Join the 200th Anniversary Celebration

Original Article

Estrogen Resistance Caused by a Mutation in the Estrogen-Receptor Gene in a Man

Eric P. Smith, Jeff Boyd, Graeme R. Frank, Hiroyuki Takahashi, Robert M. Cohen, Bonny Specker, Timothy C. Williams, Dennis B. Lubahn, and Kenneth S. Korach

N Engl J Med 1994; 331:1056-1061October 20, 1994

Abstract

Background and Methods

Mutations in the estrogen-receptor gene have been thought to be lethal. A 28-year-old man whose estrogen resistance was caused by a disruptive mutation in the estrogen-receptor gene underwent studies of pituitary-gonadal function and bone density and received transdermal estrogen for six months. Estrogen-receptor DNA, extracted from lymphocytes, was evaluated by analysis of single-strand-conformation polymorphisms and by direct sequencing.

Results

The patient was tall (204 cm [80.3 in.]) and had incomplete epiphyseal closure, with a history of continued linear growth into adulthood despite otherwise normal pubertal development. He was normally masculinized and had bilateral axillary acanthosis nigricans. Serum estradiol and estrone concentrations were elevated, and serum testosterone concentrations were normal. Serum follicle-stimulating hormone and luteinizing hormone concentrations were increased. Glucose tolerance was impaired, and hyperinsulinemia was present. The bone mineral density of the lumbar spine was 0.745 g per square centimeter, 3.1 SD below the mean for age-matched normal women; there was biochemical evidence of increased bone turnover.

The patient had no detectable response to estrogen administration, despite a 10-fold increase in the serum free estradiol concentration. Conformation analysis of his estrogen-receptor gene revealed a variant banding pattern in exon 2. Direct sequencing of exon 2 revealed a cytosine-to-thymine transition at codon 157 of both alleles, resulting in a premature stop codon. The patient's parents were heterozygous carriers of this mutation, and pedigree analysis revealed consanguinity.

Conclusions

Disruption of the estrogen receptor in humans need not be lethal. Estrogen is important for bone maturation and mineralization in men as well as women.

Media in This Article

Figure 1Growth Chart of a 28-Year-Old Man with Estrogen Resistance and Radiographs of the Left Hand and Wrist and Left Knee.
Figure 2Mutation of the Estrogen-Receptor Gene.
Article

The actions of adrenal and gonadal steroids, thyroid hormone, and vitamin D are mediated by receptors encoded by a family of related genes. Mutations of glucocorticoid, androgen, thyroid hormone, and vitamin D receptors leading to syndromes of hormone resistance have been reported1-4. It has been thought that mutation of the estrogen-receptor gene would be lethal, affecting embryo implantation in particular5. Recent insertional disruption of the mouse estrogen-receptor gene6 and two case reports,7,8 however, raise questions about the validity of the lethality hypothesis and reveal intriguing phenotypes. In mice with disrupted estrogen-receptor genes, both sexes are viable. The affected female mice have hypoplastic breasts and uteri, hyperemic cystic ovaries without corpora lutea, infertility, and decreased skeletal mineralization; the male mice have decreased skeletal mineralization and low sperm counts.

The first case report7 involving decreased estrogen synthesis described a female patient with pseudohermaphroditism due to placental aromatase deficiency, suggesting that, at least beginning late in the first trimester, excess androgen with low or absent estrogen in the female fetus is compatible with life. The second case report8 described a karyotypically female patient with pseudohermaphroditism caused by a null mutation in the aromatase cytochrome P-450 gene. At puberty progressive virilization without breast development or growth acceleration was noted. Estrogen treatment resulted in normal breast development, a pubertal growth spurt, and menarche, suggesting that androgen is relatively ineffective in stimulating pubertal growth.

In this report, we describe a man with estrogen resistance who had osteoporosis, unfused epiphyses, and continuing linear growth in adulthood. He also had elevated serum estrogen concentrations, abnormal gonadotropin secretion, and no target-tissue responses to estrogen therapy. Analysis of the estrogen-receptor gene revealed a change in a single base pair in the second exon, generating a premature stop codon. These findings indicate that estrogen-receptor mutations need not be lethal and that estrogen is important in the male, as it is in the female, for normal skeletal growth and development.

Case Report

A 28-year-old white man presented to an orthopedic surgeon with tall stature and a four-to-five-year history of progressive genu valgum. Because radiologic evaluation revealed unfused epiphyses, he was referred for further evaluation. His birth weight and early growth and development were within normal limits, and his stature was in the average range. He first noted pubic and axillary hair at 12 to 13 years of age and started shaving regularly at age 17 to 18 years of age but had no recollection of associated growth acceleration. His height at the age of 16 was approximately 178 cm (70 in.) according to information provided on his driver's license (Figure 1Figure 1Growth Chart of a 28-Year-Old Man with Estrogen Resistance and Radiographs of the Left Hand and Wrist and Left Knee.). His legs and feet continued to grow slowly after adolescence.

Review of the family history revealed four sisters who were average in stature (160 to 165 cm [63 to 65 in.]). His mother was 162 cm (64 in.) tall, and his father was 180 cm (71 in.). His mother was given a diagnosis of non-insulin-dependent diabetes mellitus at the age of 45 years. A paternal uncle had colon cancer, two maternal cousins had insulin-dependent diabetes mellitus (one of whom was given the diagnosis in infancy), and a niece had XO/XY mixed gonadal dysgenesis.

The patient had a history of Osgood-Schlatter disease, which was diagnosed when he was 20 years of age and was treated with rest. At the age of 24, a meniscal tear in the right knee required arthroscopic surgery and the results of a glucose-tolerance test were reportedly slightly abnormal. There was no history of polyuria, polydipsia, blurred vision, or nocturia. The patient did not recall any change in facial structure, thickening or oiliness of the skin, excessive diaphoresis, skin tags, or changes in his voice. He did remember noticing increased pigment in the skin of each axilla starting at the age of 23. Though unmarried, he reported no history of gender-identity disorder. He indicated strong heterosexual interests and had normal functioning, including morning erections and nocturnal emissions.

Physical examination revealed a tall, healthy-appearing man with no acromegaloid features but with obvious genu valgum. His height was 204 cm (80.3 in.) (>95th percentile), weight 127 kg (280 lb), heart rate 80 per minute, and blood pressure 140/85 mm Hg. The upper segment of his body was 96 cm (37.7 in.), and his lower segment was 109 cm (42.9 in.), yielding a ratio of the upper segment to the lower segment of 0.88 (average for men, 0.96). His left middle finger measured 10 cm (3.9 in.) (97th percentile, 9 cm), left hand 23 cm (8.9 in.) (97th percentile, 19.5 cm), and foot 33 cm (13 in.) (97th percentile, 29 cm). He had an arm span of 213 cm (83.8 in.). There was bilateral axillary acanthosis nigricans and a 0.5-cm skin tag in the left axilla. The patient had a full beard with early temporal hair loss. There was no thyroid enlargement or gynecomastia. The results of cardiovascular, respiratory, and abdominal examinations were normal. The patient had normal male genitalia with bilateral descended testes, each with a volume of 20 to 25 ml, and a normal-sized prostate gland.

Radiography of his left wrist and hand revealed a bone age of 15 years9 (Figure 1). Knee films revealed open epiphyses (Figure 1); a review of radiographs from previous orthopedic evaluations demonstrated minimal evidence of epiphyseal maturation over a 10-year period and demineralized bones. The density of the lumbar spine, measured by dual-energy x-ray absorptiometry (Hologic, Waltham, Mass.), was 0.745 g per square centimeter (3.1 SD below the mean for age-matched normal women and more than 2 SD below the mean for 15-year-old boys [the patient's bone age]). The karyotype was 46,XY. Semen analysis revealed a sperm density of 25 million per milliliter (normal, >20 million per milliliter), with a viability of 18 percent (normal, >50 percent). The results of initial laboratory tests are shown in Table 1Table 1Biochemical Measurements before and after Four and Six Months of Transdermal Ethinyl Estradiol Therapy in a Man with Estrogen Resistance.. The serum testosterone concentration was normal, and estradiol, estrone, follicle-stimulating hormone, and luteinizing hormone concentrations were high. A five-hour oral glucose-tolerance test (75 g) revealed a fasting blood glucose concentration of 135 mg per deciliter (7.6 mmol per liter), a peak response of 224 mg per deciliter (12.5 mmol per liter) at three hours, and a concentration of 163 mg per deciliter (9.1 mmol per liter) at five hours. The respective serum insulin values were 50 micro U per milliliter (300 pmol per liter), 114 micro U per milliliter (684 pmol per liter), and 93 micro U per milliliter (558 pmol per liter).

On the basis of the hypothesis that primary estrogen resistance might explain the elevated serum estrogen and abnormal serum gonadotropin concentrations, failure of epiphyseal fusion, and possibly insulin resistance, the patient was treated with high-dose transdermal ethinyl estradiol (Estraderm patch system, Ciba, Summit, N.J.) for six months. The starting dose was 2 100-μg patches per week, with 100-μg increments each week until a maintenance dose of 14 100-μg patches per week was reached. The dose was based on clinical experience with men treated with high doses of estrogen for either prostate cancer or transsexual conversion10,11. This protocol was approved by the Cincinnati Children's Hospital institutional review board, and the patient gave informed consent.

The serum hormone and metabolic measurements before and after four and six months of estrogen therapy are shown in Table 1. (All serial tests in Table 1 were performed at the Nichols Institute, San Juan Capistrano, Calif., and for each assay, results were analyzed simultaneously for purposes of comparison).

During estrogen therapy, the patient had no nausea, fluid retention, hypertension, unusual headaches, weight gain, gynecomastia, impotence, or mood alterations. In addition, there was no significant increase in the serum concentration of any estrogen-dependent protein (sex hormone-binding globulin, thyroxine-binding globulin, cortisol-binding globulin, or prolactin) or change in serum gonadotropin concentrations (Table 1). The results of tests of bone turnover were all consistent with active bone demineralization and did not decrease. Finally, total bone mineral density and bone age did not change during estrogen administration.

Because of the patient's resistance to estrogen, peripheral-blood lymphocyte DNA was obtained to study his estrogen-receptor gene by analysis of single-strand-conformation polymorphisms12. Exons 1 through 813 were independently amplified by the polymerase chain reaction (PCR) and subjected to single-strand-conformation analysis with DNA from several normal subjects as a control. All exons were wild type, with the exception of exon 2, which had a variant banding pattern suggestive of a homozygous mutation (Figure 2BFigure 2Mutation of the Estrogen-Receptor Gene.). Direct sequencing of the exon 2 product revealed the substitution of thymine for cytosine at codon 157 (Figure 2C), resulting in the replacement of an arginine codon (CGA) with a premature stop codon (TGA). The translated protein would therefore be severely truncated, lacking the DNA-binding and hormone-binding domains (Figure 2A), and expected to be functionally inert. Because the mutation was homozygous, the patient's parents were interviewed to obtain a more detailed family history. The family pedigree (Figure 3Figure 3Pedigree of a Man with Estrogen Resistance Demonstrating Consanguinity (Double Lines).) demonstrates that his parents were second cousins. On the basis of slot blot analyses performed with wild-type and mutant oligonucleotide probes (Figure 4AFigure 4Parental Origin of the Mutation of the Estrogen-Receptor Gene.) and direct sequence analysis (Figure 4B), each parent, as well as three of the patient's four sisters, proved to be heterozygous for the mutation, a finding consistent with autosomal recessive inheritance.

Methods

The coding region of the estrogen-receptor gene was amplified by PCR. Primer sequences for the eight coding exons of the gene were designed on the basis of information on the exon-intron junction sequence13. The forward primer sequence for exon 2 was 5'CCCAGGCCAAATTCAGATAA3', and the reverse primer sequence was 5'CGTTTTCAACACACTATTAC3'. PCR was carried out with 35 cycles consisting of one minute at 94 °C, one minute at 55 °C, and one minute at 72 °C. The reaction mixtures were heated at 94 °C for 90 seconds before the first cycle and at 72 °C for 7 minutes after the last cycle. After amplification, a 4-microliter aliquot of the product was diluted with denaturing buffer, heated at 95 °C for five minutes, and cooled on ice for five minutes; 3 to 4 microliters of this solution was used for electrophoresis.

The gels used for single-strand-conformation analysis consisted of 0.5X MDE solution (AT Biochem, Malvern, Pa.) and 0.6X TBE buffer (89 mM Tris, 89 mM borate, and 2 mM EDTA), and they were run in 0.6X TBE buffer at 8 W for 16 hours at room temperature. For sequence analysis, both strands of the purified exon 2 products obtained by PCR were subjected to cycle sequencing with a double-stranded DNA Cycle Sequencing System (Life Technologies, Gaithersburg, Md.) as specified by the manufacturer, except that [γ-33P]ATP was used for primer labeling. Sequencing reaction samples were run on a 6 percent polyacrylamide gel containing 8.3 M urea at 70 W for two to four hours at room temperature and processed for autoradiography according to standard procedures.

Discussion

The findings in this man with a naturally occurring disruptive mutation of the estrogen-receptor gene demonstrate that mutations in this gene need not be lethal. The major phenotypic manifestations of estrogen resistance that he demonstrated were tall stature with evidence of continued slow linear growth, markedly delayed skeletal maturation, and osteoporosis. These abnormalities provide compelling evidence of the critical part played by estrogen in bone development and mineralization during puberty not only in girls but also in boys.

The pubertal growth spurt and epiphyseal maturation are considered to be induced primarily by the actions of sex steroids, estrogen in the female and androgen in the male. The close association of sex steroids and advancement of bone age is well demonstrated in precocious puberty, which is characterized by a premature increase in sex-steroid secretion, increased height velocity, accelerated epiphyseal maturation, and reduced final adult height15. Despite the normal timing of pubertal onset and normal serum androgen concentrations, this adult with estrogen resistance had a bone age of 15 years and a slow continued increase in height during his third decade. His presentation is similar to that of a genetic female with pseudohermaphroditism caused by an aromatase-gene defect in whom androgen was present in the absence of circulating estrogen, rather than estrogen resistance8,16. Despite virilization at puberty, the patient's bone age was delayed relative to her chronologic age, and she had no growth spurt16. However, unlike the results in this man with estrogen insensitivity, her treatment with estrogen resulted in growth acceleration, advancement of bone age, and breast development. Finally, our patient's phenotype is consistent with that associated with two other conditions, testotoxicosis and androgen insensitivity. In testotoxicosis, in which there is autonomous production of androgen from the testes, therapy with an antiandrogen alone is not sufficient to slow skeletal growth to a prepubertal rate; this is achieved by the addition of an aromatase inhibitor17. Patients with complete androgen insensitivity have a pubertal growth spurt that is normal for a genetic female in both magnitude and timing18. This man's phenotype confirms what these earlier clinical observations suggested -- namely, that estrogen has a critical role in pubertal growth and epiphyseal maturation in both sexes.

Although the importance of estrogen deficiency in the pathogenesis of osteoporosis in postmenopausal women is well known, many clinical observations have supported the idea that androgen is important for the maintenance of bone mass in men. Men with hypogonadism have osteoporosis19,20; decreased serum testosterone concentrations in elderly men are a risk factor for fractures21; men with a history of constitutional delay of puberty have decreased bone density as adults22; and androgenic steroids increase bone mass23. This man with estrogen resistance had a severely undermineralized skeleton with biochemical evidence of increased bone resorption24,25 despite normal serum androgen concentrations. These observations indicate that androgen alone is not sufficient to promote skeletal maturation and retain bone mass and that estrogen has a pivotal role in the mineralization of the skeleton in males as well as females.

The elevated serum estrogen concentrations in this man suggest a compensatory increase in aromatase activity in response to estrogen resistance, and increased aromatase activity could account for the normal concentrations of androgen despite increased secretion of luteinizing hormone. In men, multiple tissues are involved in the aromatization of androgen to form estrogen, including the testes, liver, skin, and adipose tissue26,27. Testicular estrogen secretion is stimulated by luteinizing hormone, making the testis the most likely source of the elevated serum estrogen concentrations in this man. His elevated gonadotropin secretion suggests that estrogen plays a part in the regulation of gonadotropin secretion in men.

The relation of insulin resistance, glucose intolerance, and acanthosis nigricans to estrogen resistance in the patient is intriguing. Isolated increases in estrogen improve glucose tolerance by enhancing either target-tissue responsiveness to insulin or insulin secretion28-30. Acanthosis nigricans is a cutaneous marker of insulin resistance, especially when insulin resistance is associated with relative hyperandrogenism31. In this man, loss of estrogen effect or an altered balance of androgen and estrogen action may well account for diminished insulin sensitivity, glucose intolerance, and acanthosis nigricans. The elevated serum concentration of sex hormone-binding globulin, an estrogen-dependent protein, is unexplained.

It is possible that mutations causing milder estrogen resistance exist, and that compensatory hyperestrogenemia can overcome the resistance and result in a normal phenotype. The absence of lethality and the rather striking phenotype in either sex suggest that previous cases would eventually have been appropriately diagnosed. It is possible that heterozygous women may have impaired fertility, thus reducing the incidence of the mutation in the population and decreasing the prevalence of homozygous cases. Notably, the patient's mother had three spontaneous abortions. Regardless, this patient's diagnosis suggests that there are likely to be other patients with phenotypic presentations of variable severity. Estrogen-receptor defects should be included in the differential diagnosis of such apparently disparate entities as tall stature, unfused epiphyses, osteoporosis, abnormal gonadotropin secretion, and infertility.

Supported in part by the Children's Hospital-University of Cincinnati Clinical Research Center (under grant MO1 RR 08084) and by a clinical research grant (to Dr. Cohen) from the American Diabetes Association. Dr. Lubahn was a Pew Scholar.

We are indebted to Drs. Judson J. Van Wyk, Frank S. French, Robert M. Blizzard, Hartmut Malluche, Penelope Manasco, and Philip S. Zeitler for helpful discussions of this case; to Dr. Richard Jolson, the orthopedic surgeon who first recognized the abnormal epiphyseal maturation; to Nichols Institute for performing numerous assays before and during the estrogen therapy; to Dr. Nancy D. Leslie for lymphocyte transformation; to Ms. JoAnn Horn for technical assistance; and to Ms. Vicki Livengood for assistance in the preparation of the manuscript.

Source Information

From the Department of Pediatrics, Divisions of Endocrinology (E.P.S., G.R.F.) and Neonatology (B.S.), Children's Hospital Medical Center, University of Cincinnati College of Medicine, Cincinnati; the Department of Internal Medicine, Division of Endocrinology, University of Cincinnati College of Medicine, Cincinnati (R.M.C., T.C.W.); the Departments of Pediatrics and Pathology, University of North Carolina School of Medicine at Chapel Hill, Chapel Hill (D.B.L.); and the Gynecologic Pathobiology Group, Laboratory of Molecular Carcinogenesis (J.B., H.T.), and Receptor Biology Section, Laboratory and Developmental Toxicology (K.S.K.), National Institute of Environmental Health Sciences, National Institutes of Health, Research Triangle Park, N.C.

Address reprint requests to Dr. Smith at the Department of Pediatrics, Division of Endocrinology, Children's Hospital Medical Center, 3333 Burnett Ave., Cincinnati, OH 45229.

References

References

  1. 1

    Chrousos GP, Detera-Wadleigh SD, Karl M. Syndromes of glucocorticoid resistance. Ann Intern Med 1993;119:1113-1124
    Web of Science | Medline

  2. 2

    McDermott MT, Ridgway EC. Thyroid hormone resistance syndromes. Am J Med 1993;94:424-432
    CrossRef | Web of Science | Medline

  3. 3

    Brooks MH, Bell NH, Love L, et al. Vitamin-D-dependent rickets type II: resistance of target organs to 1,25-dihydroxyvitamin D. N Engl J Med 1978;298:996-999
    Full Text | Web of Science | Medline

  4. 4

    Brown TR, Lubahn DB, Wilson EM, French FS, Migeon CJ, Corden JL. Functional characterization of naturally occurring mutant androgen receptors from subjects with complete androgen insensitivity. Mol Endocrinol 1990;4:1759-1772
    CrossRef | Web of Science | Medline

  5. 5

    George FW, Wilson JD. Sex determination and differentiation. In: Knobil E, Neill JD, eds. The physiology of reproduction. New York: Raven Press, 1988:3-26.

  6. 6

    Lubahn DB, Moyer JS, Golding TS, Couse JF, Korach KS, Smithies O. Alteration of reproductive function but not prenatal sexual development after insertional disruption of the mouse estrogen receptor gene. Proc Natl Acad Sci U S A 1993;90:11162-11166
    CrossRef | Web of Science | Medline

  7. 7

    Shozu M, Akasofu K, Harada T, Kubota Y. A new cause of female pseudohermaphroditism: placental aromatase deficiency. J Clin Endocrinol Metab 1991;72:560-566
    CrossRef | Web of Science | Medline

  8. 8

    Ito Y, Fisher CR, Conte FA, Grumbach MM, Simpson ER. Molecular basis of aromatase deficiency in an adult female with sexual infantilism and polycystic ovaries. Proc Natl Acad Sci U S A 1993;90:11673-11677
    CrossRef | Web of Science | Medline

  9. 9

    Greulich WW, Pyle SI. Radiographic atlas of skeletal development of the hand and wrist. 2nd ed. Stanford, Calif.: Stanford University Press, 1959.

