziel. (2008) Immune responses during acute and chronic infection with hepatitis C virus. Clinical Immunology 128:2, 133-147
CrossRef19
Zania Stamataki, Joe Grove, Peter Balfe, Jane A. McKeating. (2008) Hepatitis C Virus Entry and Neutralization. Clinics in Liver Disease 12:3, 693-712
CrossRef20
Fatih Ermis, Filiz Akyüz, Kadir Demir, Fatih Besisik, Güngör Boztas, Zeynel Mungan. (2008) Rapidly Progressive HCV Cirrhosis in a Hypogammaglobulinemic Patient. Internal Medicine 47:5, 415-417
CrossRef21
Matti Sällberg, Malin Weiland, Lars Frelin. (2007) Therapeutic vaccines: challenges of chronic viral infections. Drug Discovery Today: Therapeutic Strategies 4:4, 253-266
CrossRef22
Christina Maresch, Philip J. Schluter, Andrew D. Wilson, Adrian Sleigh. (2007) Residual infectious disease risk in screened blood transfusion from a high-prevalence population: Santa Catarina, Brazil. Transfusion 0:0, 071117010348007-???
CrossRef23
Mark Ballow. (2007) Safety of IGIV therapy and infusion-related adverse events. Immunologic Research 38:1-3, 122-132
CrossRef24
Vinod K. Rustgi. (2007) The epidemiology of hepatitis C infection in the United States. Journal of Gastroenterology 42:7, 513-521
CrossRef25
Isabelle Desombere, Hans Van Vlierberghe, Ola Weiland, Catharina Hultgren, Matti Sällberg, Juan Quiroga, Vicente Carreño, Geert Leroux-Roels. (2007) Serum levels of anti-NS4a and anti-NS5a predict treatment response of patients with chronic hepatitis C. Journal of Medical Virology 79:6, 701-713
CrossRef26
Pierre Pradat, Nicolas Voirin, Hans Ludger Tillmann, Michèle Chevallier, Christian Trépo. (2007) Progression to cirrhosis in hepatitis C patients: an age-dependent process. Liver International 27:3, 335-339
CrossRef27
Andrew R Lloyd, Emma Jagger, Jeffrey J Post, Lee-Ann Crooks, William D Rawlinson, Young S Hahn, Rosemary A Ffrench. (2007) Host and viral factors in the immunopathogenesis of primary hepatitis C virus infection. Immunology and Cell Biology 85:1, 24-32
CrossRef28
R.-P. Vonberg, P. Gastmeier. (2007) Hospital-acquired infections related to contaminated substances. Journal of Hospital Infection 65:1, 15-23
CrossRef29
Loïc Guillevin, Christian Pagnoux. (2007) Therapeutic Strategies for Systemic Necrotizing Vasculitides. Allergology International 56:2, 105-111
CrossRef30
Nicasio Mancini, Silvia Carletti, Mario Perotti, Luisa Romanò, Rosellina Di Stefano Craxì, Antonio Craxì, Alessandro R. Zanetti, Massimo Clementi, Roberto Burioni. (2006) Modulation of epitope-specific anti-hepatitis C virus E2 (anti-HCV/E2) antibodies by anti-viral treatment. Journal of Medical Virology 78:10, 1304-1311
CrossRef31
Jos?? R. Foruny, Rafael B??rcena, Ana Moreno, Javier Bl??zquez, Rebeca Manzano, Luis A. Gil-Grande, Alberto Moreno, Javier Nu??o. (2006) Benefit of Pegylated Interferon-??-2a/Ribavirin in a Patient with Common Variable Immunodeficiency and Hepatitis C Virus Cirrhosis after Liver Transplantation and Splenic Embolization. Transplantation 82:2, 289-290
CrossRef32
LISA N ELLIOTT, ANDREW R LLOYD, JOHN B ZIEGLER, ROSEMARY A FFRENCH. (2006) Protective immunity against hepatitis C virus infection. Immunology and Cell Biology 84:3, 239-249
CrossRef33
Nicola Strnad-Trojan, Richard Linde, Janine Reichenbach, Jörg Trojan, Stefan Zeuzem, Stefan Zielen. (2006) Treatment of HCV infection with interferon alpha-2b and ribavirin in a patient with X-linked lymphoproliferative syndrome. European Journal of Pediatrics 165:5, 348-350
CrossRef34