  10. 10

    Carlstrom K, Collste L, Eriksson A, et al. A comparison of androgen status in patients with prostatic cancer treated with oral and/or parenteral estrogens or by orchidectomy. Prostate 1989;14:177-182
    CrossRef | Web of Science | Medline

  11. 11

    Valenta LJ, Elias AN, Domurat ES. Hormone pattern in pharmacologically feminized male transsexuals in the California State prison system. J Natl Med Assoc 1992;84:241-250
    Web of Science | Medline

  12. 12

    Orita M, Suzuki Y, Sekiya T, Hayashi K. Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 1989;5:874-879
    CrossRef | Web of Science | Medline

  13. 13

    Ponglikitmongkol M, Green S, Chambon P. Genomic organization of the human oestrogen receptor gene. EMBO J 1988;7:3385-3388
    Web of Science | Medline

  14. 14

    Boyd J, Risinger JI. Analysis of oncogene alterations in human endometrial carcinoma: prevalence of ras mutations. Mol Carcinog 1991;4:189-195
    CrossRef | Web of Science | Medline

  15. 15

    Kaplan SL, Grumbach MM. Pathophysiology and treatment of sexual precocity. J Clin Endocrinol Metab 1990;71:785-789
    CrossRef | Web of Science | Medline

  16. 16

    Conte FA, Grumbach MM, Ito Y, Fisher CR, Simpson ER. A syndrome of female pseudohermaphrodism, hypergonadotropic hypogonadism, and multicystic ovaries associated with missense mutations in the gene encoding aromatase (P450arom). J Clin Endocrinol Metab 1994;78:1287-1292
    CrossRef | Web of Science | Medline

  17. 17

    Laue L, Kenigsberg D, Pescovitz OH, et al. Treatment of familial male precocious puberty with spironolactone and testolactone. N Engl J Med 1989;320:496-502
    Full Text | Web of Science | Medline

  18. 18

    Zachmann M, Prader A, Sobel EH, et al. Pubertal growth in patients with androgen insensitivity: indirect evidence for the importance of estrogens in pubertal growth of girls. J Pediatr 1986;108:694-697
    CrossRef | Web of Science | Medline

  19. 19

    Finkelstein JS, Klibanski A, Neer RM, Greenspan SL, Rosenthal DI, Crowley WF Jr. Osteoporosis in men with idiopathic hypogonadotropic hypogonadism. Ann Intern Med 1987;106:354-361
    Web of Science | Medline

  20. 20

    Foresta C, Ruzza G, Mioni R, et al. Osteoporosis and decline of gonadal function in the elderly male. Horm Res 1984;19:18-22
    CrossRef | Web of Science | Medline

  21. 21

    Swartz CM, Young MA. Male hypogonadism and bone fracture. N Engl J Med 1988;318:996-996
    Web of Science | Medline

  22. 22

    Finkelstein JS, Neer RM, Biller BMK, Crawford JD, Klibanski A. Osteopenia in men with a history of delayed puberty. N Engl J Med 1992;326:600-604
    Full Text | Web of Science | Medline

  23. 23

    Dequeker J, Geusens P. Anabolic steroids and osteoporosis. Acta Endocrinol Suppl (Copenh) 1985;271:45-52
    Medline

  24. 24

    Siebel MJ, Robins SP, Bilezikian JP. Urinary pyridinium crosslinks of collagen: specific markers of bone resorption in metabolic disease. Trends Endocrinol Metab 1992;3:263-270
    CrossRef | Web of Science | Medline

  25. 25

    Hanson DA, Weis MA, Bollen AM, Maslan SL, Singer FR, Eyre DR. A specific immunoassay for monitoring human bone resorption: quantitation of type I collagen cross-linked N-telopeptides in urine. J Bone Miner Res 1992;7:1251-1258
    CrossRef | Web of Science | Medline

  26. 26

    Bhatnagar AS, Muller P, Schenkel L, Trunet PF, Beh I, Schieweck K. Inhibition of estrogen biosynthesis and its consequences on gonadotrophin secretion in the male. J Steroid Biochem Mol Biol 1992;41:437-443
    CrossRef | Web of Science | Medline

  27. 27

    MacDonald PC, Madden JD, Brenner PF, Wilson JD, Siiteri PK. Origin of estrogen in normal men and in women with testicular feminization. J Clin Endocrinol Metab 1979;49:905-916
    CrossRef | Web of Science | Medline

  28. 28

    Sharp SC, Diamond MP. Sex steroids and diabetes. Diabetes Rev 1993;1:318-342

  29. 29

    Leiter EH, Beamer WG, Coleman DL, Longcope C. Androgenic and estrogenic metabolites in serum of mice fed dehydroepiandrosterone: relationship to antihyperglycemic effects. Metabolism 1987;36:863-869
    CrossRef | Web of Science | Medline

  30. 30

    Prochazka M, Premdas FH, Leiter EH, Lipson LG. Estrone treatment dissociates primary versus secondary consequences of “diabetes” (db) gene expression in mice. Diabetes 1986;35:725-728
    CrossRef | Web of Science | Medline

  31. 31

    Barbieri RL, Ryan KJ. Hyperandrogenism, insulin resistance, and acanthosis nigricans syndrome: a common endocrinopathy with distinct pathophysiologic features. Am J Obstet Gynecol 1993;147:90-101

Citing Articles (669)

Citing Articles

  1. 1

    Gaurav Swarnkar, Kunal Sharan, Jawed A Siddiqui, Jay Sharan Mishra, Kainat Khan, Mohd Parvez Khan, Varsha Gupta, Preeti Rawat, Rakesh Maurya, Anil K Dwivedi, Sabyasachi Sanyal, Naibedya Chattopadhyay. (2012) A naturally occurring naringenin derivative exerts potent bone anabolic effects by mimicking oestrogen action on osteoblasts. British Journal of Pharmacology 165:5, 1526-1542
    CrossRef

  2. 2

    Xita Nectaria, Lazaros Leandros, Georgiou Ioannis, Tsatsoulis Agathocles. (2012) The importance of ERα and ERβ gene polymorphisms in PCOS. Gynecological Endocrinology1-4
    CrossRef

  3. 3

    Marcio Masashi Kajikawa, Zsuzsanna Ilona Katalin Jármy-Di Bella, Gustavo Rubino de Azevedo Focchi, Juliane Dornelas, Manoel João Batista Castello Girão, Marair Gracio Ferreira Sartori. (2012) Role of estrogen receptor alpha on vaginal epithelialization of patients with Mayer–Rokitansky–Kuster–Hauser syndrome submitted to neovaginoplasty using oxidized regenerated cellulose. International Urogynecology Journal
    CrossRef

  4. 4

    Claes Ohlsson, Anna E Börjesson, Liesbeth Vandenput. (2012) Sex steroids and bone health in men. BoneKEy Reports 1,
    CrossRef

  5. 5

    Tsuyoshi Miyajima, Yoon Taek Kim, Hiromi Oda. (2012) A study of changes in bone metabolism in cases of gender identity disorder. Journal of Bone and Mineral Metabolism
    CrossRef

  6. 6

    Christa Maes, Henry M. Kronenberg. 2012. Postnatal Bone Growth: Growth Plate Biology, Bone Formation, and Remodeling. , 55-82.
    CrossRef

  7. 7

    Jun Wang, Paula H. Stern. (2011) Sex-specific effects of estrogen and androgen on gene expression in human monocyte-derived osteoclasts. Journal of Cellular Biochemistry 112:12, 3714-3721
    CrossRef

  8. 8

    Carmela Guido, Ida Perrotta, Salvatore Panza, Emilia Middea, Paola Avena, Marta Santoro, Stefania Marsico, Pietro Imbrogno, Sebastiano Andò, Saveria Aquila. (2011) Human sperm physiology: Estrogen receptor alpha (ERα) and estrogen receptor beta (ERβ) influence sperm metabolism and may be involved in the pathophysiology of varicocele-associated male infertility. Journal of Cellular Physiology 226:12, 3403-3412
    CrossRef

  9. 9

    Xin-Feng Li, Shan-Jin Wang, Lei-Sheng Jiang, Li-Yang Dai. (2011) Gender- and region-specific variations of estrogen receptor α and β expression in the growth plate of spine and limb during development and adulthood. Histochemistry and Cell Biology
    CrossRef

  10. 10

    Neera Gupta, Robert H. Lustig, Michael A. Kohn, Marjorie McCracken, Eric Vittinghoff. (2011) Sex differences in statural growth impairment in Crohn's disease: Role of IGF-1. Inflammatory Bowel Diseases 17:11, 2318-2325
    CrossRef

  11. 11

    Guillermo Martínez Díaz-Guerra, Sonsoles Guadalix Iglesias, Federico Hawkins Carranza. (2011) Etiopatogenia y tratamiento de la osteoporosis y fracturas del varón adulto. Medicina Clínica 137:14, 656-662
    CrossRef

  12. 12

    E. J. Mackie, L. Tatarczuch, M. Mirams. (2011) The skeleton: a multi-functional complex organ. The growth plate chondrocyte and endochondral ossification. Journal of Endocrinology 211:2, 109-121
    CrossRef

  13. 13

    J. Argente, J.F. Sotos. (2011) Hipercrecimientos con y sin obesidad: fundamentos clínicos y moleculares. Anales de Pediatría
    CrossRef

  14. 14

    Michael Centrella, Thomas L. McCarthy. (2011) Estrogen receptor dependent gene expression by osteoblasts – Direct, indirect, circumspect, and speculative effects. Steroids
    CrossRef

  15. 15

    Jae-Hwan Jeong, Je-Yong Choi. (2011) Interrelationship of Runx2 and estrogen pathway in skeletal tissues. BMB Reports 44:10, 613-618
    CrossRef

  16. 16

    Jan M. Wit, Matti Hero, Susan B. Nunez. (2011) Aromatase inhibitors in pediatrics. Nature Reviews Endocrinology
    CrossRef

  17. 17

    David Ontjes. 2011. Hormone Actions in the Regulation of Calcium and Phosphorus Metabolism. .
    CrossRef

  18. 18

    Nelly Mauras. (2011) Strategies for Maximizing Growth in Puberty in Children with Short Stature. Pediatric Clinics of North America 58:5, 1167-1179
    CrossRef

  19. 19

    Alfred Tenore, Daniela Driul. (2011) Genomics in Pediatric Endocrinology—Genetic Disorders and New Techniques. Pediatric Clinics of North America 58:5, 1061-1081
    CrossRef

  20. 20

    Yong Xu, Thekkethil P. Nedungadi, Liangru Zhu, Nasim Sobhani, Boman G. Irani, Kathryn E. Davis, Xiaorui Zhang, Fang Zou, Lana M. Gent, Lisa D. Hahner, Sohaib A. Khan, Carol F. Elias, Joel K. Elmquist, Deborah J. Clegg. (2011) Distinct Hypothalamic Neurons Mediate Estrogenic Effects on Energy Homeostasis and Reproduction. Cell Metabolism 14:4, 453-465
    CrossRef

  21. 21

    Sarah Hart-Unger, Kenneth S. Korach. (2011) Estrogens and Obesity: Is It All in Our Heads?. Cell Metabolism 14:4, 435-436
    CrossRef

  22. 22

    R. A. Marquez Hernandez, J. Ohtani, T. Fujita, H. Sunagawa, T. Kawata, M. Kaku, M. Motokawa, K. Tanne. (2011) Sex hormones receptors play a crucial role in the control of femoral and mandibular growth in newborn mice. The European Journal of Orthodontics 33:5, 564-569
    CrossRef

  23. 23

    Maria Giovanna Sabbieti, Dimitrios Agas, Francesco Palermo, Gilberto Mosconi, Giorgio Santoni, Consuelo Amantini, Valerio Farfariello, Luigi Marchetti. (2011) 4-Nonylphenol triggers apoptosis and affects 17-β-Estradiol receptors in calvarial osteoblasts. Toxicology
    CrossRef

  24. 24

    Monika Puzianowska-Kuźnicka. (2011) ESR1 in myocardial infarction. Clinica Chimica Acta
    CrossRef

  25. 25

    V. Ribas, B. G. Drew, J. A. Le, T. Soleymani, P. Daraei, D. Sitz, L. Mohammad, D. C. Henstridge, M. A. Febbraio, S. C. Hewitt, K. S. Korach, S. J. Bensinger, A. L. Hevener. (2011) Myeloid-specific estrogen receptor   deficiency impairs metabolic homeostasis and accelerates atherosclerotic lesion development. Proceedings of the National Academy of Sciences 108:39, 16457-16462
    CrossRef

  26. 26

    Wei Huang, Wei-lin Shang, De-hao Li, Wen-wen Wu, Shu-xun Hou. (2011) Simvastatin protects osteoblast against H2O2-induced oxidative damage via inhibiting the upregulation of Nox4. Molecular and Cellular Biochemistry
    CrossRef

  27. 27

    Rodrigo P.A. Barros, Jan-Åke Gustafsson. (2011) Estrogen Receptors and the Metabolic Network. Cell Metabolism 14:3, 289-299
    CrossRef

  28. 28

    M. R. Meyer, D. J. Clegg, E. R. Prossnitz, M. Barton. (2011) Obesity, insulin resistance and diabetes: sex differences and role of oestrogen receptors. Acta Physiologica 203:1, 259-269
    CrossRef

  29. 29

    Kathryn E. Ackerman, Gary S. Skrinar, Eva Medvedova, Madhusmita Misra, Karen K Miller. (2011) Estradiol Levels Predict Bone Mineral Density in Male Collegiate Athletes: A Pilot Study. Clinical Endocrinologyno-no
    CrossRef

  30. 30

    Eric R. Prossnitz, Matthias Barton. (2011) The G-protein-coupled estrogen receptor GPER in health and disease. Nature Reviews Endocrinology 7:12, 715-726
    CrossRef

  31. 31

    Jarmo Jääskeläinen. (2011) Molecular biology of androgen insensitivity. Molecular and Cellular Endocrinology
    CrossRef

  32. 32

    Peter J. Simm, Vincenzo C. Russo, George A. Werther. (2011) The effect of selective oestrogen receptor antagonists in an in vitro model of growth plate chondrogenesis. Endocrine 40:1, 27-34
    CrossRef

  33. 33

    Amit Assa, Mordechai Weiss, Dorit Aharoni, Anat Mor, Mariana Rachmiel, Tzvi Bistritzer. (2011) Evaluation of bone density in girls with precocious and early puberty during treatment with GnRH agonist. Journal of Pediatric Endocrinology and Metabolism 24:7-8, 505-510
    CrossRef

  34. 34

    Christopher J. Dy, Lauren E. LaMont, Quang V. Ton, Joseph M. Lane. (2011) Sex and Gender Considerations in Male Patients With Osteoporosis. Clinical Orthopaedics and Related Research® 469:7, 1906-1912
    CrossRef

  35. 35

    Aviva B. Sopher, Amy M. Jean, Sarah K. Zwany, Diana M. Winston, Christy B. Pomeranz, Jennifer J. Bell, Donald J. McMahon, Abeer Hassoun, Ilene Fennoy, Sharon E. Oberfield. (2011) Bone Age Advancement in Prepubertal Children With Obesity and Premature Adrenarche: Possible Potentiating Factors. Obesity 19:6, 1259-1264
    CrossRef

  36. 36

    A Ferlin, M Schipilliti, C Foresta. (2011) Bone density and risk of osteoporosis in Klinefelter syndrome. Acta Paediatrica 100:6, 878-884
    CrossRef

  37. 37

    Loredana Cavalli, Maria Luisa Brandi. (2011) Age- and gender-related macro- and micro-architecture changes in bone structure and implications for treatment. International Journal of Clinical Rheumatology 6:3, 359-369
    CrossRef

  38. 38

    Tomaz Büdefeld, Stuart A. Tobet, Gregor Majdic. (2011) Steroidogenic factor 1 and the central nervous system. Journal of Neuroendocrinologyno-no
    CrossRef

  39. 39

    Jean-François Arnal, Françoise Lenfant, Gilles Flouriot, Florence Tremollières, Henrik Laurell, Coralie Fontaine, Andrée Krust, Pierre Chambon, Pierre Gourdy. (2011) From in vivo gene targeting of Estrogen Receptors to Optimisation of their Modulation in Menopause. British Journal of Pharmacologyno-no
    CrossRef

  40. 40

    Brittany K. Gorres, Gregory L. Bomhoff, Jill K. Morris, Paige C. Geiger. (2011) In vivo stimulation of oestrogen receptor α increases insulin-stimulated skeletal muscle glucose uptake. The Journal of Physiology 589:8, 2041-2054
    CrossRef

  41. 41

    A. E. Borjesson, S. H. Windahl, M. K. Lagerquist, C. Engdahl, B. Frenkel, S. Moverare-Skrtic, K. Sjogren, J. M. Kindblom, A. Stubelius, U. Islander, M. C. Antal, A. Krust, P. Chambon, C. Ohlsson. (2011) Roles of transactivating functions 1 and 2 of estrogen receptor-  in bone. Proceedings of the National Academy of Sciences 108:15, 6288-6293
    CrossRef

  42. 42

    Pratyush Kumar, Satish Rao, Sudha D. Kamath, Vijendra Prabhu, K. Satyamoorthy, K.K. Mahato. (2011) Autofluorescence of Osteoporotic Mouse Femur Bones: A Pilot Study. Photomedicine and Laser Surgery 29:4, 227-232
    CrossRef

  43. 43

    Gregor Majdic, Stuart Tobet. (2011) Cooperation of sex chromosomal genes and endocrine influences for hypothalamic sexual differentiation. Frontiers in Neuroendocrinology 32:2, 137-145
    CrossRef

  44. 44

    Janina M. Patsch, Julia Deutschmann, Peter Pietschmann. (2011) Gender aspects of osteoporosis and bone strength. Wiener Medizinische Wochenschrift 161:5-6, 117-123
    CrossRef

  45. 45

    Maureen J. Devlin. (2011) Estrogen, exercise, and the skeleton. Evolutionary Anthropology: Issues, News, and Reviews 20:2, 54-61
    CrossRef

  46. 46

    Rosanna Chianese, Teresa Chioccarelli, Giovanna Cacciola, Vincenza Ciaramella, Silvia Fasano, Riccardo Pierantoni, Rosaria Meccariello, Gilda Cobellis. (2011) The contribution of lower vertebrate animal models in human reproduction research. General and Comparative Endocrinology 171:1, 17-27
    CrossRef

  47. 47

    Mitra Yousefi, Wilfried Karmaus, Lanay M. Mudd, Jeffrey R. Landgraf, Dorota Mikucki, Pamela S. Haan, Jessica Zhang, Janet R. Osuch. (2011) Expression of CYP19 and CYP17 Is Associated With Leg Length, Weight, and BMI. Obesity 19:2, 436-441
    CrossRef

  48. 48

    Jeffery Ford, Asghar Hajibeigi, Michael Long, Lisa Hahner, Crystal Gore, Jer-Tseng Hsieh, Deborah Clegg, Joseph Zerwekh, Orhan K Öz. (2011) GPR30 deficiency causes increased bone mass, mineralization, and growth plate proliferative activity in male mice. Journal of Bone and Mineral Research 26:2, 298-307
    CrossRef

  49. 49

    Susan A. Krum. (2011) Direct transcriptional targets of sex steroid hormones in bone. Journal of Cellular Biochemistry 112:2, 401-408
    CrossRef

  50. 50

    Selna L. Kaplan. 2011. Hormonal Regulation of Growth and Metabolic Effects of Growth Hormone. .
    CrossRef

  51. 51

    Luigi Gennari, Daniela Merlotti, Ranuccio Nuti. 2011. Aromatase activity and bone loss. , 129-164.
    CrossRef

  52. 52

    Franck Mauvais-Jarvis. (2011) Estrogen and androgen receptors: regulators of fuel homeostasis and emerging targets for diabetes and obesity. Trends in Endocrinology & Metabolism 22:1, 24-33
    CrossRef

  53. 53

    Daniela Merlotti, Luigi Gennari, Konstantinos Stolakis, Ranuccio Nuti. (2011) Aromatase Activity and Bone Loss in Men. Journal of Osteoporosis 2011, 1-11
    CrossRef

  54. 54

    Ulrike IL Mödder, Jackie A Clowes, Kelley Hoey, James M Peterson, Louise McCready, Merry Jo Oursler, B Lawrence Riggs, Sundeep Khosla. (2011) Regulation of circulating sclerostin levels by sex steroids in women and in men. Journal of Bone and Mineral Research 26:1, 27-34
    CrossRef

  55. 55

    Peter J. Malloy, Dov Tiosano, David Feldman. 2011. Hereditary 1,25-Dihydroxyvitamin-D-Resistant Rickets. , 1197-1232.
    CrossRef

  56. 56

    Michelle Heys, Chaoqiang Jiang, Kar Keung Cheng, Weisen Zhang, Tai Hing Lam, Gabriel M. Leung, C. Mary Schooling. (2010) Does the Age of Achieving Pubertal Landmarks Predict Cognition in Older Men? Guangzhou Biobank Cohort Study. Annals of Epidemiology 20:12, 948-954
    CrossRef

  57. 57

    Anna E Börjesson, Marie K Lagerquist, Chen Liu, Ruijin Shao, Sara H Windahl, Camilla Karlsson, Klara Sjögren, Sofia Movérare-Skrtic, Maria Christina Antal, Andrée Krust, Subburaman Mohan, Pierre Chambon, Lars Sävendahl, Claes Ohlsson. (2010) The role of estrogen receptor α in growth plate cartilage for longitudinal bone growth. Journal of Bone and Mineral Research 25:12, 2690-2700
    CrossRef