Adam Lawson, Stephen D. Ryder. (2006) Progression of hepatic fibrosis in chronic hepatitis C and the need for treatment in mild disease. European Journal of Gastroenterology & Hepatology 18:4, 343-347
CrossRef35
Sheila MacLennan, John A.J. Barbara. (2006) Risks and side effects of therapy with plasma and plasma fractions. Best Practice & Research Clinical Haematology 19:1, 169-189
CrossRef36
J. Parkkinen, A. Rahola, L. Bonsdorff, H. Tolo, E. Torma. (2006) A modified caprylic acid method for manufacturing immunoglobulin G from human plasma with high yield and efficient virus clearance. Vox Sanguinis 90:2, 97-104
CrossRef37
Vanessa Howard, Jeffrey M. Greene, Savita Pahwa, Jerry A. Winkelstein, John M. Boyle, Mehmet Kocak, Mary Ellen Conley. (2006) The health status and quality of life of adults with X-linked agammaglobulinemia. Clinical Immunology 118:2-3, 201-208
CrossRef38
Lenhard K Rudolph, Hans L Tillmann. (2005) Hepatitis C virus infection in the elderly. Aging Health 1:3, 409-417
CrossRef39
H. Michels, G.-R. Burmester, F. Buttgereit. (2005) i.v.-Immunglobuline bei chronischen idiopathischen Myositiden. Zeitschrift f
r Rheumatologie 64:2, 102-110
CrossRef40
EDWARD GANE. (2004) Renal transplantation in chronic hepatitis C. Journal of Gastroenterology and Hepatology 19:s7, S99-S102
CrossRef41
K. Watt, J. Uhanova, Y. Gong, K. Kaita, K. Doucette, N. Pettigrew, G. Y. Minuk. (2004) Serum immunoglobulins predict the extent of hepatic fibrosis in patients with chronic hepatitis C virus infection. Journal of Viral Hepatitis 11:3, 251-256
CrossRef42
Irina Knezevic-Maramica, Margot S. Kruskall. (2003) Intravenous immune globulins: an update for clinicians. Transfusion 43:10, 1460-1480
CrossRef43
Robert Thimme, Hans-Christian Spangenberg, Hubert E. Blum. (2002) Bridge over troubled water: Protection against hepatitis C virus persistence?. Hepatology 36:6, 1537-1539
CrossRef44
David L. Thomas. (2002) Hepatitis C and human immunodeficiency virus infection. Hepatology 36:S1, S201-S209
CrossRef45
D. Prati. (2002) Transmission of viral hepatitis by blood and blood derivatives: current risks, past heritage. Digestive and Liver Disease 34:11, 812-817
CrossRef46
Isabella Quinti, Marina Pierdominici, Marco Marziali, Antonello Giovannetti, Simona Donnanno, Helen Chapel, Janne Bjorkander, Fernando Aiuti. (2002) European Surveillance of Immunoglobulin Safety—Results of Initial Survey of 1243 Patients with Primary Immunodeficiencies in 16 Countries. Clinical Immunology 104:3, 231-236
CrossRef47
Ding-You Li, Kathleen B. Schwarz. (2002) Immunopathogenesis of Chronic Hepatitis C Virus Infection. Journal of Pediatric Gastroenterology and Nutrition 35:3, 260-267
CrossRef48
Brent D Lemberg, Thomas A Shaw-Stiffel. (2002) Hepatic disease in injection drug users. Infectious Disease Clinics of North America 16:3, 667-679
CrossRef49
Melvin Berger. (2002) A history of immune globulin therapy, from the harvard crash program to monoclonal antibodies. Current Allergy and Asthma Reports 2:5, 368-378
CrossRef50
Edward Gane, Helen Pilmore. (2002) Management of chronic viral hepatitis before and after renal transplantation. Transplantation 74:4, 427-437
CrossRef51
Bianca Lang, Ciaran M Duffy. (2002) Controversies in the management of Kawasaki disease. Best Practice & Research Clinical Rheumatology 16:3, 427-442
CrossRef52
S Distante, K Bjoro, KB Hellum, B Myrvang, JP Berg, K Skaug, N Raknerud, H Bell. (2002) Raised serum ferritin predicts non-response to interferon and ribavirin treatment in patients with chronic hepatitis C infection. Liver International 22:3, 269-275