  58. 58

    Cristiana Vitale, Massimo Fini, Giuseppe Speziale, Sergio Chierchia. (2010) Gender differences in the cardiovascular effects of sex hormones. Fundamental & Clinical Pharmacology 24:6, 675-685
    CrossRef

  59. 59

    Saumyendra V. Singh, Arvind Tripathi. (2010) An overview of osteoporosis for the practising prosthodontist. Gerodontology 27:4, 308-314
    CrossRef

  60. 60

    Wen-Feng Li, Shu-Xun Hou, Bin Yu, Dan Jin, Claude Férec, Jian-Min Chen. (2010) Genetics of osteoporosis: perspectives for personalized medicine. Personalized Medicine 7:6, 655-668
    CrossRef

  61. 61

    Kay W. K. Yuen, Timothy C. Y. Kwok, L. Qin, Jason C. S. Leung, Dicken C. C. Chan, Anthony W. L. Kwok, Jean Woo, P. C. Leung. (2010) Characteristics of age-related changes in bone compared between male and female reference Chinese populations in Hong Kong: a pQCT study. Journal of Bone and Mineral Metabolism 28:6, 672-681
    CrossRef

  62. 62

    Angela C. Bauer-Dantoin, Daniel J. Meinhardt. (2010) 17β-Estradiol Exposure Accelerates Skeletal Development in Xenopus laevis Tadpoles. The Anatomical Record: Advances in Integrative Anatomy and Evolutionary Biology 293:11, 1880-1886
    CrossRef

  63. 63

    Christian Kasperk. (2010) Das Osteoporoserisiko der antiandrogenen Therapie des Mannes. Forensische Psychiatrie, Psychologie, Kriminologie 4:S1, 22-26
    CrossRef

  64. 64

    E.-S. A. Mohamed, W.-H. Song, S.-A. Oh, Y.-J. Park, Y.-A. You, S. Lee, J.-Y. Choi, Y.-J. Kim, I. Jo, M.-G. Pang. (2010) The transgenerational impact of benzo(a)pyrene on murine male fertility. Human Reproduction 25:10, 2427-2433
    CrossRef

  65. 65

    Andreas Mueller, Lothar Haeberle, Hendryk Zollver, Tomma Claassen, Desiree Kronawitter, Patricia G. Oppelt, Susanne Cupisti, Matthias W. Beckmann, Ralf Dittrich. (2010) Effects of Intramuscular Testosterone Undecanoate on Body Composition and Bone Mineral Density in Female-to-Male Transsexuals. The Journal of Sexual Medicine 7:9, 3190-3198
    CrossRef

  66. 66

    Ching-Lung Cheung, Su-Mei Xiao, Annie W. C. Kung. (2010) Genetic epidemiology of age-related osteoporosis and its clinical applications. Nature Reviews Rheumatology 6:9, 507-517
    CrossRef

  67. 67

    G.A. Figtree, B.G. Robinson, K.M. Channon, H. Watkins. (2010) Polymorphism upstream of estrogen receptor alpha reverses negative regulation of transcription. International Journal of Cardiology 144:1, 86-88
    CrossRef

  68. 68

    Liesbeth Vandenput, Claes Ohlsson. (2010) Sex steroid metabolism in the regulation of bone health in men. The Journal of Steroid Biochemistry and Molecular Biology 121:3-5, 582-588
    CrossRef

  69. 69

    Shoji Ichikawa, Daniel L Koller, Leah R Padgett, Dongbing Lai, Siu L Hui, Munro Peacock, Tatiana Foroud, Michael J Econs. (2010) Replication of previous genome-wide association studies of bone mineral density in premenopausal American women. Journal of Bone and Mineral Research 25:8, 1821-1829
    CrossRef

  70. 70

    Baruch Frenkel, Albert Hong, Sanjeev K. Baniwal, Gerhard A. Coetzee, Claes Ohlsson, Omar Khalid, Yankel Gabet. (2010) Regulation of adult bone turnover by sex steroids. Journal of Cellular Physiology 224:2, 305-310
    CrossRef

  71. 71

    Matti Hero, Sanna Toiviainen-Salo, Sanna Wickman, Outi Mäkitie, Leo Dunkel. (2010) Vertebral morphology in aromatase inhibitor-treated males with idiopathic short stature or constitutional delay of puberty. Journal of Bone and Mineral Research 25:7, 1536-1543
    CrossRef

  72. 72

    Zsuzsanna Suba. (2010) Common soil of smoking-associated and hormone-related cancers: estrogen deficiency. Oncology Reviews 4:2, 73-87
    CrossRef

  73. 73

    Peter R Ebeling. (2010) Androgens and osteoporosis. Current Opinion in Endocrinology, Diabetes and Obesity 17:3, 284-292
    CrossRef

  74. 74

    A. Ferlin, M. Schipilliti, A. Di Mambro, C. Vinanzi, C. Foresta. (2010) Osteoporosis in Klinefelter's syndrome. Molecular Human Reproduction 16:6, 402-410
    CrossRef

  75. 75

    S. Carreau, S. Wolczynski, I. Galeraud-Denis. (2010) Aromatase, oestrogens and human male reproduction. Philosophical Transactions of the Royal Society B: Biological Sciences 365:1546, 1571-1579
    CrossRef

  76. 76

    Andrea Cignarella, Mario Kratz, Chiara Bolego. (2010) Emerging role of estrogen in the control of cardiometabolic disease. Trends in Pharmacological Sciences 31:4, 183-189
    CrossRef

  77. 77

    Bonny L Specker, Howard E Wey, Eric P Smith. (2010) Rates of bone loss in young adult males. International Journal of Clinical Rheumatology 5:2, 215-228
    CrossRef

  78. 78

    Wen-Feng Li, Shu-Xun Hou, Bin Yu, Meng-Meng Li, Claude Férec, Jian-Min Chen. (2010) Genetics of osteoporosis: accelerating pace in gene identification and validation. Human Genetics 127:3, 249-285
    CrossRef

  79. 79

    Ann E. Kearns, Donald W. Northfelt, Amylou C. Dueck, Pamela J. Atherton, Shaker R. Dakhil, Kendrith M. Rowland, Jyotsna Fuloria, Patrick J. Flynn, Todor Dentchev, Charles L. Loprinzi. (2010) Osteoporosis prevention in prostate cancer patients receiving androgen ablation therapy: placebo-controlled double-blind study of estradiol and risedronate: N01C8. Supportive Care in Cancer 18:3, 321-328
    CrossRef

  80. 80

    Filip Callewaert, Katrien Venken, John J Kopchick, Antonia Torcasio, G Harry van Lenthe, Steven Boonen, Dirk Vanderschueren. (2010) Sexual dimorphism in cortical bone size and strength but not density is determined by independent and time-specific actions of sex steroids and IGF-1: Evidence from pubertal mouse models. Journal of Bone and Mineral Research 25:3, 617-626
    CrossRef

  81. 81

    L. Vico, J-M. Vanacker. (2010) Sex hormones and their receptors in bone homeostasis: insights from genetically modified mouse models. Osteoporosis International 21:3, 365-372
    CrossRef

  82. 82

    C.E. Roselli, F. Stormshak. (2010) The ovine sexually dimorphic nucleus, aromatase, and sexual partner preferences in sheep. The Journal of Steroid Biochemistry and Molecular Biology 118:4-5, 252-256
    CrossRef

  83. 83

    Eric P. Smith, Bonny Specker, Kenneth S. Korach. (2010) Recent experimental and clinical findings in the skeleton associated with loss of estrogen hormone or estrogen receptor activity. The Journal of Steroid Biochemistry and Molecular Biology 118:4-5, 264-272
    CrossRef

  84. 84

    Francesca Marini, Maria Luisa Brandi. (2010) Genetic Determinants of Osteoporosis: Common Bases to Cardiovascular Diseases?. International Journal of Hypertension 2010, 1-16
    CrossRef

  85. 85

    Kendall F. Moseley, Suzanne M. Jan de Beur. 2010. Osteoporosis in Men and Women. , 716-736.
    CrossRef

  86. 86

    Diala El-Maouche, Adrian Dobs. 2010. Testosterone Replacement Therapy in Men and Women. , 737-760.
    CrossRef

  87. 87

    Marianne J. Legato, Jaswinder K. Leghe. 2010. Gender and the HeartSex-Specific Differences in the Normal Myocardial Anatomy and Physiology. , 151-161.
    CrossRef

  88. 88

    B LEDER. 2010. Androgens and the Skeleton – Humans. , 319-334.
    CrossRef

  89. 89

    C MEIER. 2010. Testicular Dysfunction. , 423-434.
    CrossRef

  90. 90

    L VANDENPUT. 2010. Estrogen and the Skeleton – Humans. , 289-293.
    CrossRef

  91. 91

    L GENNARI. 2010. The Genetics of Peak Bone Mass. , 149-163.
    CrossRef

  92. 92

    F CALLEWAERT. 2010. Estrogen and the Skeleton – Rodents. , 283-287.
    CrossRef

  93. 93

    Q WANG. 2010. Skeletal Growth in Males. , 85-93.
    CrossRef

  94. 94

    A BOSKEY. 2010. The Biochemistry of BoneComposition and Organization. , 3-13.
    CrossRef

  95. 95

    Csilla Krausz. 2009. Molecular Genetics of Spermatogenic Disturbances. .
    CrossRef

  96. 96

    Pascal Guggenbuhl. (2009) Osteoporosis in males and females: Is there really a difference?. Joint Bone Spine 76:6, 595-601
    CrossRef

  97. 97

    L. Zirilli, L. Maffei, P.J. Meunier, P. Chavassieux, C. Carani, V. Rochira. (2009) The effects of long-term raloxifene and estradiol treatments on bone in a patient with congenital aromatase deficiency. Bone 45:5, 827-832
    CrossRef

  98. 98

    Pascal Guggenbuhl. (2009) Ostéoporose de l’homme et de la femme : est-ce vraiment différent ?. Revue du Rhumatisme 76:10-11, 952-958
    CrossRef

  99. 99

    Thirupathi Muthusamy, Palaniappan Murugesan, Karundevi Balasubramanian. (2009) Sex steroids deficiency impairs glucose transporter 4 expression and its translocation through defective Akt phosphorylation in target tissues of adult male rat. Metabolism 58:11, 1581-1592
    CrossRef

  100. 100

    M. C. Lardone, P. Castillo, R. Valdevenito, M. Ebensperger, A. M. Ronco, R. Pommer, A. Piottante, A. Castro. (2009) P450-aromatase activity and expression in human testicular tissues with severe spermatogenic failure. International Journal of Andrology
    CrossRef

  101. 101

    Björn Olde, L.M. Fredrik Leeb-Lundberg. (2009) GPR30/GPER1: searching for a role in estrogen physiology. Trends in Endocrinology & Metabolism 20:8, 409-416
    CrossRef

  102. 102

    Shailesh Kumar, Shreekant Deshpande, Vishal Chandra, Shakti Kitchlu, Anila Dwivedi, Vadithe Lakshma Nayak, Rituraj Konwar, Yenamandra S. Prabhakar, Devi Prasad Sahu. (2009) Synthesis and biological evaluation of 2,3,4-triarylbenzopyran derivatives as SERM and therapeutic agent for breast cancer. Bioorganic & Medicinal Chemistry 17:19, 6832-6840
    CrossRef

  103. 103

    Vincenzo Rochira, Cesare Carani. (2009) Aromatase deficiency in men: a clinical perspective. Nature Reviews Endocrinology 5:9, 559-568
    CrossRef

  104. 104

    L. E. Olofsson, A. A. Pierce, A. W. Xu. (2009) Functional requirement of AgRP and NPY neurons in ovarian cycle-dependent regulation of food intake. Proceedings of the National Academy of Sciences 106:37, 15932-15937
    CrossRef

  105. 105

    C. George Priya Doss, Rao Sethumadhavan. (2009) Computational and structural analysis of deleterious functional SNPs in ARNT oncogene. Interdisciplinary Sciences: Computational Life Sciences 1:3, 220-228
    CrossRef

  106. 106

    Masanobu Kawai, Clifford J. Rosen. (2009) Marrow Fat and Bone: New Insights from Mice and Humans. Clinical Reviews in Bone and Mineral Metabolism 7:3, 216-223
    CrossRef

  107. 107

    Yanjun Mu, Ruiping She, Hua Zhang, Bing Dong, Chengfei Huang, Wei Lin, Defa Li, Xiangdong Li. (2009) Effects of estrogen and androgen deprivation on the progression of non-alcoholic steatohepatitis (NASH) in male Sprague-Dawley rats. Hepatology Research 39:9, 910-920
    CrossRef

  108. 108

    Piet Geusens, Philip Sambrook, Willem Lems. (2009) Fracture prevention in men. Nature Reviews Rheumatology 5:9, 497-504
    CrossRef

  109. 109

    Nelly Mauras. (2009) Strategies for Maximizing Growth in Puberty in Children with Short Stature. Endocrinology & Metabolism Clinics of North America 38:3, 613-624
    CrossRef

  110. 110

    Alfred Tenore, Daniela Driul. (2009) Genomics in Pediatric Endocrinology—Genetic Disorders and New Techniques. Endocrinology & Metabolism Clinics of North America 38:3, 471-490
    CrossRef

  111. 111

    Cristiana Vitale, Michael E. Mendelsohn, Giuseppe M. C. Rosano. (2009) Gender differences in the cardiovascular effect of sex hormones. Nature Reviews Cardiology 6:8, 532-542
    CrossRef

  112. 112

    Liesbeth Vandenput, Claes Ohlsson. (2009) Estrogens as regulators of bone health in men. Nature Reviews Endocrinology 5:8, 437-443
    CrossRef

  113. 113

    Jose Eduardo B. Cavaco, Sandra S. Laurentino, Alberto Barros, Mario Sousa, Silvia Socorro. (2009) Estrogen Receptors α and β in Human Testis: Both Isoforms are Expressed. Systems Biology in Reproductive Medicine 55:4, 137-144
    CrossRef

  114. 114

    Serge Carreau, Christelle Delalande, Isabelle Galeraud-Denis. (2009) Mammalian sperm quality and aromatase expression. Microscopy Research and Technique 72:8, 552-557
    CrossRef

  115. 115

    Jerry K. Wales. 2009. Evaluation of Growth Disorders. , 124-154.
    CrossRef

  116. 116

    Zu-feng Sun, Hui Jiang, Zheng-qin Ye, Bing Jia, Xiao-le Zhang, Ke-qin Zhang. (2009) Expression of Rho GDIα in rat osteoblasts intermittently exposed to parathyroid hormone in vitro and in vivo. Acta Pharmacologica Sinica 30:7, 1001-1007
    CrossRef

  117. 117

    K. Venkat, M. Desai, M. M. Arora, P. Singh, M. I. Khatkhatay. (2009) Age-related changes in sex steroid levels influence bone mineral density in healthy Indian men. Osteoporosis International 20:6, 955-962
    CrossRef

  118. 118

    Zsuzsanna Suba. (2009) Az ösztrogénhiányon alapuló rákelmélet. Orvosi Hetilap 150:25, 1155-1166
    CrossRef

  119. 119

    Jaak Jürimäe, Triin Pomerants, Vallo Tillmann, Toivo Jürimäe. (2009) Bone metabolism markers and ghrelin in boys at different stages of sexual maturity. Acta Paediatrica 98:5, 892-896
    CrossRef

  120. 120

    Regiana L. Oliveira, André G. Oliveira, Germán A.B. Mahecha, José C. Nogueira, Cleida A. Oliveira. (2009) Distribution of estrogen receptors (ERα and ERβ) and androgen receptor in the testis of big fruit-eating bat Artibeus lituratus is cell- and stage-specific and increases during gonadal regression. General and Comparative Endocrinology 161:2, 283-292
    CrossRef

  121. 121

    Darko Kastelan, Zorana Grubic, Ivana Kraljevic, Ozren Polasek, Tina Dusek, Katarina Stingl, Vesna Kerhin-Brkljacic, Mirko Korsic. (2009) The role of estrogen receptor-α gene TA polymorphism and aromatase gene TTTA polymorphism on peak bone mass attainment in males: is there an additive negative effect of certain allele combinations?. Journal of Bone and Mineral Metabolism 27:2, 198-204
    CrossRef

  122. 122

    Luigi Gennari, Daniela Merlotti, Vincenzo De Paola, Giuseppe Martini, Ranuccio Nuti. (2009) Update on the pharmacogenetics of the vitamin D receptor and osteoporosis. Pharmacogenomics 10:3, 417-433
    CrossRef

  123. 123

    Karen D. Hancock, Elaine S. Coleman, Ya-Xiong Tao, Edward E. Morrison, Tim D. Braden, Barbara W. Kemppainen, Benson T. Akingbemi. (2009) Genistein decreases androgen biosynthesis in rat Leydig cells by interference with luteinizing hormone-dependent signaling. Toxicology Letters 184:3, 169-175
    CrossRef

  124. 124

    Benit S. Maru, Jonathan H. Tobias, Caroline Rivers, Christopher J. Caunt, Michael R. Norman, Craig A. McArdle. (2009) Potential use of an estrogen–glucocorticoid receptor chimera as a drug screen for tissue selective estrogenic activity. Bone 44:1, 102-112
    CrossRef

  125. 125

    Rogerio A. Lobo. 2009. Menopause and Aging. , 325-355.
    CrossRef

  126. 126

    G. F. Weinbauer, J. Wessels. (2009) ‘Paracrine’ control of spermatogenesis. Andrologia 31:5, 249
    CrossRef

  127. 127

    Turk Rhen, John A. Cidlowski. 2009. Steroid Hormone Action. , 105-120.
    CrossRef

  128. 128

    Channing J. Paller, Meredith S. Shiels, Sabine Rohrmann, Shehzad Basaria, Nader Rifai, William Nelson, Elizabeth A. Platz, Adrian Dobs. (2009) Relationship of sex steroid hormones with bone mineral density (BMD) in a nationally representative sample of men. Clinical Endocrinology 70:1, 26-34
    CrossRef

  129. 129

    S.P. Tuck, A.C. Scane, W.D. Fraser, M.J. Diver, R. Eastell, R.M. Francis. (2008) Sex steroids and bone turnover markers in men with symptomatic vertebral fractures. Bone 43:6, 999-1005
    CrossRef

  130. 130

    Mai Asano, Michiaki Fukui, Hiroko Hosoda, Emi Shiraishi, Ichiko Harusato, Mayuko Kadono, Muhei Tanaka, Goji Hasegawa, Toshikazu Yoshikawa, Naoto Nakamura. (2008) Bone stiffness in men with type 2 diabetes mellitus. Metabolism 57:12, 1691-1695
    CrossRef

  131. 131

    Tie-Lin Yang, Dong-Hai Xiong, Yan Guo, Robert R Recker, Hong-Wen Deng. (2008) Comprehensive association analyses of IGF1, ESR2, and CYP17 genes with adult height in Caucasians. European Journal of Human Genetics 16:11, 1380-1387
    CrossRef

  132. 132

    K. Venken, F. Callewaert, S. Boonen, D. Vanderschueren. (2008) Sex hormones, their receptors and bone health. Osteoporosis International 19:11, 1517-1525
    CrossRef

  133. 133

    M.K. Bohlmann, A. Hornemann, J. Weichert, G. Stichtenoth, J. Ortmann, K. Diedrich, D. Lüdders. (2008) „Off-label-Anwendung“ von Aromatasehemmern. Gynäkologische Endokrinologie 6:4, 221-228
    CrossRef

  134. 134

    Courtney Grimsrud, Teresa Binkley, Bonny Specker. (2008) The effect of menarcheal age on anthropometric, limb length, and bone measures in Hutterite and non-Hutterite women. American Journal of Human Biology 20:6, 693-699
    CrossRef

  135. 135

    Ingrid Dahlman, Martine Vaxillaire, Maria Nilsson, Cecile Lecoeur, Harvest F. Gu, Christine Cavalcanti-Proença, Suad Efendic, Claes G. Östenson, Kerstin Brismar, Guillaume Charpentier, Jan-Åke Gustafsson, Philippe Froguel, Karin Dahlman-Wright, Knut R. Steffensen. (2008) Estrogen receptor alpha gene variants associate with type 2 diabetes and fasting plasma glucose. Pharmacogenetics and Genomics 18:11, 967-975
    CrossRef

  136. 136

    Luigi Gennari, Sundeep Khosla, John P Bilezikian. (2008) Estrogen and Fracture Risk in Men. Journal of Bone and Mineral Research 23:10, 1548-1551
    CrossRef

  137. 137

    Qingju Wang, Ego Seeman. (2008) Skeletal growth and peak bone strength. Best Practice & Research Clinical Endocrinology & Metabolism 22:5, 687-700
    CrossRef

  138. 138

    Jill Littrell. (2008) Incorporating Information from Neuroscience and Endocrinology Regarding Sexual Orientation into Social Work Education. Journal of Human Behavior in the Social Environment 18:2, 101-128
    CrossRef

  139. 139

    Ravin Jugdaohsingh, Mario R. Calomme, Karen Robinson, Forrest Nielsen, Simon H.C. Anderson, Patrick D'Haese, Piet Geusens, Nigel Loveridge, Richard P.H. Thompson, Jonathan J. Powell. (2008) Increased longitudinal growth in rats on a silicon-depleted diet. Bone 43:3, 596-606
    CrossRef