CrossRef53
Sandro Vento, Francesca Cainelli. (2002) Does hepatitis C virus cause severe liver disease only in people who drink alcohol?. The Lancet Infectious Diseases 2:5, 303-309
CrossRef54
Anthony J Freeman, George Marinos, Rosemary A Ffrench, Andrew R Lloyd. (2001) Immunopathogenesis of hepatitis C virus infection. Immunology and Cell Biology 79:6, 515-536
CrossRef55
Samiya Razvi, Lynda Schneider, Maureen M. Jonas, Charlotte Cunningham-Rundles. (2001) Outcome of Intravenous Immunoglobulin-Transmitted Hepatitis C Virus Infection in Primary Immunodeficiency. Clinical Immunology 101:3, 284-288
CrossRef56
Mario U Mondelli, Antonella Cerino, Laura Segagni, Annalisa Meola, Agostino Cividini, Enrico Silini, Alfredo Nicosia. (2001) Hypervariable region 1 of hepatitis C virus: immunological decoy or biologically relevant domain?. Antiviral Research 52:2, 153-159
CrossRef57
Robert J. Klaassen, John J. Doyle, Murray D. Krahn, Victor S. Blanchette, Gary Naglie. (2001) Initial Bone Marrow Aspiration in Childhood Idiopathic Thrombocytopenia: Decision Analysis. Journal of Pediatric Hematology/Oncology 23:8, 511-518
CrossRef58
Robin Patel. (2001) INFECTIONS IN RECIPIENTS OF KIDNEY TRANSPLANTS. Infectious Disease Clinics of North America 15:3, 901-952
CrossRef59
Rudolf Schosser, Brigitte Keller-Stanislawski, C. Micha Nubling, Johannes Lower. (2001) Causality assessment of suspected virustransmission by human plasma products. Transfusion 41:8, 1020-1029
CrossRef60
H.M. Chapel, J.M.L. Christie, V. Peach, R.W.G. Chapman. (2001) Five-Year Follow-up of Patients with Primary Antibody Deficiencies Following an Outbreak of Acute Hepatitis C. Clinical Immunology 99:3, 320-324
CrossRef61
Sandra Hjalmarsson, Jonas Blomberg, Lena Grillner, R
CrossRef62
David J. Weber, William A. Rutala. (2001) The Emerging Nosocomial Pathogens Cryptosporidium, Escherichia coli O157:H7, Helicobacter pylori , and Hepatitis C: Epidemiology, Environmental Survival, Efficacy of Disinfection, and Control Measures • . Infection Control and Hospital Epidemiology 22:5, 306-315
CrossRef63
Manuel Castella, Gero Tenderich, Michael M Koerner, Latif Arusoglu, Ali El-Banayosy, Uwe Schulz, Bern Schulze, Sebastian Schulte-Eistrup, Carlsten Wolff, Kazutomo Minami, Reiner Koerfer. (2001) Outcome of heart transplantation in patients previously infected with hepatitis C virus. The Journal of Heart and Lung Transplantation 20:5, 595-598
CrossRef64
Alexander C Haushofer, Camel Kopty, Rene Hauer, Harald Brunner, Walter-Michael Halbmayer. (2001) HCV genotypes and age distribution in patients of Vienna and surrounding areas. Journal of Clinical Virology 20:1-2, 41-47
CrossRef65
G.W. McCaughan, A. Zekry. (2000) Effects of immunosuppression and organ transplantation on the natural history and immunopathogenesis of hepatitis C virus infection. Transplant Infectious Disease 2:4, 166-185
CrossRef66
Catherine Petruff Cheney, Sanjiv Chopra, Camilla Graham. (2000) HEPATITIS C. Infectious Disease Clinics of North America 14:3, 633-667
CrossRef67
Stewart S Cooper, Jeffery Glenn, Harry B Greenberg. (2000) Host–microbe interactions: viruses. Current Opinion in Microbiology 3:4, 363-365
CrossRef68
Hiroshi Yatsuhashi, Michitami Yano. (2000) Natural history of chronic hepatitis C. Journal of Gastroenterology and Hepatology 15:5 (Suppl.), E111-E116
CrossRef69