  140. 140

    Robert F. Heary, Karthik Madhavan. (2008) GENETICS OF SCOLIOSIS. Neurosurgery 63:Supplement, A222-A227
    CrossRef

  141. 141

    Sundeep Khosla. (2008) Estrogen and bone: Insights from estrogen-resistant, aromatase-deficient, and normal men. Bone 43:3, 414-417
    CrossRef

  142. 142

    D. Karasik, S. L. Ferrari. (2008) Contribution of Gender-Specific Genetic Factors to Osteoporosis Risk. Annals of Human Genetics 72:5, 696-714
    CrossRef

  143. 143

    Elham Karimian, Andrei S Chagin, Jennifer Gjerde, Terhi Heino, Ernst A Lien, Claes Ohlsson, Lars Sävendahl. (2008) Tamoxifen Impairs Both Longitudinal and Cortical Bone Growth in Young Male Rats. Journal of Bone and Mineral Research 23:8, 1267-1277
    CrossRef

  144. 144

    A. Morani, M. Warner, J.-. Gustafsson. (2008) Biological functions and clinical implications of oestrogen receptors alfa and beta in epithelial tissues. Journal of Internal Medicine 264:2, 128-142
    CrossRef

  145. 145

    ZhongYi Shen, ZhiQi Peng, Yi Sun, H Kalervo Väänänen, Matti Poutanen. (2008) Overexpression of Human Hydroxysteroid (17β) Dehydrogenase 2 Induces Disturbance in Skeletal Development in Young Male Mice. Journal of Bone and Mineral Research 23:8, 1217-1226
    CrossRef

  146. 146

    Charlotte E. Hotchkiss, Connie Weis, Betty Blaydes, Retha Newbold, K. Barry Delclos. (2008) Multigenerational exposure to ethinyl estradiol affects bone geometry, but not bone mineral density in rats. Bone 43:1, 110-118
    CrossRef

  147. 147

    Barbara A. Cromer. (2008) Menstrual Cycle and Bone Health in Adolescents. Annals of the New York Academy of Sciences 1135:1, 196-203
    CrossRef

  148. 148

    Francesco Massart, Gemma Marcucci, Maria Luisa Brandi. (2008) Pharmacogenetics of bone treatments: the VDR and ERα gene story. Pharmacogenomics 9:6, 733-746
    CrossRef

  149. 149

    Angela Scafonas, Alfred A. Reszka, Donald B. Kimmel, Xiaoli Shirley Hou, Qin Su, Elizabeth T. Birzin, Seongkon Kim, Helen Y. Chen, Qiang Tan, Susan P. Roher, Frank Dininno, Milton L. Hammond, Gideon A. Rodan, Dwight A. Towler, Azriel Schmidt. (2008) Agonist-like SERM effects on ERα-mediated repression of MMP1 promoter activity predict in vivo effects on bone and uterus. The Journal of Steroid Biochemistry and Molecular Biology 110:3-5, 197-206
    CrossRef

  150. 150

    (2008) Second meeting on bone quality, Abbaye des Vaux de Cernay, France, 19–20 June 2007: Cortical bone. Osteoporosis International 19:6, 853-893
    CrossRef

  151. 151

    Yanping Wang, Julia Barthold, Ernesto Figueroa, Ricardo González, Paul H. Noh, Miao Wang, Jeanne Manson. (2008) Analysis of five single nucleotide polymorphisms in theESR1 gene in cryptorchidism. Birth Defects Research Part A: Clinical and Molecular Teratology 82:6, 482-485
    CrossRef

  152. 152

    Beata Kulik-Rechberger, Paweł Skorupski, Maria Kozłowska, Tomasz Rechberger. (2008) Wiek menarche w zależności od stanu odżywienia i polimorfizmu sekwencji intronu 1 genu receptora estrogenowego alfa. Pediatria Polska 83:3, 218-223
    CrossRef

  153. 153

    Peng Xiao, Yuan Chen, Hui Jiang, Yao-Zhong Liu, Feng Pan, Tie-Lin Yang, Zi-Hui Tang, Jennifer A Larsen, Joan M Lappe, Robert R Recker, Hong-Wen Deng. (2008) In Vivo Genome-Wide Expression Study on Human Circulating B Cells Suggests a Novel ESR1 and MAPK3 Network for Postmenopausal Osteoporosis. Journal of Bone and Mineral Research 23:5, 644-654
    CrossRef

  154. 154

    Keith L. Keene, Josyf C. Mychaleckyj, Shelly G. Smith, Tennille S. Leak, Peter S. Perlegas, Carl D. Langefeld, David M. Herrington, Barry I. Freedman, Stephen S. Rich, Donald W. Bowden, Michèle M. Sale. (2008) Comprehensive evaluation of the estrogen receptor α gene reveals further evidence for association with type 2 diabetes enriched for nephropathy in an African American population. Human Genetics 123:4, 333-341
    CrossRef

  155. 155

    Ebeling, Peter R., . (2008) Osteoporosis in Men. New England Journal of Medicine 358:14, 1474-1482
    Full Text

  156. 156

    Lucia Zirilli, Vincenzo Rochira, Chiara Diazzi, Giovanni Caffagni, Cesare Carani. (2008) Human models of aromatase deficiency. The Journal of Steroid Biochemistry and Molecular Biology 109:3-5, 212-218
    CrossRef

  157. 157

    B. M. H. Lai, C. L. Cheung, K. D. K. Luk, A. W. C. Kung. (2008) Estrogen receptor α CA dinucleotide repeat polymorphism is associated with rate of bone loss in perimenopausal women and bone mineral density and risk of osteoporotic fractures in postmenopausal women. Osteoporosis International 19:4, 571-579
    CrossRef

  158. 158

    J.M. Wit, E.O. Reiter, J.L. Ross, P.H. Saenger, M.O. Savage, A.D. Rogol, P. Cohen. (2008) Idiopathic short stature: Management and growth hormone treatment. Growth Hormone & IGF Research 18:2, 111-135
    CrossRef

  159. 159

    K. Venken, R. Bouillon, D. Vanderschueren. (2008) Androgens Versus Estrogens: Different Theories About Opposing Actions on Periosteal Bone Expansion. IBMS BoneKEy 5:4, 130-136
    CrossRef

  160. 160

    Karen P. Phillips, Warren G. Foster. (2008) Key Developments in Endocrine Disrupter Research and Human Health. Journal of Toxicology and Environmental Health, Part B 11:3-4, 322-344
    CrossRef

  161. 161

    Mari Mori, Yuki Okabe, Hiroyuki Tanimoto, Tsukasa Shimazu, Hideki Mori, Yukio Yamori. (2008) Isoflavones as Putative Anti-aging Food Factors in Asia and Effects of Isoflavone Aglycone-rich Fermented Soybeans on Bone and Glucose Metabolisms in Post-menopausal Women. Geriatrics & Gerontology International 8, S8-S15
    CrossRef

  162. 162

    Tomasz Szreder, Beata Żelazowska, Jolanta Oprządek, Lech Zwierzchowski. (2008) Expression in promoter variant of the ERα gene in bos taurus liver. Molecular Biology Reports 35:1, 65-71
    CrossRef

  163. 163

    Susan A Krum, Gustavo A Miranda-Carboni, Peter V Hauschka, Jason S Carroll, Timothy F Lane, Leonard P Freedman, Myles Brown. (2008) Estrogen protects bone by inducing Fas ligand in osteoblasts to regulate osteoclast survival. The EMBO Journal 27:3, 535-545
    CrossRef

  164. 164

    U.I. Mödder, A. Sanyal, J. Xu, B.W. O'Malley, T.C. Spelsberg, S. Khosla. (2008) The skeletal response to estrogen is impaired in female but not in male steroid receptor coactivator (SRC)-1 knock out mice. Bone 42:2, 414-421
    CrossRef

  165. 165

    Sara E. Walker, Michael R. Adams, Adrian A. Franke, Thomas C. Register. (2008) Effects of dietary soy protein on iliac and carotid artery atherosclerosis and gene expression in male monkeys. Atherosclerosis 196:1, 106-113
    CrossRef

  166. 166

    RON G. ROSENFELD, PINCHAS COHEN. 2008. Disorders of Growth Hormone/Insulin-like Growth Factor Secretion and Action. , 254-334.
    CrossRef

  167. 167

    Subhendu Mukherjee, Shuchi Nagar, Sanchita Mullick, Arup Mukherjee, Achintya Saha. (2008) Pharmacophore mapping of arylbenzothiophene derivatives for MCF cell inhibition using classical and 3D space modeling approaches. Journal of Molecular Graphics and Modelling 26:5, 884-892
    CrossRef

  168. 168

    Lan-Juan Zhao, Hui Jiang, Christopher J Papasian, Dev Maulik, Betty Drees, James Hamilton, Hong-Wen Deng. (2008) Correlation of Obesity and Osteoporosis: Effect of Fat Mass on the Determination of Osteoporosis. Journal of Bone and Mineral Research 23:1, 17-29
    CrossRef

  169. 169

    ROBERT L. ROSENFIELD, DAVID W. COOKE, SALLY RADOVICK. 2008. Puberty and Its Disorders in the Female. , 530-609.
    CrossRef

  170. 170

    C. George Priya Doss, R. Rajasekaran, C. Sudandiradoss, K. Ramanathan, R. Purohit, R. Sethumadhavan. (2008) A novel computational and structural analysis of nsSNPs in CFTR gene. Genomic Medicine 2:1-2, 23-32
    CrossRef

  171. 171

    R. J. Perry, C. Farquharson, S. F. Ahmed. (2008) The role of sex steroids in controlling pubertal growth. Clinical Endocrinology 68:1, 4-15
    CrossRef

  172. 172

    Francesca Nuti, Csilla Krausz. (2008) Gene polymorphisms/mutations relevant to abnormal spermatogenesis. Reproductive BioMedicine Online 16:4, 504-513
    CrossRef

  173. 173

    ALAN M. RICE, SCOTT A. RIVKEES. 2008. Receptor Transduction of Hormone Action. , 26-73.
    CrossRef

  174. 174

    L. E. Lanyon, V. J. Armstrong, L. K. Saxon, A. Sunters, T. Sugiyama, G. Zaman, J. S. Price. (2007) Estrogen Receptors Critically Regulate Bones’ Adaptive Responses to Loading. Clinical Reviews in Bone and Mineral Metabolism 5:4, 234-248
    CrossRef

  175. 175

    Rayna J Gonzales, Saema Ansar, Sue P Duckles, Diana N Krause. (2007) Androgenic/estrogenic balance in the male rat cerebral circulation: metabolic enzymes and sex steroid receptors. Journal of Cerebral Blood Flow & Metabolism 27:11, 1841-1852
    CrossRef

  176. 176

    Roy J. Levin. (2007) Single case studies in human sexuality – important or idiosyncratic?. Sexual and Relationship Therapy 22:4, 457-469
    CrossRef

  177. 177

    R. Rajasekaran, C. Sudandiradoss, C. George Priya Doss, Rao Sethumadhavan. (2007) Identification and in silico analysis of functional SNPs of the BRCA1 gene. Genomics 90:4, 447-452
    CrossRef

  178. 178

    S. Khosla. (2007) Estrogen and the Death of Osteoclasts: A Fascinating Story. International Bone and Mineral Society Knowledge Environment 4:10, 267-272
    CrossRef

  179. 179

    Andrei S. Chagin, Lars Sävendahl. (2007) Oestrogen receptors and linear bone growth. Acta Paediatrica 96:9, 1275-1279
    CrossRef

  180. 180

    Adriana Stopforth, Ben V. Burger, Andrew M. Crouch, Pat Sandra. (2007) The analysis of estrone and 17β-estradiol by stir bar sorptive extraction–thermal desorption–gas chromatography/mass spectrometry: Application to urine samples after oral administration of conjugated equine estrogens. Journal of Chromatography B 856:1-2, 156-164
    CrossRef

  181. 181

    Takashi Nakamura, Yuuki Imai, Takahiro Matsumoto, Shingo Sato, Kazusane Takeuchi, Katsuhide Igarashi, Yoshifumi Harada, Yoshiaki Azuma, Andree Krust, Yoko Yamamoto, Hiroshi Nishina, Shu Takeda, Hiroshi Takayanagi, Daniel Metzger, Jun Kanno, Kunio Takaoka, T. John Martin, Pierre Chambon, Shigeaki Kato. (2007) Estrogen Prevents Bone Loss via Estrogen Receptor α and Induction of Fas Ligand in Osteoclasts. Cell 130:5, 811-823
    CrossRef

  182. 182

    I.R. Haraldsen, E. Haug, J. Falch, T. Egeland, S. Opjordsmoen. (2007) Cross-sex pattern of bone mineral density in early onset gender identity disorder. Hormones and Behavior 52:3, 334-343
    CrossRef

  183. 183

    Åshild Bjørnerem, Nina Emaus, Gro K. R. Berntsen, Ragnar M. Joakimsen, Vinjar Fønnebø, Tom Wilsgaard, Pål Øian, Ego Seeman, Bjørn Straume. (2007) Circulating Sex Steroids, Sex Hormone-Binding Globulin, and Longitudinal Changes in Forearm Bone Mineral Density in Postmenopausal Women and Men: The Tromsø Study. Calcified Tissue International 81:2, 65-72
    CrossRef

  184. 184

    Stuart J. Ellem, Gail P. Risbridger. (2007) Treating prostate cancer: a rationale for targeting local oestrogens. Nature Reviews Cancer 7:8, 621-627
    CrossRef

  185. 185

    M.E.E. Jones, K.J. McInnes, W.C. Boon, E.R. Simpson. (2007) Estrogen and adiposity—Utilizing models of aromatase deficiency to explore the relationship. The Journal of Steroid Biochemistry and Molecular Biology 106:1-5, 3-7
    CrossRef

  186. 186

    Laura Maffei, Vincenzo Rochira, Lucia Zirilli, Paula Antunez, Claudio Aranda, Bibiana Fabre, Maria L. Simone, Elisa Pignatti, Evan R. Simpson, Souheir Houssami, Colin D. Clyne, Cesare Carani. (2007) A novel compound heterozygous mutation of the aromatase gene in an adult man: reinforced evidence on the relationship between congenital oestrogen deficiency, adiposity and the metabolic syndrome. Clinical Endocrinology 67:2, 218-224
    CrossRef

  187. 187

    Maiko Fujioka, Yumi Sudo, Mai Okumura, Jian Wu, Mariko Uehara, Ken Takeda, Yu Hosokawa, Kazuhiko Yamada, Sachie Ikegami, Yoshiko Ishimi. (2007) Differential effects of isoflavones on bone formation in growing male and female mice. Metabolism 56:8, 1142-1148
    CrossRef

  188. 188

    Benjamin Z. Leder. (2007) Testosterone, estradiol and aromatase inhibitor therapy in elderly men. The Journal of Steroid Biochemistry and Molecular Biology 106:1-5, 162-167
    CrossRef

  189. 189

    Elizabeth Murphy, Charles Steenbergen. (2007) Cardioprotection in females: a role for nitric oxide and altered gene expression. Heart Failure Reviews 12:3-4, 293-300
    CrossRef

  190. 190

    M Nilsson, I Dahlman, M Rydén, E A Nordström, J-Å Gustafsson, P Arner, K Dahlman-Wright. (2007) Oestrogen receptor α gene expression levels are reduced in obese compared to normal weight females. International Journal of Obesity 31:6, 900-907
    CrossRef

  191. 191

    Benjamin Leder. (2007) Gonadal steroids and bone metabolism in men. Current Opinion in Endocrinology, Diabetes and Obesity 14:3, 241-246
    CrossRef

  192. 192

    Sue A Brown, Theresa A Guise. (2007) Drug Insight: the use of bisphosphonates for the prevention and treatment of osteoporosis in men. Nature Clinical Practice Urology 4:6, 310-320
    CrossRef

  193. 193

    Margaret EE Jones, Wah Chin Boon, Kerry McInnes, Laura Maffei, Cesare Carani, Evan R Simpson. (2007) Recognizing rare disorders: aromatase deficiency. Nature Clinical Practice Endocrinology & Metabolism 3:5, 414-421
    CrossRef

  194. 194

    Andrei S. Chagin, Elham Karimian, Farasat Zaman, Masaharu Takigawa, Dionisios Chrysis, Lars Sävendahl. (2007) Tamoxifen induces permanent growth arrest through selective induction of apoptosis in growth plate chondrocytes in cultured rat metatarsal bones. Bone 40:5, 1415-1424
    CrossRef

  195. 195

    Michio Otsuki, Soji Kasayama, Shinya Morita, Nobuyuki Asanuma, Hiroshi Saito, Mikio Mukai, Masafumi Koga. (2007) Menopause, but not age, is an independent risk factor for fasting plasma glucose levels in nondiabetic women. Menopause 14:3, 404-407
    CrossRef

  196. 196

    Chang Bai, Osvaldo Flores, Azriel Schmidt. (2007) Opportunities for development of novel therapies targeting steroid hormone receptors. Expert Opinion on Drug Discovery 2:5, 725-737
    CrossRef

  197. 197

    N. Napoli, R. Faccio, V. Shrestha, S. Bucchieri, G. Battista Rini, R. Armamento-Villareal. (2007) Estrogen Metabolism Modulates Bone Density in Men. Calcified Tissue International 80:4, 227-232
    CrossRef

  198. 198

    Triin Pomerants, Vallo Tillmann, Jaak Jürimäe, Toivo Jürimäe. (2007) The influence of serum ghrelin, IGF axis and testosterone on bone mineral density in boys at different stages of sexual maturity. Journal of Bone and Mineral Metabolism 25:3, 193-197
    CrossRef

  199. 199

    Luigi Gennari, Vincenzo De Paola, Daniela Merlotti, Giuseppe Martini, Ranuccio Nuti. (2007) Steroid hormone receptor gene polymorphisms and osteoporosis: a pharmacogenomic review. Expert Opinion on Pharmacotherapy 8:5, 537-553
    CrossRef

  200. 200

    L.M. Starnes, C.M. Downey, S.K. Boyd, F.R. Jirik. (2007) Increased bone mass in male and female mice following tamoxifen administration. genesis 45:4, 229-235
    CrossRef

  201. 201

    Nontakorn Urasopon, Yuzuru Hamada, Kazuo Asaoka, Wichai Cherdshewasart, Suchinda Malaivijitnond. (2007) Pueraria mirifica, a phytoestrogen-rich herb, prevents bone loss in orchidectomized rats. Maturitas 56:3, 322-331
    CrossRef

  202. 202

    Darko Kastelan, Mirko Korsic. (2007) New hopes in the treatment of osteoporosis in men. Future Rheumatology 2:1, 1-4
    CrossRef

  203. 203

    Ju Tae Seo, Jae Seok Lee, Tae Hee Oh, Kwan Joong Joo. (2007) The clinical significance of bone mineral density and testosterone levels in Korean men with non-mosaic Klinefelter's syndrome. BJU International 99:1, 141-146
    CrossRef

  204. 204

    Edward O. Reiter. (2007) Hormonal Treatment of Idiopathic Short Stature. Hormone Research 67:1, 58-63
    CrossRef

  205. 205

    Steven Boonen, Jean-Marc Kaufman, Stefan Goemaere, Roger Bouillon, Dirk Vanderschueren. (2007) The diagnosis and treatment of male osteoporosis: Defining, assessing, and preventing skeletal fragility in men. European Journal of Internal Medicine 18:1, 6-17
    CrossRef

  206. 206

    Regina Ebert, Norbert Schütze, Tatjana Schilling, Lothar Seefried, Meike Weber, Ulrich Nöth, Jochen Eulert, Franz Jakob. (2007) Influence of hormones on osteogenic differentiation processes of mesenchymal stem cells. Expert Review of Endocrinology & Metabolism 2:1, 59-78
    CrossRef

  207. 207

    Takuya Sato, Ken Watanabe, Masaaki Masuhara, Naoto Hada, Yoshiyuki Hakeda. (2006) Production of IL-7 is increased in ovariectomized mice, but not RANKL mRNA expression by osteoblasts/stromal cells in bone, and IL-7 enhances generation of osteoclast precursors in vitro. Journal of Bone and Mineral Metabolism 25:1, 19-27
    CrossRef

  208. 208

    Xianfeng Yao, Huayue Chen, Norihiro Ohtake, Shizuko Shoumura. (2006) Morphological alterations in the growth plate cartilage of ovariectomized mice. Medical Molecular Morphology 39:4, 193-197
    CrossRef

  209. 209

    Fang-Ping Chen, Todd Hsu, Chin-Hwa Hu, Wen-Der Wang, Kun-Chuang Wang, Li-Fen Teng. (2006) Expression of Estrogen Receptors Alfa and Beta mRNA and Alkaline Phosphatase in the Differentiation of Osteoblasts from Elderly Postmenopausal Women: Comparison with Osteoblasts from Osteosarcoma Cell Lines. Taiwanese Journal of Obstetrics and Gynecology 45:4, 307-312
    CrossRef

  210. 210

    Serge Ferrari. (2006) Single gene mutations and variations affecting bone turnover and strength: a selective 2006 update. BoneKEy-Osteovision 3:12, 11-29
    CrossRef

  211. 211

    Michael J. Baum. (2006) Mammalian animal models of psychosexual differentiation: When is ‘translation’ to the human situation possible?. Hormones and Behavior 50:4, 579-588
    CrossRef