Edward Gane. (2000) Pre- and post-transplant treatment of hepatitis C. Journal of Gastroenterology and Hepatology 15:5 (Suppl.), E187-E193
CrossRef70
Stephanos J Hadziyannis, Dimitrios Vassilopoulos. (2000) Complex management issues: management of HCV in the atypical patient. Best Practice & Research Clinical Gastroenterology 14:2, 277-291
CrossRef71
Mark S. Sulkowski, Eric E. Mast, Leonard B. Seeff, David L. Thomas. (2000) Hepatitis C Virus Infection as an Opportunistic Disease in Persons Infected with Human Immunodeficiency Virus. Clinical Infectious Diseases 30:s1, S77-S84
CrossRef72
Hugo R. Rosen. (2000) Primer on Hepatitis C for Hospital Epidemiologists • . Infection Control and Hospital Epidemiology 21:3, 229-234
CrossRef73
Kevin K. Watanabe, Michael P. Busch, George B. Schreiber, Thomas F. Zuck. (2000) Evaluation of the Safety of Rh Immunoglobulin by Monitoring Viral Markers among Rh-Negative Female Blood Donors. Vox Sanguinis 78:1, 1-6
CrossRef74
Yves Allory, Frederic Charlotte, Yves Benhamou, Pierre Opolon, Yves Le Charpentier, Thierry Poynard. (2000) Impact of human immunodeficiency virus infection on the histological features of chronic hepatitis C: A case-control study. Human Pathology 31:1, 69-74
CrossRef75
H. F. Rabenau, H. Kawara, H. W. Doerr, B. Weber. (2000) Prävalenzbestimmung von Hepatitis G Virus in Plasmapools und Plasmapoolpräparaten. Prevalence of Hepatitis G Virus in Plasma Pools and Products. LaboratoriumsMedizin 24:3, 146-152
CrossRef76
E. Tabor. (1999) The epidemiology of virus transmission by plasma derivatives: clinical studies verifying the lack of transmission of hepatitis B and C viruses and HIV type 1. Transfusion 39:11, 1160-1168
CrossRef77
Helen M. Chapel. (1999) Safety and availability of immunoglobulin replacement therapy in relation to potentially transmissable agents. Clinical and Experimental Immunology 118:S1, 29-34
CrossRef78
R. A. Willson, S. H. Fischer, H. D. Ochs. (1999) Long-Term Interferon Alpha Maintenance Therapy for Chronic Hepatitis C Infection in a Patient With Common Variable Immune Deficiency. Journal of Clinical Gastroenterology 29:2, 203-206
CrossRef79
Mario U. Mondelli, Antonella Cerino, Antonella Lisa, Sabrina Brambilla, Laura Segagni, Agostino Cividini, Morena Bissolati, Gabriele Missale, Giorgio Bellati, Annalisa Meola, Bruno Bruniercole, Alfredo Nicosia, Giovanni Galfr
CrossRef80
W.B. Benny, D.M.C. Sutton, J. Oger, V. Bril, M.J. McAteer, G. Rock. (1999) Clinical evaluation of a staphylococcal protein A immunoadsorption system in the treatment of myasthenia gravis patients. Transfusion 39:7, 682-687
CrossRef81
K. Bjoro, T. Haaland, K. Skaug, S. S. Froland. (1999) The spectrum of hepatobiliary disease in primary hypogammaglobulinaemia. Journal of Internal Medicine 245:5, 517-524
CrossRef82
Kenny-Walsh, Elizabeth, . (1999) Clinical Outcomes after Hepatitis C Infection from Contaminated Anti-D Immune Globulin. New England Journal of Medicine 340:16, 1228-1233
Full Text83
Stewart Cooper, Ann L Erickson, Erin J Adams, Joe Kansopon, Amy J Weiner, David Y Chien, Michael Houghton, Peter Parham, Christopher M Walker. (1999) Analysis of a Successful Immune Response against Hepatitis C Virus. Immunity 10:4, 439-449
CrossRef84
P.F.G. O'Leary, K. Collingham, S. Skidmore, J. King, C.L. Bennett, P.E. Williams, D. Pillay, R.A. Thompson. (1999) Hepatic Dysfunction in a Population of Antibody-Deficient Patients: Prevalence, Aetiology and Outcome of PCR Screening for Hepatitis C and G Viruses. Vox Sanguinis 76:3, 144-148
CrossRef85