  212. 212

    Hannu-Ville Leskelä, Anu Olkku, Siri Lehtonen, Anitta Mahonen, Jussi Koivunen, Miia Turpeinen, Jouko Uusitalo, Olavi Pelkonen, Lauri Kangas, Katri Selander, Petri Lehenkari. (2006) Estrogen receptor alpha genotype confers interindividual variability of response to estrogen and testosterone in mesenchymal-stem-cell-derived osteoblasts. Bone 39:5, 1026-1034
    CrossRef

  213. 213

    Tran Quang Binh, Toshikatsu Shinka, Nguyen Cong Khan, Vu Thi Thu Hien, Nguyen Thi Lam, Le Bach Mai, Takuro Nakano, Masako Sei, Shigeru Yamamoto, Masayo Nakamori, Yutaka Nakahori. (2006) Association of estrogen receptor alpha gene polymorphisms and lifestyle factors with calcaneal quantitative ultrasound and osteoporosis in postmenopausal Vietnamese women. Journal of Human Genetics 51:11, 1022-1029
    CrossRef

  214. 214

    Rosa María Vigueras-Villaseñor, Norma Angélica Moreno-Mendoza, Gabriela Reyes-Torres, Dora Molina-Ortiz, Mario Cárdenas León, Julio Cesar Rojas-Castañeda. (2006) The effect of estrogen on testicular gonocyte maturation. Reproductive Toxicology 22:3, 513-520
    CrossRef

  215. 215

    Rodrigo P.A. Barros, Ubiratan Fabres Machado, Jan-Åke Gustafsson. (2006) Estrogen receptors: new players in diabetes mellitus. Trends in Molecular Medicine 12:9, 425-431
    CrossRef

  216. 216

    Gul Zaman, Helen L Jessop, Mariusz Muzylak, Roberto L De Souza, Andrew A Pitsillides, Joanna S Price, Lance L Lanyon. (2006) Osteocytes Use Estrogen Receptor α to Respond to Strain but Their ERα Content Is Regulated by Estrogen. Journal of Bone and Mineral Research 21:8, 1297-1306
    CrossRef

  217. 217

    Paolo Ascenzi, Alessio Bocedi, Maria Marino. (2006) Structure–function relationship of estrogen receptor α and β: Impact on human health. Molecular Aspects of Medicine 27:4, 299-402
    CrossRef

  218. 218

    Leo Dunkel. (2006) Use of aromatase inhibitors to increase final height. Molecular and Cellular Endocrinology 254-255, 207-216
    CrossRef

  219. 219

    Jean Claude Carel. (2006) Management of short stature with GnRH agonist and co-treatment with growth hormone: A controversial issue. Molecular and Cellular Endocrinology 254-255, 226-233
    CrossRef

  220. 220

    Yun Zhai, Gangqiao Zhou, Guohong Deng, Weimin Xie, Xiaojia Dong, Xiumei Zhang, Ling Yu, Hao Yang, Xiaoyan Yuan, Hongxin Zhang, Lianteng Zhi, Zhijian Yao, Yan Shen, Boqing Qiang, Fuchu He. (2006) Estrogen Receptor α Polymorphisms Associated With Susceptibility to Hepatocellular Carcinoma in Hepatitis B Virus Carriers. Gastroenterology 130:7, 2001-2009
    CrossRef

  221. 221

    Jie Wu, Yong Qiu, Le Zhang, Qiang Sun, Xusheng Qiu, Yongxiong He. (2006) Association of Estrogen Receptor Gene Polymorphisms With Susceptibility to Adolescent Idiopathic Scoliosis. Spine 31:10, 1131-1136
    CrossRef

  222. 222

    Renato Pasquali. (2006) Obesity and androgens: facts and perspectives. Fertility and Sterility 85:5, 1319-1340
    CrossRef

  223. 223

    Jeffrey M. Holzbeierlein. (2006) Managing Complications of Androgen Deprivation Therapy for Prostate Cancer. Urologic Clinics of North America 33:2, 181-190
    CrossRef

  224. 224

    Anna Enjuanes, Natalia Garcia-Giralt, August Supervía, Xavier Nogués, Silvia Ruiz-Gaspà, Mariona Bustamante, Leonardo Mellibovsky, Daniel Grinberg, Susana Balcells, Adolfo Díez-Pérez. (2006) A new SNP in a negative regulatory region of the CYP19A1 gene is associated with lumbar spine BMD in postmenopausal women. Bone 38:5, 738-743
    CrossRef

  225. 225

    Roland Baron. (2006) FSH versus estrogen: Who's guilty of breaking bones?. Cell Metabolism 3:5, 302-305
    CrossRef

  226. 226

    Federman, Daniel D., . (2006) The Biology of Human Sex Differences. New England Journal of Medicine 354:14, 1507-1514
    Full Text

  227. 227

    Katrien Venken, Karel De Gendt, Steven Boonen, Jill Ophoff, Roger Bouillon, Johannes V Swinnen, Guido Verhoeven, Dirk Vanderschueren. (2006) Relative Impact of Androgen and Estrogen Receptor Activation in the Effects of Androgens on Trabecular and Cortical Bone in Growing Male Mice: A Study in the Androgen Receptor Knockout Mouse Model. Journal of Bone and Mineral Research 21:4, 576-585
    CrossRef

  228. 228

    Ryan R. Brinkman, Marie-Pierre Dubé, Guy A. Rouleau, Andrew C. Orr, Mark E. Samuels. (2006) Human monogenic disorders — a source of novel drug targets. Nature Reviews Genetics 7:4, 249-260
    CrossRef

  229. 229

    Sofia Movérare-Skrtic, Katrien Venken, Niklas Andersson, Marie K. Lindberg, Johan Svensson, Charlotte Swanson, Dirk Vanderschueren, Jan Oscarsson, Jan-Åke Gustafsson, Claes Ohlsson. (2006) Dihydrotestosterone Treatment Results in Obesity and Altered Lipid Metabolism in Orchidectomized Mice*. Obesity 14:4, 662-672
    CrossRef

  230. 230

    Luigi Gennari, Ranuccio Nuti, John P Bilezikian. (2006) Estrogen in men: effects on bone accrual, maintenance and prevention of bone loss. Expert Review of Endocrinology & Metabolism 1:2, 281-295
    CrossRef

  231. 231

    Margaret E.E. Jones, Wah Chin Boon, Joseph Proietto, Evan R. Simpson. (2006) Of mice and men: the evolving phenotype of aromatase deficiency. Trends in Endocrinology & Metabolism 17:2, 55-64
    CrossRef

  232. 232

    Benjamin M. Auerbach, Christopher B. Ruff. (2006) Limb bone bilateral asymmetry: variability and commonality among modern humans. Journal of Human Evolution 50:2, 203-218
    CrossRef

  233. 233

    Cecilia Petersen, Olle Söder. (2006) The Sertoli Cell – A Hormonal Target and ‘Super’ Nurse for Germ Cells That Determines Testicular Size. Hormone Research 66:4, 153-161
    CrossRef

  234. 234

    Sumegha Mitra, Meena Desai, M. Ikram Khatkhatay. (2006) Association of estrogen receptor α gene polymorphisms with bone mineral density in postmenopausal Indian women. Molecular Genetics and Metabolism 87:1, 80-87
    CrossRef

  235. 235

    Melanie Walton, Richard A Anderson. (2006) Male hormonal contraception: a safe option?. Expert Review of Endocrinology & Metabolism 1:1, 25-32
    CrossRef

  236. 236

    Claude Ribot, Florence Trémollieres, Jean-Michel Pouillés. (2006) Aromatase et régulation du remodelage osseux. Revue du Rhumatisme 73:1, 32-38
    CrossRef

  237. 237

    Claude Ribot, Florence Trémollieres, Jean-Michel Pouillés. (2006) Aromatase and regulation of bone remodeling. Joint Bone Spine 73:1, 37-42
    CrossRef

  238. 238

    S.L. Ferrari, S. Deutsch, C. Baudoin, M. Cohen-Solal, A. Ostertag, S.E. Antonarakis, R. Rizzoli, M.C. de Vernejoul. (2005) LRP5 gene polymorphisms and idiopathic osteoporosis in men. Bone 37:6, 770-775
    CrossRef

  239. 239

    Evan R. Simpson, Kerry J. McInnes. (2005) Sex and fat—Can one factor handle both?. Cell Metabolism 2:6, 346-347
    CrossRef

  240. 240

    S. BENVENGA. (2005) Central hormonal regulation and dimorphism of arousal. International Journal of Andrology 28:s2, 18-22
    CrossRef

  241. 241

    Benjamin Z. Leder, Joel S. Finkelstein. (2005) Effect of aromatase inhibition on bone metabolism in elderly hypogonadal men. Osteoporosis International 16:12, 1487-1494
    CrossRef

  242. 242

    Y. Guo, L.-J. Zhao, H. Shen, Y. Guo, H.-W. Deng. (2005) Genetic and Environmental Correlations between Age at Menarche and Bone Mineral Density at Different Skeletal Sites. Calcified Tissue International 77:6, 356-360
    CrossRef

  243. 243

    Ville-Valtteri Välimäki, Kirsi Piippo, Stiina Välimäki, Eliisa Löyttyniemi, Kimmo Kontula, Matti J. Välimäki. (2005) The relation of the Xbal and Pvull polymorphisms of the estrogen receptor gene and the CAG repeat polymorphism of the androgen receptor gene to peak bone mass and bone turnover rate among young healthy men. Osteoporosis International 16:12, 1633-1640
    CrossRef

  244. 244

    Katrien Venken, Frans Schuit, Leentje Van Lommel, Katsura Tsukamoto, John J Kopchick, Karen Coschigano, Claes Ohlsson, Sofia Movérare, Steven Boonen, Roger Bouillon, Dirk Vanderschueren. (2005) Growth Without Growth Hormone Receptor: Estradiol Is a Major Growth Hormone-Independent Regulator of Hepatic IGF-I Synthesis. Journal of Bone and Mineral Research 20:12, 2138-2149
    CrossRef

  245. 245

    Dong-Hai Xiong, Yao-Zhong Liu, Peng-Yuan Liu, Lan-Juan Zhao, Hong-Wen Deng. (2005) Association analysis of estrogen receptor α gene polymorphisms with cross-sectional geometry of the femoral neck in Caucasian nuclear families. Osteoporosis International 16:12, 2113-2122
    CrossRef

  246. 246

    Christian Meier, Peter Y. Liu, David J. Handelsman, Markus J. Seibel. (2005) Endocrine regulation of bone turnover in men. Clinical Endocrinology 63:6, 603-616
    CrossRef

  247. 247

    Xinxiang Wang, Jian Wu, Hiroshige Chiba, Kazuhiko Yamada, Yoshiko Ishimi. (2005) Puerariae radix prevents bone loss in castrated male mice. Metabolism 54:11, 1536-1541
    CrossRef

  248. 248

    Charlotte E. Hotchkiss, Connie Weis, Betty Blaydes, Retha Newbold, K. Barry Delclos. (2005) Multigenerational exposure to genistein does not increase bone mineral density in rats. Bone 37:5, 720-727
    CrossRef

  249. 249

    Koji Yamazaki, Hideki Fukata, Tetsuya Adachi, Hitoshi Tainaka, Masao Kohda, Masashi Yamazaki, Kensuke Kojima, Kan Chiba, Chisato Mori, Masatoshi Komiyama. (2005) Association of increased type I collagen expression and relative stromal overgrowth in mouse epididymis neonatally exposed to diethylstilbestrol. Molecular Reproduction and Development 72:3, 291-298
    CrossRef

  250. 250

    Zsolt Bardóczy, István Kocsis, András Treszl, Tivador Tulassay, Barna Vásárhelyi, Miklós Szathmári. (2005) Independent effect of endogenous dehydroepiandrosterone-sulphate levels and birth weight on bone turnover parameters in young adults. Journal of Bone and Mineral Metabolism 23:6, 483-487
    CrossRef

  251. 251

    Nozomi Tamura, Takumi Kurabayashi, Hiroshi Nagata, Hiroshi Matsushita, Tetsuro Yahata, Kenichi Tanaka. (2005) Effects of testosterone on cancellous bone, marrow adipocytes, and ovarian phenotype in a young female rat model of polycystic ovary syndrome. Fertility and Sterility 84, 1277-1284
    CrossRef

  252. 252

    ELLEN SHAPIRO, HONGYING HUANG, RACHEL J. MASCH, DEBORAH E. McFADDEN, XUE-RU WU, HARRY OSTRER. (2005) IMMUNOLOCALIZATION OF ANDROGEN RECEPTOR AND ESTROGEN RECEPTORS α AND β IN HUMAN FETAL TESTIS AND EPIDIDYMIS. The Journal of Urology 174:4, 1695-1698
    CrossRef

  253. 253

    SOPHIE LAMBARD, SERGE CARREAU. (2005) Aromatase and oestrogens in human male germ cells. International Journal of Andrology 28:5, 254-259
    CrossRef

  254. 254

    Satoshi Mishima, Kazu-Michi Suzuki, Yoichiro Isohama, Naoko Kuratsu, Yoko Araki, Makoto Inoue, Takeshi Miyata. (2005) Royal jelly has estrogenic effects in vitro and in vivo. Journal of Ethnopharmacology 101:1-3, 215-220
    CrossRef

  255. 255

    D. Kapoor, C. J. Malkin, K. S. Channer, T. H. Jones. (2005) Androgens, insulin resistance and vascular disease in men. Clinical Endocrinology 63:3, 239-250
    CrossRef

  256. 256

    Chang Hoon Yim, Jong Tae Choi, Hyun Ah Choi, Young Soon Kang, In Gul Moon, Hyun Koo Yoon, In Kwon Han, Dae Hee Kang, Ki Ok Han. (2005) Association of estrogen receptor α gene microsatellite polymorphism with annual changes in bone mineral density in Korean women with hormone replacement therapy. Journal of Bone and Mineral Metabolism 23:5, 395-400
    CrossRef

  257. 257

    Mattias Lorentzon, Charlotte Swanson, Niklas Andersson, Dan Mellström, Claes Ohlsson. (2005) Free Testosterone Is a Positive, Whereas Free Estradiol Is a Negative, Predictor of Cortical Bone Size in Young Swedish Men: The GOOD Study. Journal of Bone and Mineral Research 20:8, 1334-1341
    CrossRef

  258. 258

    Ammar Qoubaitary, Ronald S Swerdloff, Christina Wang. (2005) Advances in male hormone substitution therapy. Expert Opinion on Pharmacotherapy 6:9, 1493-1506
    CrossRef

  259. 259

    Nelly Mauras, Jennifer Bell, Banae G. Snow, Kevin L. Winslow. (2005) Sperm analysis in growth hormone-deficient adolescents previously treated with an aromatase inhibitor: Comparison with normal controls. Fertility and Sterility 84:1, 239-242
    CrossRef

  260. 260

    ANNA-LENA ERIKSSON, MIIA SUURINIEMI, ANITTA MAHONEN, SULIN CHENG, CLAES OHLSSON. (2005) The COMT val158met Polymorphism Is Associated with Early Pubertal Development, Height and Cortical Bone Mass in Girls. Pediatric Research 58:1, 71-77
    CrossRef

  261. 261

    C CARANI, A GRANATA, V ROCHIRA, G CAFFAGNI, C ARANDA, P ANTUNEZ, L MAFFEI. (2005) Sex steroids and sexual desire in a man with a novel mutation of aromatase gene and hypogonadism. Psychoneuroendocrinology 30:5, 413-417
    CrossRef

  262. 262

    A Mancini, D Milardi, A Bianchi, V Summaria, L De Marinis. (2005) Increased estradiol levels in venous occlusive disorder: a possible functional mechanism of venous leakage. International Journal of Impotence Research 17:3, 239-242
    CrossRef

  263. 263

    Evan Simpson, Margaret Jones, Marie Misso, Kylie Hewitt, Rachel Hill, Laura maffei, Cesare Carani, Wah Chin Boon. (2005) Estrogen, a fundamental player in energy homeostasis. The Journal of Steroid Biochemistry and Molecular Biology 95:1-5, 3-8
    CrossRef

  264. 264

    H. de Boer, L. Verschoor, J. Ruinemans-Koerts, M. Jansen. (2005) Letrozole normalizes serum testosterone in severely obese men with hypogonadotropic hypogonadism. Diabetes, Obesity and Metabolism 7:3, 211-215
    CrossRef

  265. 265

    Makarios I. Eleftheriades, Irene V. Lambrinoudaki, George E. Christodoulakos, Odysseas V. Gregoriou, Emmanuel V. Economou, Evangelia E. Kouskouni, Aristidis G. Antoniou, Despoina N. Perrea, Ismene A. Dontas, Panagiota D. Raptou, George P. Lyritis, George C. Creatsas. (2005) Effect of oral contraceptive treatment on bone mass acquisition in skeletally immature young female rats. Contraception 71:5, 362-371
    CrossRef

  266. 266

    Ab Sadeghi-Nejad, Lawrence I. Karlin. (2005) A provisionally unique syndrome of macrosomia, bone overgrowth, macrocephaly, and tall stature. American Journal of Medical Genetics Part A 134A:4, 443-446
    CrossRef

  267. 267

    Alex C. Vidaeff, Lowell E. Sever. (2005) In utero exposure to environmental estrogens and male reproductive health: a systematic review of biological and epidemiologic evidence. Reproductive Toxicology 20:1, 5-20
    CrossRef

  268. 268

    Christian Alexandre. (2005) Androgens and bone metabolism. Joint Bone Spine 72:3, 202-206
    CrossRef

  269. 269

    Robin Weston, Asad Hussain, Emmanuel George, Nigel J. Parr. (2005) Testosterone recovery and changes in bone mineral density after stopping long-term luteinizing hormone-releasing hormone analogue therapy in osteoporotic patients with prostate cancer. BJU International 95:6, 776-779
    CrossRef

  270. 270

    Marcel Karperien, Bram C. J. Eerden, Jan Maarten Wit. (2005) Genomic and non-genomic actions of sex steroids in the growth plate. Pediatric Nephrology 20:3, 323-329
    CrossRef

  271. 271

    Vincenzo Rochira, Antonio R M Granata, Bruno Madeo, Lucia Zirilli, Giuseppina Rossi, Cesare Carani. (2005) Estrogens in males: what have we learned in the last 10 years?. Asian Journal of Andrology 7:1, 3-20
    CrossRef

  272. 272

    Farhan Syed, Sundeep Khosla. (2005) Mechanisms of sex steroid effects on bone. Biochemical and Biophysical Research Communications 328:3, 688-696
    CrossRef

  273. 273

    Ola Nilsson, Jeffrey Baron. (2005) Impact of growth plate senescence on catch-up growth and epiphyseal fusion. Pediatric Nephrology 20:3, 319-322
    CrossRef

  274. 274

    Alicia Garcia-Falgueras, Helena Pinos, Paloma Collado, Eduardo Pasaro, Rosa Fernandez, Cynthia L. Jordan, Santiago Segovia, Antonio Guillamon. (2005) The role of the androgen receptor in CNS masculinization. Brain Research 1035:1, 13-23
    CrossRef

  275. 275

    L.K. Saxon, C.H. Turner. (2005) Estrogen receptor β: the antimechanostat?. Bone 36:2, 185-192
    CrossRef

  276. 276

    Alessandra Crisafulli, Domenica Altavilla, Herbert Marini, Alessandra Bitto, Domenico Cucinotta, Nicola Frisina, Francesco Corrado, Rosario D'Anna, Giovanni Squadrito, Elena B. Adamo, Rolando Marini, Adolfo Romeo, Francesco Cancellieri, Michele Buemi, Francesco Squadrito. (2005) Effects of the phytoestrogen genistein on cardiovascular risk factors in postmenopausal women. Menopause 12:2, 186-192
    CrossRef

  277. 277

    Ki Won Oh, Eun Joo Yun, Eun Jung Rhee, Won Young Lee, Ki Hyun Baek, Moo Il Kang, Cheol Young Park, Sung Hee Ihm, Moon Gi Choi, Hyung Joon Yoo, Sung Woo Park. (2005) The Effects of Osteoprotegerin Polymorphism on Bone Mineral Metabolism in Korean Women with Perimenopause. Journal of Korean Society of Endocrinology 20:3, 204
    CrossRef

  278. 278

    A. Sanyal, B.L. Riggs, T.C. Spelsberg, S. Khosla. (2005) Bone marrow stromal cells express two distinct splice variants of ER-? that are regulated by estrogen. Journal of Cellular Biochemistry 94:1, 88-97
    CrossRef

  279. 279

    James L. Wittliff, Sarah A. Andres. 2005. Estrogens I: Estrogens and Their Conjugates. , 244-248.
    CrossRef

  280. 280

    Ki Won Oh, Eun Jung Rhee, Won Young Lee, Sun Woo Kim, Ki Hyun Baek, Moo Il Kang, Eun Joo Yun, Cheol Young Park, Sung Hee Ihm, Moon Gi Choi, Hyung Joon Yoo, Sung Woo Park. (2005) Circulating osteoprotegerin and receptor activator of NF-kappaB ligand system are associated with bone metabolism in middle-aged males. Clinical Endocrinology 62:1, 92-98
    CrossRef

  281. 281

    Moshe Phillip, Liora Lazar. (2005) Precocious Puberty: Growth and Genetics. Hormone Research 64:2, 56-61
    CrossRef

  282. 282

    Lars Sävendahl. (2005) Hormonal Regulation of Growth Plate Cartilage. Hormone Research 64:2, 94-97
    CrossRef

  283. 283

    Emily Darby, Bradley D Anawalt. (2005) Male Hypogonadism. Treatments in Endocrinology 4:5, 293-309
    CrossRef

  284. 284

    Hosam K Kamel. (2005) Male Osteoporosis. Drugs & Aging 22:9, 741-748
    CrossRef

  285. 285

    MATTHEW O. FRASER, MUHAMMAD ARSLAN, TONY M. PLANT. (2005) Androgen and Estrogen Treatment, Alone or in Combination, Differentially Influences Bone Maturation and Hypothalamic Mechanisms that Time Puberty in the Male Rhesus Monkey (Macaca mulatta). Pediatric Research 57:1, 141-148
    CrossRef

  286. 286

    Jean E. Mulder, John P. Bilezikian. (2004) Bone Density in Survivors of Childhood Cancer. Journal of Clinical Densitometry 7:4, 432-442
    CrossRef

  287. 287

    Régis Levasseur, Jean-Pierre Sabatier, Christian Marcelli. (2004) Physiopathologie de l'ostéoporose. La Revue de Médecine Interne 25, S531-S537
    CrossRef

  288. 288

    Mattias Lorentzon, Anna-Lena Eriksson, Dan Mellström, Claes Ohlsson. (2004) The COMT val158met Polymorphism Is Associated With Peak BMD in Men. Journal of Bone and Mineral Research 19:12, 2005-2011
    CrossRef

  289. 289

    MELVIN M. GRUMBACH. (2004) Mutations in the Synthesis and Action of Estrogen: The Critical Role in the Male of Estrogen on Pubertal Growth, Skeletal Maturation, and Bone Mass. Annals of the New York Academy of Sciences 1038:1, 7-13
    CrossRef

  290. 290

    L. Fountas, M. Anapliotou, A. Kominakis, C. E. Sekeris, E. Kassi, P. Moutsatsou. (2004) Estrogen receptor alpha gene analysis in osteoporosis and familial osteoporosis. Osteoporosis International 15:12, 948-956
    CrossRef

  291. 291

    Vittoria Rago, Marcello Maggiolini, Adele Vivacqua, Antonio Palma, Amalia Carpino. (2004) Differential expression of estrogen receptors (ER?/ER?) in testis of mature and immature pigs. The Anatomical Record 281A:2, 1234-1239
    CrossRef

  292. 292

    Min Jiang, Ilpo Huhtaniemi. (2004) Polymorphisms in androgen and estrogen receptor genes: effects on male aging. Experimental Gerontology 39:11-12, 1603-1611
    CrossRef

  293. 293

    Florence Lima, Laurence Vico, Marie-Hélène Lafage-Proust, Paul van der Saag, Christian Alexandre, Thierry Thomas. (2004) Interactions between estrogen and mechanical strain effects on U2OS human osteosarcoma cells are not influenced by estrogen receptor type. Bone 35:5, 1127-1135
    CrossRef

  294. 294

    Katrine Bay, Anna-Maria Andersson, Niels E. Skakkebaek. (2004) Estradiol levels in prepubertal boys and girls - analytical challenges. International Journal of Andrology 27:5, 266-273
    CrossRef

  295. 295

    Ola Nilsson, Jeffrey Baron. (2004) Fundamental limits on longitudinal bone growth: growth plate senescence and epiphyseal fusion. Trends in Endocrinology & Metabolism 15:8, 370-374
    CrossRef

  296. 296

    Pawel Szulc, Bruno Claustrat, Francoise Munoz, Francois Marchand, Pierre D. Delmas. (2004) Assessment of the role of 17beta-oestradiol in bone metabolism in men: does the assay technique matter? The MINOS study. Clinical Endocrinology 61:4, 447-457
    CrossRef

  297. 297

    Ersi Voskaridou, Evangelos Terpos. (2004) New insights into the pathophysiology and management of osteoporosis in patients with beta thalassaemia. British Journal of Haematology 127:2, 127-139
    CrossRef

  298. 298

    Brigitte Uebelhart, François Herrmann, Imre Pavo, Michael W Draper, René Rizzoli. (2004) Raloxifene Treatment Is Associated With Increased Serum Estradiol and Decreased Bone Remodeling in Healthy Middle-Aged Men With Low Sex Hormone Levels. Journal of Bone and Mineral Research 19:9, 1518-1524
    CrossRef

  299. 299

    E.L. Aschim, T. Sæther, R. Wiger, T. Grotmol, T.B. Haugen. (2004) Differential distribution of splice variants of estrogen receptor beta in human testicular cells suggests specific functions in spermatogenesis. The Journal of Steroid Biochemistry and Molecular Biology 92:1-2, 97-106
    CrossRef

  300. 300

    C. Rodd, N. Jourdain, M. Alini. (2004) Action of Estradiol on Epiphyseal Growth Plate Chondrocytes. Calcified Tissue International 75:3, 214-224
    CrossRef

  301. 301

    Takashi Yamada, Hirotaka Kawano, Keisuke Sekine, Takahiro Matsumoto, Toru Fukuda, Yoshiaki Azuma, Keiji Itaka, Ung-il Chung, Pierre Chambon, Kozo Nakamura, Shigeaki Kato, Hiroshi Kawaguchi. (2004) SRC-1 Is Necessary for Skeletal Responses to Sex Hormones in Both Males and Females. Journal of Bone and Mineral Research 19:9, 1452-1461
    CrossRef

  302. 302

    Ego Seeman. (2004) Estrogen, androgen, and the pathogenesis of bone fragility in women and men. Current Osteoporosis Reports 2:3, 90-96
    CrossRef

  303. 303

    ZhiQi Peng, XiangDong Li, Sari Mäkelä, H Kalervo Väänänen, Matti Poutanen. (2004) Skeletal Changes in Transgenic Male Mice Expressing Human Cytochrome P450 Aromatase. Journal of Bone and Mineral Research 19:8, 1320-1328
    CrossRef

  304. 304

    Harlan Stock, Adina Schneider, Elton Strauss. (2004) Osteoporosis. Clinical Orthopaedics and Related Research 425, 143-151
    CrossRef

  305. 305

    Lan-Juan Zhao, Peng-Yuan Liu, Ji-Rong Long, Yan Lu, Fu-Hua Xu, Yuan-Yuan Zhang, Hui Shen, Peng Xiao, Leo Elze, Robert R Recker, Hong-Wen Deng. (2004) Test of linkage and/or association between the estrogen receptor α gene with bone mineral density in Caucasian nuclear families. Bone 35:2, 395-402
    CrossRef

  306. 306

    Guohong Deng, Gangqiao Zhou, Yun Zhai, Shuqing Li, Xuhong Li, Ya Li, Ruifang Zhang, Zhijian Yao, Yan Shen, Boqing Qiang, Yuming Wang, Fuchu He. (2004) Association of estrogen receptor ? polymorphisms with susceptibility to chronic hepatitis B virus infection. Hepatology 40:2, 318-326
    CrossRef

  307. 307

    G A Figtree, B G Robinson. (2004) Estrogen receptor polymorphisms in common disease: recent developments. Current Opinion in Endocrinology & Diabetes 11:3, 141-146
    CrossRef

  308. 308

    C Lormeau, B Soudan, M d'Herbomez, P Pigny, B Duquesnoy, B Cortet. (2004) Sex hormone-binding globulin, estradiol, and bone turnover markers in male osteoporosis. Bone 34:6, 933-939
    CrossRef

  309. 309

    Helen L Jessop, Rosemary FL Suswillo, Simon CF Rawlinson, Gul Zaman, Karla Lee, Vicky Das-Gupta, Andrew A Pitsillides, Lance E Lanyon. (2004) Osteoblast-Like Cells From Estrogen Receptor α Knockout Mice Have Deficient Responses to Mechanical Strain. Journal of Bone and Mineral Research 19:6, 938-946
    CrossRef

  310. 310

    J.Larry Jameson. (2004) Molecular mechanisms of end-organ resistance. Growth Hormone & IGF Research 14, 45-50
    CrossRef

  311. 311

    Jean-Francois Louet, Cedric LeMay, Franck Mauvais-Jarvis. (2004) Antidiabetic actions of estrogen: Insight from human and genetic mouse models. Current Atherosclerosis Reports 6:3, 180-185
    CrossRef

  312. 312

    Karla C. L. Lee, Lance E. Lanyon. (2004) Mechanical Loading Influences Bone Mass Through Estrogen Receptor ??. Exercise and Sport Sciences Reviews 32:2, 64-68
    CrossRef

  313. 313

    Diana Rucker, Shereen Ezzat, Anastasia Diamandi, Javad Khosravi, David A. Hanley. (2004) IGF-I and testosterone levels as predictors of bone mineral density in healthy, community-dwelling men. Clinical Endocrinology 60:4, 491-499
    CrossRef

  314. 314

    Sandra Timm Pearce, V.Craig Jordan. (2004) The biological role of estrogen receptors α and β in cancer. Critical Reviews in Oncology/Hematology 50:1, 3-22
    CrossRef

  315. 315

    T. M. Doherty, L. A. Fitzpatrick, A. Shaheen, T. B. Rajavashisth, R. C. Detrano. (2004) Genetic Determinants of Arterial Calcification Associated With Atherosclerosis. Mayo Clinic Proceedings 79:2, 197-210
    CrossRef

  316. 316

    Tomas Barkhem, Stefan Nilsson, Jan-??ke Gustafsson. (2004) Molecular Mechanisms, Physiological Consequences and Pharmacological Implications of Estrogen Receptor Action. American Journal of PharmacoGenomics 4:1, 19-28
    CrossRef

  317. 317

    Erica A Eugster. (2004) Aromatase Inhibitors in Precocious Puberty. Treatments in Endocrinology 3:3, 141-151
    CrossRef

  318. 318

    James T Martin, Duc Huu Nguyen. (2004) Anthropometric analysis of homosexuals and heterosexuals: implications for early hormone exposure. Hormones and Behavior 45:1, 31-39
    CrossRef

  319. 319

    AS Chagin, MK Lindberg, N Andersson, S Moverare, J-Å Gustafsson, L Sävendahl, C Ohlsson. (2004) Estrogen Receptor-β Inhibits Skeletal Growth and Has the Capacity to Mediate Growth Plate Fusion in Female Mice. Journal of Bone and Mineral Research 19:1, 72-77
    CrossRef

  320. 320

    Peter R Ebeling. (2004) Idiopathic or Hypogonadal Osteoporosis in Men. Treatments in Endocrinology 3:6, 381-391
    CrossRef

  321. 321

    Harold M. Frost. (2003) Bone's mechanostat: A 2003 update. The Anatomical Record 275A:2, 1081-1101
    CrossRef

  322. 322

    Jonathan H Tobias. (2003) At the crossroads of skeletal responses to estrogen and exercise. Trends in Endocrinology & Metabolism 14:10, 441-443
    CrossRef

  323. 323

    Siobhán Cusack, Kevin D. Cashman. (2003) Impact of genetic variation on metabolic response of bone to diet. Proceedings of the Nutrition Society 62:04, 901-912
    CrossRef

  324. 324

    Teppo Ln Järvinen, Pekka Kannus, Harri Sievänen. (2003) Estrogen and Bone-a Reproductive and Locomotive Perspective. Journal of Bone and Mineral Research 18:11, 1921-1931
    CrossRef

  325. 325

    Moshe Phillip, Liora Lazar. (2003) The Regulatory Effect of Hormones and Growth Factors on the Pubertal Growth Spurt. The Endocrinologist 13:6, 465-469
    CrossRef

  326. 326

    Sanjay Sarkhel, Ashoke Sharon, Vishal Trivedi, Prakas R Maulik, Man Mohan Singh, Paloth Venugopalan, Suprabhat Ray. (2003) Structure-Based drug design: synthesis, crystal structure, biological evaluation and docking studies of mono- and bis-benzo[b]oxepines as non-steroidal estrogens. Bioorganic & Medicinal Chemistry 11:23, 5025-5033
    CrossRef

  327. 327

    K. K. Dhatariya, K. S. Nair. (2003) Dehydroepiandrosterone: Is There a Role for Replacement?. Mayo Clinic Proceedings 78:10, 1257-1273
    CrossRef

  328. 328

    Leo Dunkel, Sanna Wickman. (2003) Novel treatment of short stature with aromatase inhibitors. The Journal of Steroid Biochemistry and Molecular Biology 86:3-5, 345-356
    CrossRef

  329. 329

    Serdar E. Bulun, Siby Sebastian, Kazuto Takayama, Takashi Suzuki, Hironobu Sasano, Makio Shozu. (2003) The human CYP19 (aromatase P450) gene: update on physiologic roles and genomic organization of promoters. The Journal of Steroid Biochemistry and Molecular Biology 86:3-5, 219-224
    CrossRef

  330. 330

    E.R Simpson. (2003) Sources of estrogen and their importance. The Journal of Steroid Biochemistry and Molecular Biology 86:3-5, 225-230
    CrossRef

  331. 331

    U KORNAK, S MUNDLOS. (2003) Genetic Disorders of the Skeleton: A Developmental Approach. The American Journal of Human Genetics 73:3, 447-474
    CrossRef

  332. 332

    Shreyasee Amin. (2003) Male osteoporosis: Epidemiology and pathophysiology. Current Osteoporosis Reports 1:2, 71-77
    CrossRef

  333. 333

    Manuel Sosa, Esteban Jódar, Elena Arbelo, Casimira Domínguez, Pedro Saavedra, Armando Torres, Eduardo Salido, María Jesús Gómez de Tejada, Diego Hernández. (2003) Bone Mass, Bone Turnover, Vitamin D, and Estrogen Receptor Gene Polymorphisms in Male to Female Transsexuals. Journal of Clinical Densitometry 6:3, 297-304
    CrossRef

  334. 334

    Graeme R. Frank. (2003) Role of estrogen and androgen in pubertal skeletal physiology. Medical and Pediatric Oncology 41:3, 217-221
    CrossRef

  335. 335

    Toshihiko Yanase, Shizu Suzuki, Kiminobu Goto, Masatoshi Nomura, Taijiro Okabe, Ryoichi Takayanagi, Hajime Nawata. (2003) Aromatase in bone: roles of Vitamin D3 and androgens. The Journal of Steroid Biochemistry and Molecular Biology 86:3-5, 393-397
    CrossRef

  336. 336

    Michael N. Weedon, Martina Turner, Beatrice Knight, Penny Clark, Andrew T. Hattersley, Timothy M. Frayling. (2003) Variants in the aromatase gene and on the Y-chromosome are not associated with adult height or insulin resistance in a UK population. Clinical Endocrinology 59:2, 175-179
    CrossRef

  337. 337

    Arnold von Eckardstein, Fredrick C.W Wu. (2003) Testosterone and atherosclerosis. Growth Hormone & IGF Research 13, S72-S84
    CrossRef

  338. 338

    Kyo Chul Lee, Byung Seok Moon, Jae Hak Lee, Kyoo-Hyun Chung, John A Katzenellenbogen, Dae Yoon Chi. (2003) Synthesis and binding affinities of fluoroalkylated raloxifenes. Bioorganic & Medicinal Chemistry 11:17, 3649-3658
    CrossRef

  339. 339

    Pascal Richette, Maïté Corvol, Thomas Bardin. (2003) Estrogens, cartilage, and osteoarthritis. Joint Bone Spine 70:4, 257-262
    CrossRef

  340. 340

    Yue-Juan Qin, Hui Shen, Qi-Ren Huang, Lan-Juan Zhao, Qi Zhou, Miao-Xin Li, Jin-Wei He, Xiao-Yang Mo, Jing-Hui Lu, Robert R Recker, Hong-Wen Deng. (2003) Estrogen Receptor α Gene Polymorphisms and Peak Bone Density in Chinese Nuclear Families. Journal of Bone and Mineral Research 18:6, 1028-1035
    CrossRef

  341. 341

    Matthew R Smith. (2003) Management of treatment-related osteoporosis in men with prostate cancer. Cancer Treatment Reviews 29:3, 211-218
    CrossRef

  342. 342

    Gerald B Phillips, Tianyi Jing, Steven B Heymsfield. (2003) Relationships in men of sex hormones, insulin, adiposity, and risk factors for myocardial infarction. Metabolism 52:6, 784-790
    CrossRef

  343. 343

    Bruce R Troen. (2003) Molecular mechanisms underlying osteoclast formation and activation. Experimental Gerontology 38:6, 605-614
    CrossRef

  344. 344

    Kung M. Sutherland, H. Brady, L. M. Gayo-Fung, J. Leisten, S. G. Lipps, J. A. McKie, E. O’Leary, N. Patnaik, D. W. Anderson, S. S. Bhagwat, B. Stein. (2003) Effects of SP500263, a Novel Selective Estrogen Receptor Modulator, on Bone, Uterus, and Serum Cholesterol in the Ovariectomized Rat. Calcified Tissue International 72:6, 710-716
    CrossRef

  345. 345

    Stavroula Kousteni, Li Han, Jin-Ran Chen, Maria Almeida, Lilian I. Plotkin, Teresita Bellido, Stavros C. Manolagas. (2003) Kinase-mediated regulation of common transcription factors accounts for the bone-protective effects of sex steroids. Journal of Clinical Investigation 111:11, 1651-1664
    CrossRef

  346. 346

    T.L.N Järvinen, P Kannus, I Pajamäki, T Vuohelainen, J Tuukkanen, M Järvinen, H Sievänen. (2003) Estrogen deposits extra mineral into bones of female rats in puberty, but simultaneously seems to suppress the responsiveness of female skeleton to mechanical loading. Bone 32:6, 642-651
    CrossRef

  347. 347

    S LALWANI, R REINDOLLAR, A DAVIS. (2003) Normal onset of puberty. Obstetrics and Gynecology Clinics of North America 30:2, 279-286
    CrossRef

  348. 348

    Gautam Khastgir, John WW Studd, Simon W Fox, Julia Jones, Jamshid Alaghband-Zadeh, Jade WM Chow. (2003) A Longitudinal Study of the Effect of Subcutaneous Estrogen Replacement on Bone in Young Women With Turner's Syndrome. Journal of Bone and Mineral Research 18:5, 925-932
    CrossRef

  349. 349

    Jean D. Wilson. (2003) Hormones and Sexual Behavior. The Endocrinologist 13:3, 208-210
    CrossRef

  350. 350

    Dimitrios Evangelopoulos, Maria Alevizaki, John Lekakis, Adriana Cimponeriu, Christos Papamichael, Antonios Kominakis, Anastasios Kalofoutis, Paraskevi Moutsatsou. (2003) Molecular analysis of the estrogen receptor alpha gene in men with coronary artery disease: association with disease status. Clinica Chimica Acta 331:1-2, 37-44
    CrossRef

  351. 351

    Dick F. Swaab, Wilson C.J. Chung, Frank P.M. Kruijver, Michel A. Hofman, Andon Hestiantoro. (2003) Sex differences in the hypothalamus in the different stages of human life. Neurobiology of Aging 24, S1-S16
    CrossRef

  352. 352

    Serdar E. Bulun, Zongjuan Fang, Bilgin Gurates, Mitsutoshi Tamura, Bertan Yilmaz, Sanober Amin, Sijun Yang. (2003) Aromatase in Health and Disease. The Endocrinologist 13:3, 269-276
    CrossRef

  353. 353

    R. Tracy Ballock, Regis J. O'Keefe. (2003) Physiology and pathophysiology of the growth plate. Birth Defects Research Part C: Embryo Today: Reviews 69:2, 123-143
    CrossRef

  354. 354

    Gaurav S Batra, Linda Hainey, Anthony J Freemont, Glynne Andrew, Philippa TK Saunders, Judith A Hoyland, Isobel P Braidman. (2003) Evidence for cell-specific changes with age in expression of oestrogen receptor (ER) ? and ? in bone fractures from men and women. The Journal of Pathology 200:1, 65-73
    CrossRef

  355. 355

    Willem de Ronde, Huibert A.P. Pols, Johannes P.T.M. van Leeuwen, Frank H. de Jong. (2003) The importance of oestrogens in males. Clinical Endocrinology 58:5, 529-542
    CrossRef

  356. 356

    Guitty Eghbali-Fatourechi, Sundeep Khosla, Arunik Sanyal, William J. Boyle, David L. Lacey, B. Lawrence Riggs. (2003) Role of RANK ligand in mediating increased bone resorption in early postmenopausal women. Journal of Clinical Investigation 111:8, 1221-1230
    CrossRef

  357. 357

    T Remes, S.B Väisänen, A Mahonen, J Huuskonen, H Kröger, J.S Jurvelin, I.M Penttilä, R Rauramaa. (2003) Aerobic exercise and bone mineral density in middle-aged finnish men: a controlled randomized trial with reference to androgen receptor, aromatase, and estrogen receptor α gene polymorphismsPresented in part as an abstract at the 1st Joint Meeting of the International Bone and Mineral Society and the European Calcified Tissue Society, Madrid, Spain, 2001.. Bone 32:4, 412-420
    CrossRef

  358. 358

    Yuichiro Tanaka, Masahiro Sasaki, Masanori Kaneuchi, Seiichiro Fujimoto, Rajvir Dahiya. (2003) Estrogen receptor alpha polymorphisms and renal cell carcinoma—a possible risk. Molecular and Cellular Endocrinology 202:1-2, 109-116
    CrossRef