Sudhish Chandra, James E. Cavanaugh, Chaomei M. Lin, Claudette Pierre-Jerome, Nagender Yerram, Richard L. Weeks, Everett Flanigan, Fred Feldman. (1999) Virus reduction in the preparation of intravenous immune globulin: in vitro experiments. Transfusion 39:3, 249-257
CrossRef86
Akira Matsumori, Naohiro Ohashi, Ryosuke Nishio, Tadashi Kakio, Masatake Hara, Yutaka Furukawa, Koh Ono, Tetsuo Shioi, Koji Hasegawa, Shigetake Sasayama. (1999) Apical Hypertrophic Cardiomyopathy and Hepatitis C Virus Infection. Japanese Circulation Journal 63:6, 433-438
CrossRef87
Brian J.G. Pereira. (1999) Hepatitis C Virus Infection in Dialysis: A Continuing Problem. Artificial Organs 23:1, 51-60
CrossRef88
Edward J. Gane, Geert Maertens, Annemie Ducatteeuw, Ke-Ping Qian, Johnson Y.N. Lau, Huw Jones, Edward Davies, Nikolai V. Naoumov, Roger Williams. (1999) ANTIBODIES TO HEPATITIS C VIRUS ENVELOPE PROTEINS CORRELATE WITH HEPATITIS C VIRAEMIA AFTER LIVER TRANSPLANTATION. Transplantation 67:1, 78-84
CrossRef89
Marcello Piazza. (1999) Immunoglobulin transmits hepatitis C. true or false?. Hepatology 29:1, 299-300
CrossRef90
Claus Niederau, Stefan Lange, Tobias Heintges, Andreas Erhardt, Marlies Buschkamp, Dietmar H
CrossRef91
L.E. Adinolfi, A. Andreana, R. Utili, R. Zampino, E. Ragone, G. Ruggiero. (1998) HCV RNA levels in serum, liver, and peripheral blood mononuclear cells of chronic hepatitis C patients and their relationship to liver injury. The American Journal of Gastroenterology 93:11, 2162-2166
CrossRef92
S.M. Gore, R.P. Brettle, S.M. Burns, S.C. Lewis. (1998) Pilot study to estimate survivors to 1995 of 1983–1984 prevalent hepatitis C infections in lothian patients who tested positive or negative for hepatitis B surface antigen in 1983–1984. Journal of Infection 37:2, 159-165
CrossRef93
J. C. L. Booth. (1998) Chronic hepatitis C: the virus, its discovery and the natural history of the disease. Journal of Viral Hepatitis 5:4, 213-222
CrossRef94
Brian J.G. Pereira, Svetlozar N. Natov, Beth A. Bouthot, B. V. R. Murthy, Robin Ruthazer, Christopher H. Schmid, Andrew S. Levey, . (1998) Effect of hepatitis C infection and renal transplantation on survival in end-stage renal disease1. Kidney International 53:5, 1374-1381
CrossRef95
M. Fiore, R. Ammendola, L. Gaetaniello, C. De Felice, R. Iorio, A. Vegnente, B. Balestrieri, G. Palmese, M. Sommantico, C. Pignata. (1998) Chronic Unexplained Liver Disease in Children With Primary Immunodeficiency Syndromes. Journal of Clinical Gastroenterology 26:3, 187-192
CrossRef96
Miriam J. Alter, Eric E. Mast, Linda A. Moyer, Harold S. Margolis. (1998) HEPATITIS C. Infectious Disease Clinics of North America 12:1, 13-26
CrossRef97
Jonathan C. Booth, Umesh Kumar, David Webster, John Monjardino, Howard C. Thomas. (1998) Comparison of the rate of sequence variation in the hypervariable region of E2/NS1 region of hepatitis C virus in normal and hypogammaglobulinemic patients. Hepatology 27:1, 223-227
CrossRef98
Jane Collier, Jenny Heathcote. (1998) Hepatitis C viral infection in the immunosuppressed patient. Hepatology 27:1, 2-6
CrossRef99
C. I. Edvard Smith, Carl-Magnus B
CrossRef100
James B. Bussel. (1997) Immune thrombocytopenia in pregnancy: autoimmune and alloimmune. Journal of Reproductive Immunology 37:1, 35-61
CrossRef101
Sarah C Darby, David W Ewart, Paul LF Giangrande, Rosemary JD Spooner, Charles R Rizza, Geoffrey M Dusheiko, Christine A Lee, Christopher A Ludlam, F Eric Preston. (1997) Mortality from liver cancer and liver disease in haemophilic men and boys in UK given blood products contaminated with hepatitis C. The Lancet 350:9089, 1425-1431
CrossRef102
WAC Sewell, CG Mullighan, J Christie, HM Chapel. (1997) HEPATITIS C AFTER INTRAVENOUS IMMUNOGLOBULIN. Annals of Allergy, Asthma & Immunology 79:5, 466
CrossRef103
Hugo R. Rosen, Sunwen Chou, Christopher L. Corless, David R. Gretch, Kenneth D. Flora, Alan Boudousquie, Susan L. Orloff, John M. Rabkin, Kent G. Benner. (1997) CYTOMEGALOVIRUS VIREMIA. Transplantation 64:5, 721-726
CrossRef104
Christine McCusker, Wendy Somerville, Vijaylaxmi Grey, Bruce Mazer. (1997) Specific Antibody Responses to Diphtheria/Tetanus Revaccination in Children Evaluated for Immunodeficiency. Annals of Allergy, Asthma & Immunology 79:2, 145-150
CrossRef105
Antoni Ribas, Anna Butturini, Anna Locasciulli, Maurizio Aricó, Robert Peter Gale. (1997) How important is hepatitis C virus (HCV)-infection in persons with acute leukemia?. Leukemia Research 21:8, 785-788
CrossRef106
Robert M. Pascuzzi, James D. Fleck. (1997) ACUTE PERIPHERAL NEUROPATHY IN ADULTS. Neurologic Clinics 15:3, 529-547
CrossRef107
E. RICHARD STIEHM. (1997) Human intravenous immunoglobulin in primary and secondary antibody deficiencies. The Pediatric Infectious Disease Journal 16:7, 696-707
CrossRef108
Hugo R. Rosen. (1997) Acquisition of hepatitis C by a conjunctival splash. American Journal of Infection Control 25:3, 242-247
CrossRef109
Garrett Adams, Sean Kuntz, Gerard Rabalais, Denise Bratcher, Carlo H. Tamburro, Girish J. Kotwal. (1997) NATURAL RECOVERY FROM ACUTE HEPATITIS C VIRUS INFECTION BY AGAMMAGLOBULINEMIC TWIN CHILDREN. The Pediatric Infectious Disease Journal 16:5, 533-534
CrossRef110
Süreyya Savaan, Volkan Tuzcu, Indira Warrier, Peter Karpawich. (1997) Cardiac Rhythm Abnormalities During Intravenous Immunoglobulin G Infusion for Treatment of Thrombocytopenia. Journal of Pediatric Hematology/Oncology 19:3, 254-257
CrossRef111
Thomas Peters, Hans-Joachim Schlayer, Bernhard Hiller, Bernd Rosier, Hubert Blum, Jens Rasenack. (1997) Quasispecies analysis in hepatitis C virus infection by fluorescent single strand conformation polymorphism. Journal of Virological Methods 64:1, 95-102
CrossRef112
H. CODY MEISSNER, ROBERT C. WELLIVER, STEPHEN A. CHARTRAND, DAVID R. FULTON, WILLIAM J. A. RODRIGUEZ, JESSIE R. GROOTHUIS. (1996) Prevention of Respiratory Syncytial Virus Infection in High Risk Infants: Consensus Opinion on the Role of Immunoprophylaxis with Respiratory Syncytial Virus Hyperimmune Globulin. The Pediatric Infectious Disease Journal 15:12, 1059-1068
CrossRef113
Hans D. Ochs, C. I. Edvard Smith. (1996) X-Linked Agammaglobulinemia. Medicine 75:6, 287-299
CrossRef114
J. Haem, P. Berthoux, J. F. Mosnier, F. Grattard, S. Cecillon, B. Pozzetto, E. Alamartine, F. Berthoux. (1996) CLEAR EVIDENCE OF THE EXISTENCE OF HEALTHY CARRIERS OF HEPATITIS C VIRUS AMONG RENAL TRANSPLANT RECIPIENTS. Transplantation 62:5, 699,700
CrossRef115
(1996) Long-Term Outcome of Hepatitis C Infection after Liver Transplantation. New England Journal of Medicine 335:7, 522-523
Full Text116
Ryo Sumazaki, Takako Matsubara, Takeshi Aoki, Yoji Nagai, Masanao Shibasaki, Hitoshi Takita. (1996) Rapidly progressive hepatitis C in a patient with common variable immunodeficiency. European Journal of Pediatrics 155:7, 532-534
CrossRef117
E. Richard Stiehm. (1996) Appropriate therapeutic use of immunoglobulin. Transfusion Medicine Reviews 10:3, 203-221
CrossRef118