  359. 359

    Yanovski, Jack A., Rose, Susan R., Municchi, Giovanna, Pescovitz, Ora H., Hill, Suvimol C., Cassorla, Fernando G., Cutler, Gordon B. Jr., . (2003) Treatment with a Luteinizing Hormone–Releasing Hormone Agonist in Adolescents with Short Stature. New England Journal of Medicine 348:10, 908-917
    Full Text

  360. 360

    Vincenzo Rochira, Matteo Fabbi, Elena Valassi, Bruno Madeo, Cesare Carani. (2003) Estrogens and male reproduction. Andrologie 13:1, 57-61
    CrossRef

  361. 361

    Vincenzo Rochira, Matteo Fabbi, Elena Valassi, Bruno Madeo, Cesare Carani. (2003) Oestrogènes et reproduction masculine. Andrologie 13:1, 51-56
    CrossRef

  362. 362

    Sundeep Khosla, John P Bilezikian. (2003) The role of estrogens in men and androgens in women. Endocrinology & Metabolism Clinics of North America 32:1, 195-218
    CrossRef

  363. 363

    Stefano Mora, Vicente Gilsanz. (2003) Establishment of peak bone mass. Endocrinology & Metabolism Clinics of North America 32:1, 39-63
    CrossRef

  364. 364

    Patrick Fenichel. (2003) œstrogènes et contrôle de la prolifération germinale. Andrologie 13:1, 28-33
    CrossRef

  365. 365

    Matthew R. Smith. (2003) Diagnosis and management of treatment-related osteoporosis in men with prostate carcinoma. Cancer 97:S3, 789-795
    CrossRef

  366. 366

    Jiro Fujimoto, Wen-Shu Sun, Ryou Misao, Hideki Sakaguchi, Ikumi Aoki, Hiroshi Toyoki, Teruhiko Tamaya. (2003) Expression of estrogen receptor β exon-deleted variant mRNAs in ovary and uterine endometrium. The Journal of Steroid Biochemistry and Molecular Biology 84:2-3, 133-140
    CrossRef

  367. 367

    Deborah L. Swope, Kenneth S. Korach. 2003. Estrogen Receptor Biology and Lessons from Knockout Mice. , 608-614.
    CrossRef

  368. 368

    Boonsong Ongphiphadhanakul. (2003) Genetic Polymorphisms of Estrogen Receptor-??. American Journal of PharmacoGenomics 3:1, 5-9
    CrossRef

  369. 369

    Shalender Bhasin. 2003. Androgen Effects in Mammals. , 70-83.
    CrossRef

  370. 370

    Matthew R Smith, Mary Anne Fallon, Melissa J Goode. (2003) Cross-sectional study of bone turnover during bicalutamide monotherapy for prostate cancer. Urology 61:1, 127-131
    CrossRef

  371. 371

    Matthew R. Smith. (2003) Bisphosphonates to Prevent Osteoporosis in Men Receiving Androgen Deprivation Therapy for Prostate Cancer. Drugs & Aging 20:3, 175-183
    CrossRef

  372. 372

    Evan R. Simpson. 2003. Aromatase and Estrogen Insufficiency. , 179-186.
    CrossRef

  373. 373

    Hideki Sakaguchi, Jiro Fujimoto, Ikumi Aoki, Teruhiko Tamaya. (2003) Expression of estrogen receptor α and β in myometrium of premenopausal and postmenopausal women. Steroids 68:1, 11-19
    CrossRef

  374. 374

    Tomohiko Urano. (2003) Nippon Ronen Igakkai Zasshi. Japanese Journal of Geriatrics 40:4, 336-338
    CrossRef

  375. 375

    Alan D Rogol. (2002) Androgens and puberty. Molecular and Cellular Endocrinology 198:1-2, 25-29
    CrossRef

  376. 376

    Alan D Rogol, James N Roemmich, Pamela A Clark. (2002) Growth at puberty. Journal of Adolescent Health 31:6, 192-200
    CrossRef

  377. 377

    MARIA ROSA MADURO, DOLORES J. LAMB. (2002) Understanding New Genetics of Male Infertility. The Journal of Urology2197-2205
    CrossRef

  378. 378

    Masatoshi Inoue, Shohei Minami, Yoshinori Nakata, Hiroshi Kitahara, Yoshinori Otsuka, Keijiro Isobe, Masashi Takaso, Makoto Tokunaga, Shinsuke Nishikawa, Tetsuro Maruta, Hideshige Moriya. (2002) Association Between Estrogen Receptor Gene Polymorphisms and Curve Severity of Idiopathic Scoliosis. Spine 27:21, 2357-2362
    CrossRef

  379. 379

    Paul J. Turek, Renee A. Reijo Pera. (2002) Current and future genetic screening for male infertility. Urologic Clinics of North America 29:4, 767-792
    CrossRef

  380. 380

    K.O Han, J.T Choi, I.G Moon, M.S Jeong, C.H Yim, H.Y Chung, H.C Jang, H.K Yoon, I.K Han. (2002) Nonassociation of interleukin-1 receptor antagonist genotypes with bone mineral density, bone turnover status, and estrogen responsiveness in Korean postmenopausal women. Bone 31:5, 612-615
    CrossRef

  381. 381

    MARIA ROSA MADURO, DOLORES J. LAMB. (2002) Understanding New Genetics of Male Infertility. The Journal of Urology 168:5, 2197-2205
    CrossRef

  382. 382

    Farjaad M. Siddiq, Mark Sigman. (2002) A new look at the medical management of infertility. Urologic Clinics of North America 29:4, 949-963
    CrossRef

  383. 383

    Trevor J. Powles. (2002) Anti-oestrogenic prevention of breast cancer — the make or break point. Nature Reviews Cancer 2:10, 787-794
    CrossRef

  384. 384

    Toshiaki Tanaka, Pinchas Cohen, Peter E. Clayton, Zvi Laron, Raymond L. Hintz, Pierre C. Sizonenko. (2002) Diagnosis and management of growth hormone deficiency in childhood and adolescence – Part 2: Growth hormone treatment in growth hormone deficient children. Growth Hormone & IGF Research 12:5, 323-341
    CrossRef

  385. 385

    Jennifer Batch. (2002) Turner syndrome in childhood and adolescence. Best Practice & Research Clinical Endocrinology & Metabolism 16:3, 465-482
    CrossRef

  386. 386

    P. J. Ehrlich, B. S. Noble, H. L. Jessop, H. Y. Stevens, J. R. Mosley, L. E. Lanyon. (2002) The Effect of In Vivo Mechanical Loading on Estrogen Receptor α Expression in Rat Ulnar Osteocytes. Journal of Bone and Mineral Research 17:9, 1646-1655
    CrossRef

  387. 387

    Geoffrey Ambler. (2002) Overgrowth. Best Practice & Research Clinical Endocrinology & Metabolism 16:3, 519-546
    CrossRef

  388. 388

    Matthew R Smith. (2002) Osteoporosis during androgen deprivation therapy for prostate cancer. Urology 60:3, 79-85
    CrossRef

  389. 389

    Ze'ev Hochberg. (2002) Clinical physiology and pathology of the growth plate. Best Practice & Research Clinical Endocrinology & Metabolism 16:3, 399-419
    CrossRef

  390. 390

    Masahiro Sasaki, Yuichiro Tanaka, Masanori Kaneuchi, Noriaki Sakuragi, Rajvir Dahiya. (2002) Polymorphisms of estrogen receptor α gene in endometrial cancer. Biochemical and Biophysical Research Communications 297:3, 558-564
    CrossRef

  391. 391

    Anna Cardone, Raffaella Comitato, Luigi Bellini, Francesco Angelini. (2002) Effects of the aromatase inhibitor fadrozole on plasma sex steroid secretion, spermatogenesis and epididymis morphology in the lizard,Podarcis sicula. Molecular Reproduction and Development 63:1, 63-70
    CrossRef

  392. 392

    Armando Arroyo, Flavia Pernasetti, Vyacheslav V. Vasilyev, Paula Amato, Samuel S. C. Yen, Pamela L. Mellon. (2002) A unique case of combined pituitary hormone deficiency caused by a PROP1 gene mutation (R120C) associated with normal height and absent puberty. Clinical Endocrinology 57:2, 283-291
    CrossRef

  393. 393

    H.H.L Lau, A.Y.Y Ho, K.D.K Luk, A.W.C Kung. (2002) Estrogen receptor β gene polymorphisms are associated with higher bone mineral density in premenopausal, but not postmenopausal southern Chinese women. Bone 31:2, 276-281
    CrossRef

  394. 394

    S. C. C. M. van Coeverden, J. C. Netelenbos, C. M. de Ridder, J. C. Roos, C. Popp-Snijders, H. A. Delemarre-van de Waal. (2002) Bone metabolism markers and bone mass in healthy pubertal boys and girls. Clinical Endocrinology 57:1, 107-116
    CrossRef

  395. 395

    Sara H Windahl, Göran Andersson, Jan-Åke Gustafsson. (2002) Elucidation of estrogen receptor function in bone with the use of mouse models. Trends in Endocrinology & Metabolism 13:5, 195-200
    CrossRef

  396. 396

    Vincenzo Rochira, Antonio Balestrieri, Bruno Madeo, Antonio Spaggiari, Cesare Carani. (2002) Congenital estrogen deficiency in men: a new syndrome with different phenotypes; clinical and therapeutic implications in men. Molecular and Cellular Endocrinology 193:1-2, 19-28
    CrossRef

  397. 397

    Serge Carreau, Sonia Bourguiba, Sophie Lambard, Isabelle Galeraud-Denis, Christelle Genissel, Jérôme Levallet. (2002) Reproductive system: aromatase and estrogens. Molecular and Cellular Endocrinology 193:1-2, 137-143
    CrossRef

  398. 398

    Elizabeth Burgess, Mark S. Nanes. (2002) Osteoporosis in men: pathophysiology, evaluation, and therapy. Current Opinion in Rheumatology 14:4, 421-428
    CrossRef

  399. 399

    J Huuskonen, S.B Väisänen, H Kröger, J.S Jurvelin, I Penttilä, E Alhava, R Rauramaa. (2002) Relation of sex hormones to bone mineral density in middle-aged men during a 4 year exercise intervention trial. Bone 31:1, 51-56
    CrossRef

  400. 400

    Y Ishimi, M Yoshida, S Wakimoto, J Wu, H Chiba, X Wang, K Takeda, C Miyaura. (2002) Genistein, a soybean isoflavone, affects bone marrow lymphopoiesis and prevents bone loss in castrated male mice. Bone 31:1, 180-185
    CrossRef

  401. 401

    Y Murata, K.M Robertson, M.E.E Jones, E.R Simpson. (2002) Effect of estrogen deficiency in the male: the ArKO mouse model. Molecular and Cellular Endocrinology 193:1-2, 7-12
    CrossRef

  402. 402

    Shehzad Basaria, John Lieb, Alice M. Tang, Theodore DeWeese, Michael Carducci, Mario Eisenberger, Adrian S. Dobs. (2002) Long-term effects of androgen deprivation therapy in prostate cancer patients. Clinical Endocrinology 56:6, 779-786
    CrossRef

  403. 403

    A. Kukuvitis, I. Georgiou, I. Bouba, A. Tsirka, CH. Giannouli, C. Yapijakis, B. Tarlatzis, J. Bontis, D. Lolis, N. Sofikitis, J. Papadimas. (2002) Association of oestrogen receptor alpha polymorphisms and androgen receptor CAG trinucleotide repeats with male infertility: a study in 109 Greek infertile men. International Journal of Andrology 25:3, 149-152
    CrossRef

  404. 404

    ALVIN M. MATSUMOTO, LISA TENOVER, MICHAEL McCLUNG, DAVID MOBLEY, JACK GELLER, MICHAEL SULLIVAN, JOHN GRAYHACK, HUNTER WESSELLS, DOV KADMON, MALACHI FLANAGAN, GANG K. ZHANG, JOSEPH SCHMIDT, ALICE M. TAYLOR, MICHAEL LEE, JOANNE WALDSTREICHER. (2002) The Long-Term Effect Of Specific Type II 5α-Reductase Inhibition With Finasteride on Bone Mineral Density in Men: Results of a 4-Year Placebo Controlled Trial. The Journal of Urology 167:5, 2105-2108
    CrossRef

  405. 405

    B. Ongphiphadhanakul, S. Thamprajamchit, S. Chanprasertyothin, L. Chailurkit, R. Rajatanavin. (2002) Effect of estrogen replacement on insulin sensitivity, serum lipid and bone resorption marker in hypogonadal males. Maturitas 42:1, 85-89
    CrossRef

  406. 406

    L. Gennari, L. Becherini, A. Falchetti, L. Masi, F. Massart, M.L. Brandi. (2002) Genetics of osteoporosis: role of steroid hormone receptor gene polymorphisms. The Journal of Steroid Biochemistry and Molecular Biology 81:1, 1-24
    CrossRef

  407. 407

    Ego Seeman. (2002) Pathogenesis of bone fragility in women and men. The Lancet 359:9320, 1841-1850
    CrossRef

  408. 408

    A. Lania, E. Gangi, R. Romoli, M. Losa, P. Travaglini, D. Meringolo, B. Ambrosi, G. Faglia, P. Beck-Peccoz, A. Spada. (2002) Impaired estrogen-induced negative feedback on gonadotropin secretion in patients with gonadotropin-secreting and nonfunctioning pituitary adenomas. European Journal of Clinical Investigation 32:5, 335-340
    CrossRef

  409. 409

    ALVIN M. MATSUMOTO, LISA TENOVER, MICHAEL McCLUNG, DAVID MOBLEY, JACK GELLER, MICHAEL SULLIVAN, JOHN GRAYHACK, HUNTER WESSELLS, DOV KADMON, MALACHI FLANAGAN, GANG K. ZHANG, JOSEPH SCHMIDT, ALICE M. TAYLOR, MICHAEL LEE, JOANNE WALDSTREICHER. (2002) The Long-Term Effect Of Specific Type II 5??-Reductase Inhibition With Finasteride on Bone Mineral Density in Men: Results of a 4-Year Placebo Controlled Trial. The Journal of Urology2105-2108
    CrossRef

  410. 410

    Michaela Luconi, Gianni Forti, Elisabetta Baldi. (2002) Genomic and nongenomic effects of estrogens: molecular mechanisms of action and clinical implications for male reproduction. The Journal of Steroid Biochemistry and Molecular Biology 80:4-5, 369-381
    CrossRef

  411. 411

    Evan R Simpson. (2002) Aromatization of androgens in women: current concepts and findings. Fertility and Sterility 77, 6-10
    CrossRef

  412. 412

    John P. Bilezikian. (2002) Sex Steroids, Mice, and Men: When Androgens and Estrogens Get Very Close to Each Other. Journal of Bone and Mineral Research 17:4, 563-566
    CrossRef

  413. 413

    Emmanuel Lemazurier, Marie Pierre Toquet, Guillaume Fortier, Gilles Eric Séralini. (2002) Sex steroids in serum of prepubertal male and female horses and correlation with bone characteristics. Steroids 67:5, 361-369
    CrossRef

  414. 414

    Herrington, David M., Howard, Timothy D., Hawkins, Gregory A., Reboussin, David M., Xu, Jianfeng, Zheng, Siqun L., Brosnihan, K. Bridget, Meyers, Deborah A., Bleecker, Eugene R., . (2002) Estrogen-Receptor Polymorphisms and Effects of Estrogen Replacement on High-Density Lipoprotein Cholesterol in Women with Coronary Disease. New England Journal of Medicine 346:13, 967-974
    Full Text

  415. 415

    Brian M Brady, Richard A Anderson. (2002) Advances in male contraception. Expert Opinion on Investigational Drugs 11:3, 333-344
    CrossRef

  416. 416

    Evan R. Simpson, Colin Clyne, Gary Rubin, Wah Chin Boon, Kirsten Robertson, Kara Britt, Caroline Speed, Margaret Jones. (2002) A ROMATASE —A B RIEF O VERVIEW. Annual Review of Physiology 64:1, 93-127
    CrossRef

  417. 417

    B.C.J Van der Eerden, E.F Gevers, C.W.G.M Löwik, M Karperien, J.M Wit. (2002) Expression of estrogen receptor α and β in the epiphyseal plate of the rat. Bone 30:3, 478-485
    CrossRef

  418. 418

    Sundeep Khosla. (2002) Oestrogen, bones and men: when testosterone just isn't enough. Clinical Endocrinology 56:3, 291-293
    CrossRef

  419. 419

    Emmanuel Lemazurier, Safa Moslemi, Pascal Sourdaine, Isabelle Desjardins, Bruno Plainfosse, Gilles-Eric Seralini. (2002) Free and Conjugated Estrogens and Androgens in Stallion Semen. General and Comparative Endocrinology 125:2, 272-282
    CrossRef

  420. 420

    Gabor M Rubanyi, Katalin Kauser, Anthony Johns. (2002) Role of estrogen receptors in the vascular system. Vascular Pharmacology 38:2, 81-88
    CrossRef

  421. 421

    Jan Tesarik, Peter Nagy, Roger Abdelmassih, Ermanno Greco, Carmen Mendoza. (2002) Pharmacological concentrations of follicle-stimulating hormone and testosterone improve the efficacy of in vitro germ cell differentiation in men with maturation arrest. Fertility and Sterility 77:2, 245-251
    CrossRef

  422. 422

    A. M. Matsumoto. (2002) Andropause: Clinical Implications of the Decline in Serum Testosterone Levels With Aging in Men. The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 57:2, M76-M99
    CrossRef

  423. 423

    Gruber, Christian J., Tschugguel, Walter, Schneeberger, Christian, Huber, Johannes C., . (2002) Production and Actions of Estrogens. New England Journal of Medicine 346:5, 340-352
    Full Text

  424. 424

    Carlos A. Gartner, Sidney D. Nelson. 2002. Aromatase, The Enzyme Responsible for Estrogen Biosynthesis. .
    CrossRef

  425. 425

    M. Beato, J. Klug. 2002. Estrogen Receptors. .
    CrossRef

  426. 426

    Per E. L??nning. (2002) Aromatase Inhibitors and Inactivators for Breast Cancer Therapy. Drugs & Aging 19:4, 277-298
    CrossRef

  427. 427

    R. Luboshitzky, Z. Shen-Orr, P. Herer. (2002) SEMINAL PLASMA MELATONIN AND GONADAL STEROIDS CONCENTRATIONS IN NORMAL MEN. Systems Biology in Reproductive Medicine 48:3, 225-232
    CrossRef

  428. 428

    Paul S. Bury, Lise B. Christiansen, Poul Jacobsen, Anker S. Jørgensen, Anders Kanstrup, Lars Nærum, Steven Bain, Christian Fledelius, Birgitte Gissel, Birgit S. Hansen, Niels Korsgaard, Susan M. Thorpe, Karsten Wassermann. (2002) Synthesis and pharmacological evaluation of novel cis-3,4-Diaryl-hydroxychromanes as high affinity partial agonists for the estrogen receptor. Bioorganic & Medicinal Chemistry 10:1, 125-145
    CrossRef

  429. 429

    Sanae Kanazawa. (2002) Bone Maturation and Bone Mineralization in Precocious Puberty: Relation to Estrogen Receptor Gene Polymorphisms. Clinical Pediatric Endocrinology 11:1, 11-17
    CrossRef

  430. 430

    N.A Sims, S Dupont, A Krust, P Clement-Lacroix, D Minet, M Resche-Rigon, M Gaillard-Kelly, R Baron. (2002) Deletion of estrogen receptors reveals a regulatory role for estrogen receptors-β in bone remodeling in females but not in males. Bone 30:1, 18-25
    CrossRef

  431. 431

    Saiko Ikegami, Tadashi Moriwake, Hiroyuki Tanaka, Masaru Inoue, Toshihide Kubo, Satoshi Suzuki, Susumu Kanzaki, Yoshiki Seino. (2001) An ultrasensitive assay revealed age-related changes in serum oestradiol at low concentrations in both sexes from infancy to puberty. Clinical Endocrinology 55:6, 789-795
    CrossRef

  432. 432

    Makio Shozu, Hiroshi Sumitani, Kouichi Murakami, Tomoya Segawa, Hei-Juan Yang, Masaki Inoue. (2001) Regulation of aromatase activity in bone-derived cells: possible role of mitogen-activated protein kinase. The Journal of Steroid Biochemistry and Molecular Biology 79:1-5, 61-65
    CrossRef

  433. 433

    S. Carreau, S. Bourguiba, S. Lambard, I. Galeraud-Denis, C. Genissel, B. Bilinska, M. Benahmed, J. Levallet. (2001) Aromatase expression in male germ cells. The Journal of Steroid Biochemistry and Molecular Biology 79:1-5, 203-208
    CrossRef

  434. 434

    Huey-Yi Chen, Wen-Chi Chen, Horng-Der Tsai, Cheng-Der Hsu, Fuu-Jen Tsai, Chang-Hai Tsai. (2001) Relation of the estrogen receptor α gene microsatellite polymorphism to bone mineral density and the susceptibility to osteoporosis in postmenopausal Chinese women in Taiwan. Maturitas 40:2, 143-150
    CrossRef

  435. 435

    Nadine G. Haddad, John S. Fuqua. (2001) Phytoestrogens: Effects on the Reproductive System. The Endocrinologist 11:6, 498-505
    CrossRef

  436. 436

    Patrick M. Doran, B. Lawrence Riggs, Elizabeth J. Atkinson, Sundeep Khosla. (2001) Effects of Raloxifene, a Selective Estrogen Receptor Modulator, on Bone Turnover Markers and Serum Sex Steroid and Lipid Levels in Elderly Men. Journal of Bone and Mineral Research 16:11, 2118-2125
    CrossRef