Balu H. Athieya. (1996) Management of rheumatic diseases in children. The Indian Journal of Pediatrics 63:3, 305-321
CrossRef119
Robin Patel, David R. Snydman, Robert H. Rubin, Monto Ho, Mark Pescovitz, Maureen Martin, Carlos V. Paya. (1996) CYTOMEGALOVIRUS PROPHYLAXIS IN SOLID ORGAN TRANSPLANT RECIPIENTS. Transplantation 61:9, 1279-1289
CrossRef120
Tulio E. Bertorini, Adriana M. Nance, Linda H. Horner, William Greene, Michael S. Gelfand, J. Howard Jaster. (1996) Complications of intravenous gammaglobulin in neuromuscular and other diseases. Muscle & Nerve 19:3, 388-391
CrossRef121
Kenneth Flora, Mark Schiele, Kent Benner, Anthony Montanaro, Wendy Johnston, Ruth Whitham, Richard Press. (1996) An Outbreak of Acute Hepatitis C Among Recipients of Intravenous Immunoglobulin. Annals of Allergy, Asthma & Immunology 76:2, 160-162
CrossRef122
Isabella Quinti, Franco Pandolfi, Roberto Paganelli, Antonello Giovannetti, Giovanna Sacco, Alessandra Oliva, Fernando Aiuti. (1996) Hepatitis C virus infection in Italian patients with hypogammaglobulinemia. Clinical Therapeutics 18, 96-107
CrossRef123
Janne Björkander, Anders Fasth, Anders Widell. (1996) Intravenous Immunoglobulin and hepatitis C virus: the scandinavian experience. Clinical Therapeutics 18, 73-82
CrossRef124
Kusuya Nishioka. (1996) Hepatitis C virus screening and intravenous immunoglobulin safety in Japan. Clinical Therapeutics 18, 83-92
CrossRef125
A. Sánchez-Quijano, J. Andreu, F. Gavilán, F. Luque, M. A. Abad, B. Soto, J. Muñoz, J. M. Aznar, M. Leal, E. Lissen. (1995) Influence of human immunodeficiency virus type 1 infection on the natural course of chronic parenterally acquired Hepatitis C. European Journal of Clinical Microbiology & Infectious Diseases 14:11, 949-953
CrossRef126
I. QUINTI, F. PANDOLFI, R. PAGANELLI, D. EL SALMAN, A. GIOVANNETTI, R. ROSSO, A. OLIVA, L. RAINALDI, F. AIUTI. (1995) HCV infection in patients with primary defects of immunoglobulin production. Clinical & Experimental Immunology 102:1, 11-16
CrossRef127
Paula H.B. Bolton-Maggs. (1995) Idiopathic thrombocytopenic purpura. Current Paediatrics 5:3, 181-185
CrossRef128
Rosen, Fred S., Cooper, Max D., Wedgwood, Ralph J.P., . (1995) The Primary Immunodeficiencies. New England Journal of Medicine 333:7, 431-440
Full Text129
Freja Ebeling, Maija Baer, Pirkko Hormila, Greta Järventie, Pirjo Koistinen, Kalevi Kätkä, Kalevi Oksanen, Mikko Perkkiö, Tapani Ruutu, Esa Soppi, Lea Veijola, Gunnar Myllylä. (1995) Tolerability and Kinetics of a Solvent-Detergent-Treated Intravenous Immunoglobulin Preparation in Hypogammaglobulinaemia Patients. Vox Sanguinis 69:2, 91-94
CrossRef130
Victor S. Blanchette, Thomas Kühne, Heather Hume, Jonathan Hellmann. (1995) Platelet transfusion therapy in newborn infants. Transfusion Medicine Reviews 9:3, 215-230
CrossRef131
(1995) Hepatitis C and Immune Globulin. New England Journal of Medicine 332:18, 1235-1237
Full Text132
C. J. Tibbs. (1995) Methods of transmission of hepatitis C. Journal of Viral Hepatitis 2:3, 113-119
CrossRef133
(1995) Prophylactic Immune Globulin in Children with HIV Disease. New England Journal of Medicine 332:11, 750-752
Full Text134
M. Burnouf-Radosevich. (1995) Sécurité virale des préparations d'immunoglobulines G intraveineuses à usage thérapeutique. Transfusion Clinique et Biologique 2:3, 167-179
CrossRef135
Schiff, Richard I., . (1994) Transmission of Viral Infections through Intravenous Immune Globulin. New England Journal of Medicine 331:24, 1649-1650
Full Text
- Letters