  437. 437

    Charles E. Roselli, Scott Klosterman, John A. Resko. (2001) Anatomic relationships between aromatase and androgen receptor mRNA expression in the hypothalamus and amygdala of adult male cynomolgus monkeys. The Journal of Comparative Neurology 439:2, 208-223
    CrossRef

  438. 438

    Kayo Sumida, Norihisa Ooe, Koichi Saito, Hideo Kaneko. (2001) Molecular cloning and characterization of reptilian estrogen receptor cDNAs. Molecular and Cellular Endocrinology 183:1-2, 33-39
    CrossRef

  439. 439

    A. Anwar, P. G. McTernan, L. A. Anderson, J. Askaa, C. G. Moody, A. H. Barnett, M. C. Eggo, S. Kumar. (2001) Site-specific regulation of oestrogen receptor-α and -β by oestradiol in human adipose tissue. Diabetes, Obesity and Metabolism 3:5, 338-349
    CrossRef

  440. 440

    Ariadne Malamitsi-Puchner, John Tziotis, Dimitrios Evangelopoulos, Lazaros Fountas, George Vlachos, George Creatsas, Constantine E Sekeris, Paraskevi Moutsatsou. (2001) Gene analysis of the N-terminal region of the estrogen receptor alpha in preeclampsia. Steroids 66:9, 695-700
    CrossRef

  441. 441

    Erica A Eugster, Ora H Pescovitz. (2001) Advances in the treatment of precocious puberty. Expert Opinion on Investigational Drugs 10:9, 1623-1630
    CrossRef

  442. 442

    Sara H. Windahl, Karin Hollberg, Olle Vidal, Jan-Åke Gustafsson, Claes Ohlsson, Göran Andersson. (2001) Female Estrogen Receptor β−/− Mice Are Partially Protected Against Age-Related Trabecular Bone Loss. Journal of Bone and Mineral Research 16:8, 1388-1398
    CrossRef

  443. 443

    Thomas L. McCarthy, Michael Centrella. (2001) Local IGF-I expression and bone formation. Growth Hormone & IGF Research 11:4, 213-219
    CrossRef

  444. 444

    Anders Juul. (2001) The effects of oestrogens on linear bone growth. APMIS 109:S103, S124-S134
    CrossRef

  445. 445

    E Legrand, C Hedde, Y Gallois, I Degasne, F Boux de Casson, E Mathieu, M.-F Baslé, D Chappard, M Audran. (2001) Osteoporosis in men: a potential role for the sex hormone binding globulin. Bone 29:1, 90-95
    CrossRef

  446. 446

    P. Albertazzi, D.W. Purdie. (2001) Oestrogen and selective oestrogen receptor modulators (SERMs): current roles in the prevention and treatment of osteoporosis. Best Practice & Research Clinical Rheumatology 15:3, 451-468
    CrossRef

  447. 447

    Liesbeth Vandenput, Antwan G.H. Ederveen, Reinhold G. Erben, Kerstin Stahr, Johannes V. Swinnen, Erik Van Herck, Annemieke Verstuyf, Steven Boonen, Roger Bouillon, Dirk Vanderschueren. (2001) Testosterone Prevents Orchidectomy-Induced Bone Loss in Estrogen Receptor-α Knockout Mice. Biochemical and Biophysical Research Communications 285:1, 70-76
    CrossRef

  448. 448

    Sanja Jurada, Janja Marc, Janez Preželj, Andreja Kocijančič, Radovan Komel. (2001) Codon 325 sequence polymorphism of the estrogen receptor α gene and bone mineral density in postmenopausal women. The Journal of Steroid Biochemistry and Molecular Biology 78:1, 15-20
    CrossRef

  449. 449

    Michaela Luconi, Lorella Bonaccorsi, Gianni Forti, Elisabetta Baldi. (2001) Effects of estrogenic compounds on human spermatozoa: evidence for interaction with a nongenomic receptor for estrogen on human sperm membrane. Molecular and Cellular Endocrinology 178:1-2, 39-45
    CrossRef

  450. 450

    G Lombardi, S Zarrilli, A Colao, L Paesano, C Di Somma, F Rossi, M De Rosa. (2001) Estrogens and health in males. Molecular and Cellular Endocrinology 178:1-2, 51-55
    CrossRef

  451. 451

    Rogerio A. Lobo. (2001) Androgens in Postmenopausal Women: Production, Possible Role, and Replacement Options. Obstetric and Gynecologic Survey 56:6, 361-376
    CrossRef

  452. 452

    Aaron Tabensky, Yunbo Duan, Jan Edmonds, Ego Seeman. (2001) The Contribution of Reduced Peak Accrual of Bone and Age-Related Bone Loss to Osteoporosis at the Spine and Hip: Insights from the Daughters of Women with Vertebral or Hip Fractures. Journal of Bone and Mineral Research 16:6, 1101-1107
    CrossRef

  453. 453

    Richard Stanhope. (2001) Use of a specific aromatase inhibitor in delayed puberty. The Lancet 357:9270, 1723-1724
    CrossRef

  454. 454

    Christina Wang, Ronald S. Swerdloff, Ali Iranmanesh, Adrian Dobs, Peter J. Snyder, Glenn Cunningham, Alvin M. Matsumoto, Thomas Weber, Nancy Berman, . (2001) Effects of transdermal testosterone gel on bone turnover markers and bone mineral density in hypogonadal men. Clinical Endocrinology 54:6, 739-750
    CrossRef

  455. 455

    Vincenzo Rochira, Antonio Balestrieri, Bruno Madeo, Enrica Baraldi, Marco Faustini-Fustini, Antonio R.M Granata, Cesare Carani. (2001) Congenital estrogen deficiency: in search of the estrogen role in human male reproduction. Molecular and Cellular Endocrinology 178:1-2, 107-115
    CrossRef

  456. 456

    Paul S Cooke, Patricia A Heine, Julia A Taylor, Dennis B Lubahn. (2001) The role of estrogen and estrogen receptor-α in male adipose tissue. Molecular and Cellular Endocrinology 178:1-2, 147-154
    CrossRef

  457. 457

    Stefanie Denger, George Reid, Heike Brand, Martin Kos, Frank Gannon. (2001) Tissue-specific expression of human ERα and ERβ in the male. Molecular and Cellular Endocrinology 178:1-2, 155-160
    CrossRef

  458. 458

    Sanna Wickman, Ilkka Sipilä, Carina Ankarberg-Lindgren, Ensio Norjavaara, Leo Dunkel. (2001) A specific aromatase inhibitor and potential increase in adult height in boys with delayed puberty: a randomised controlled trial. The Lancet 357:9270, 1743-1748
    CrossRef

  459. 459

    Dipak Mahato, Eugenia H. Goulding, Kenneth S. Korach, Edward M. Eddy. (2001) Estrogen receptor-α is required by the supporting somatic cells for spermatogenesis. Molecular and Cellular Endocrinology 178:1-2, 57-63
    CrossRef

  460. 460

    Vincenzo Rochira, Antonio Balestrieri, Marco Faustini-Fustini, Cesare Carani. (2001) Role of estrogen on bone in the human male: insights from the natural models of congenital estrogen deficiency. Molecular and Cellular Endocrinology 178:1-2, 215-220
    CrossRef

  461. 461

    Jinong Feng, Jin Yan, Shawneen Michaud, Nick Craddock, Ian R. Jones, Edwin H. Cook, David Goldman, Leonard L. Heston, Leena Peltonen, Lynn E. Delisi, Steve S. Sommer. (2001) Scanning of estrogen receptor ? (ER?) and thyroid hormone receptor ? (TR?) genes in patients with psychiatric diseases: Four missense mutations identified in ER? gene. American Journal of Medical Genetics 105:4, 369-374
    CrossRef

  462. 462

    Erick Legrand. (2001) Men with osteoporosis: are they being treated fairly?. Joint Bone Spine 68:3, 191-193
    CrossRef

  463. 463

    P. Pietschmann, S. Kudlacek, J. Grisar, S. Spitzauer, W. Woloszczuk, R. Willvonseder, M. Peterlik. (2001) Bone turnover markers and sex hormones in men with idiopathic osteoporosis. European Journal of Clinical Investigation 31:5, 444-451
    CrossRef

  464. 464

    Antonio Balestrieri, Marco Faustini-Fustini, Vincenzo Rochira, Cesare Carani. (2001) Clinical implications and management of oestrogen deficiency in the male. Clinical Endocrinology 54:4, 431-432
    CrossRef

  465. 465

    Hua Zhu Ke, Hong Qi, Kristin L. Chidsey-Frink, D. Todd Crawford, David D. Thompson. (2001) Lasofoxifene (CP-336,156) Protects Against the Age-Related Changes in Bone Mass, Bone Strength, and Total Serum Cholesterol in Intact Aged Male Rats. Journal of Bone and Mineral Research 16:4, 765-773
    CrossRef

  466. 466

    D.F Gunther, L.E Underwood, A.S Calikoglu. (2001) Androgen-accelerated bone maturation in mice is not attenuated by Faslodex, an estrogen receptor blocker. Bone 28:4, 410-413
    CrossRef

  467. 467

    Maria I. New, S. Nimkarn, D.D. Brandon, S. Cunningham-Rundles, R.C. Wilson, R.S. Newfield, J. Vandermeulen, N. Barron, C. Russo, D.L. Loriaux, B. O'Malley. (2001) Resistance to multiple steroids in two sisters. The Journal of Steroid Biochemistry and Molecular Biology 76:1-5, 161-166
    CrossRef

  468. 468

    Deborah P. Merke, Gordon B. Cutler. (2001) NEW IDEAS FOR MEDICAL TREATMENT OF CONGENITAL ADRENAL HYPERPLASIA. Endocrinology & Metabolism Clinics of North America 30:1, 121-135
    CrossRef

  469. 469

    Katarina Pettersson, Jan-Åke Gustafsson. (2001) R OLE OF E STROGEN R ECEPTOR B ETA IN E STROGEN A CTION. Annual Review of Physiology 63:1, 165-192
    CrossRef

  470. 470

    Isobel P. Braidman, Linda Hainey, Gaurav Batra, Peter L. Selby, Philippa T.K. Saunders, Judith A. Hoyland. (2001) Localization of Estrogen Receptor β Protein Expression in Adult Human Bone. Journal of Bone and Mineral Research 16:2, 214-220
    CrossRef

  471. 471

    Shreyasee Amin, David T. Felson. (2001) Osteoporosis in Men. Rheumatic Disease Clinics of North America 27:1, 19-47
    CrossRef

  472. 472

    Chisato Miyaura, Katsumi Toda, Masaki Inada, Tomoyasu Ohshiba, Chiho Matsumoto, Teruhiko Okada, Masako Ito, Yutaka Shizuta, Akira Ito. (2001) Sex- and Age-Related Response to Aromatase Deficiency in Bone. Biochemical and Biophysical Research Communications 280:4, 1062-1068
    CrossRef

  473. 473

    Wendell W. Weber. (2001) Pharmacogenetic Tactics and Strategies. Paediatric Drugs 3:12, 863-881
    CrossRef

  474. 474

    Emma E. Hobson, Stuart H. Ralston. (2001) Role of genetic factors in the pathophysiology and management of osteoporosis. Clinical Endocrinology 54:1, 1-9
    CrossRef

  475. 475

    Benson T Akingbemi, Matthew P Hardy. (2001) Oestrogenic and antiandrogenic chemicals in the environment: effects on male reproductive health. Annals of Medicine 33:6, 391-403
    CrossRef

  476. 476

    Omar M. E. Albagha, Fiona E. A. McGuigan, David M. Reid, Stuart H. Ralston. (2001) Estrogen Receptor α Gene Polymorphisms and Bone Mineral Density: Haplotype Analysis in Women from the United Kingdom. Journal of Bone and Mineral Research 16:1, 128-134
    CrossRef

  477. 477

    E. N. Kassi, P. G. Vlachoyiannopoulos, H. M. Moutsopoulos, C. E. Sekeris, P. Moutsatsou. (2001) Molecular analysis of estrogen receptor alpha and beta in lupus patients. European Journal of Clinical Investigation 31:1, 86-93
    CrossRef

  478. 478

    Alireza Falahati-Nini, B. Lawrence Riggs, Elizabeth J. Atkinson, W. Michael O’Fallon, Richard Eastell, Sundeep Khosla. (2000) Relative contributions of testosterone and estrogen in regulating bone resorption and formation in normal elderly men. Journal of Clinical Investigation 106:12, 1553-1560
    CrossRef

  479. 479

    Eric S. Orwoll. (2000) Osteoporosis in men. Current Opinion in Endocrinology & Diabetes 7:6, 303-309
    CrossRef

  480. 480

    Timo Salmén, Anna-Mari Heikkinen, Anitta Mahonen, Heikki Kröger, Marja Komulainen, Seppo Saarikoski, Risto Honkanen, Pekka H. Mäenpää. (2000) The Protective Effect of Hormone-Replacement Therapy on Fracture Risk Is Modulated by Estrogen Receptor α Genotype in Early Postmenopausal Women. Journal of Bone and Mineral Research 15:12, 2479-2486
    CrossRef

  481. 481

    Millan S. Patel, David E. C. Cole, Janice D. Smith, Gillian A. Hawker, Betty Wong, Hoang Trang, Reinhold Vieth, Paul Meltzer, Laurence A. Rubin. (2000) Alleles of the Estrogen Receptor α-Gene and an Estrogen Receptor Cotranscriptional Activator Gene, Amplified in Breast Cancer-1 (AIB1), Are Associated with Quantitative Calcaneal Ultrasound. Journal of Bone and Mineral Research 15:11, 2231-2239
    CrossRef

  482. 482

    Claes Ohlsson, Nina Hellberg, Paolo Parini, Olle Vidal, Mohammed Bohlooly, Mats Rudling, Marie K. Lindberg, Margaret Warner, Bo Angelin, Jan-Åke Gustafsson. (2000) Obesity and Disturbed Lipoprotein Profile in Estrogen Receptor-α-Deficient Male Mice. Biochemical and Biophysical Research Communications 278:3, 640-645
    CrossRef

  483. 483

    Jonathan Reeve. (2000) How do women develop fragile bones?. The Journal of Steroid Biochemistry and Molecular Biology 74:5, 375-381
    CrossRef

  484. 484

    Bente L. Langdahl, Elsebet Løkke, Mette Carstens, Lise Lotte Stenkjaer, Erik Fink Eriksen. (2000) A TA Repeat Polymorphism in the Estrogen Receptor Gene Is Associated with Osteoporotic Fractures but Polymorphisms in the First Exon and Intron Are Not. Journal of Bone and Mineral Research 15:11, 2222-2230
    CrossRef

  485. 485

    E. Damien, J. S. Price, L. E. Lanyon. (2000) Mechanical Strain Stimulates Osteoblast Proliferation Through the Estrogen Receptor in Males as Well as Females. Journal of Bone and Mineral Research 15:11, 2169-2177
    CrossRef

  486. 486

    D Vanderschueren, S Boonen, A.G.H Ederveen, R de Coster, E Van Herck, K Moermans, L Vandenput, A Verstuyf, R Bouillon. (2000) Skeletal effects of estrogen deficiency as induced by an aromatase inhibitor in an aged male rat model. Bone 27:5, 611-617
    CrossRef

  487. 487

    E.Martin Ritzén, Ola Nilsson, Giedre Grigelioniene, Mikael Holst, Lars Sävendahl, Joanna Wroblewski. (2000) Estrogens and human growth. The Journal of Steroid Biochemistry and Molecular Biology 74:5, 383-386
    CrossRef

  488. 488

    Anker Steen Jørgensen, Poul Jacobsen, Lise Brown Christiansen, Paul S. Bury, Anders Kanstrup, Susan M. Thorpe, Lars Nærum, Karsten Wassermann. (2000) Synthesis and estrogen receptor binding affinities of novel pyrrolo[2,1,5-cd]indolizine derivatives. Bioorganic & Medicinal Chemistry Letters 10:20, 2383-2386
    CrossRef

  489. 489

    M. S. Katz. (2000) Geriatrics Grand Rounds: Eve's Rib, or a Revisionist View of Osteoporosis in Men. The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 55:10, M560-M569
    CrossRef

  490. 490

    Mattias Lorentzon, Ronny Lorentzon, Peter Nordström. (2000) Interleukin-6 Gene Polymorphism Is Related to Bone Mineral Density During and After Puberty in Healthy White Males: A Cross-Sectional and Longitudinal Study. Journal of Bone and Mineral Research 15:10, 1944-1949
    CrossRef

  491. 491

    Michelle Bradney, Magnus K. Karlsson, Yunbo Duan, Stephen Stuckey, Shona Bass, Ego Seeman. (2000) Heterogeneity in the Growth of the Axial and Appendicular Skeleton in Boys: Implications for the Pathogenesis of Bone Fragility in Men. Journal of Bone and Mineral Research 15:10, 1871-1878
    CrossRef

  492. 492

    Peter M. Sadow, Sirimon Reutrakul, Roy E. Weiss, Samuel Refetoff. (2000) Resistance to thyroid hormone in the absence of mutations in the thyroid hormone receptor genes. Current Opinion in Endocrinology & Diabetes 7:5, 253-259
    CrossRef

  493. 493

    Elizabeth A. Shirtcliff, Douglas A. Granger, Eve B. Schwartz, Mary J. Curran, Alan Booth, William H. Overman. (2000) Assessing Estradiol in Biobehavioral Studies Using Saliva and Blood Spots: Simple Radioimmunoassay Protocols, Reliability, and Comparative Validity. Hormones and Behavior 38:2, 137-147
    CrossRef

  494. 494

    Isobel P. Braidman, Charlotte Baris, Peter L. Selby, Judith E. Adams, Anthony J. Freemont, Judith A. Hoyland. (2000) Preliminary report of impaired oestrogen receptor-? expression in bone, but no involvement of androgen receptor, in male idiopathic osteoporosis. The Journal of Pathology 192:1, 90-96
    CrossRef

  495. 495

    G. Ravaglia, P. Forti, F. Maioli, B. Nesi, L. Pratelli, D. Cucinotta, L. Bastagli, G. Cavalli. (2000) Body Composition, Sex Steroids, IGF-1, and Bone Mineral Status in Aging Men. The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 55:9, M516-M521
    CrossRef

  496. 496

    Anne M. Kenny, Karen M. Prestwood. (2000) OSTEOPOROSIS. Rheumatic Disease Clinics of North America 26:3, 569-591
    CrossRef

  497. 497

    F Scopacasa, M Horowitz, J.M Wishart, H.A Morris, B.E Chatterton, A.G Need. (2000) The relation between bone density, free androgen index, and estradiol in men 60 to 70 years old. Bone 27:1, 145-149
    CrossRef

  498. 498

    F. Chanetsa, L. S. Hillman, M. G. Thomas, D. H. Keisler. (2000) Estrogen Agonist (Zeranol) Treatment in a Castrated Male Lamb Model: Effects on Growth and Bone Mineral Accretion. Journal of Bone and Mineral Research 15:7, 1361-1367
    CrossRef

  499. 499

    Evan Simpson, Gary Rubin, Colin Clyne, Kirsten Robertson, Liza O’Donnell, Margaret Jones, Susan Davis. (2000) The Role of Local Estrogen Biosynthesis in Males and Females. Trends in Endocrinology & Metabolism 11:5, 184-188
    CrossRef

  500. 500

    Clifford J. Rosen. (2000) Pathogenesis of osteoporosis. Best Practice & Research Clinical Endocrinology & Metabolism 14:2, 181-193
    CrossRef

  501. 501

    Dirk Vanderschueren, Steven Boonen, Roger Bouillon. (2000) Osteoporosis and osteoporotic fractures in men: a clinical perspective. Best Practice & Research Clinical Endocrinology & Metabolism 14:2, 299-315
    CrossRef

  502. 502

    S. Carreau. (2000) Mise au point Estrogènes et reproduction chez le mâle. Andrologie 10:2, 141-147
    CrossRef

  503. 503

    ANNEWIEKE W. van den BELD, STEVEN W.J. LAMBERTS. (2000) Endocrine Determinants of Successful Aging in the Male. Journal of Anti-Aging Medicine 3:2, 159-167
    CrossRef

  504. 504

    Reinhold G. Erben, Johannes Eberle, Kerstin Stahr, Michel Goldberg. (2000) Androgen Deficiency Induces High Turnover Osteopenia in Aged Male Rats: A Sequential Histomorphometric Study. Journal of Bone and Mineral Research 15:6, 1085-1098
    CrossRef

  505. 505

    Minoru Ohsawa, Hideki Mizunuma, Issei Kagami, Sumitaka Miyamoto, Tatsuya Kanuma, Yoshito Ibuki. (2000) Effect of 1,25(OH)2D3 on expression of estrogen receptor-alpha mRNA on rat osteosarcoma cell line (ROS 17/2.8). Life Sciences 66:25, 2465-2472
    CrossRef

  506. 506

    I Braidman, C Baris, L Wood, P Selby, J Adams, A Freemont, J Hoyland. (2000) Preliminary evidence for impaired estrogen receptor-α protein expression in osteoblasts and osteocytes from men with idiopathic osteoporosis. Bone 26:5, 423-427
    CrossRef

  507. 507

    GABOR M. RUBANYI. (2000) Estrogen Receptor Deficiency Leads to Impaired Endothelial Nitric Oxide Production and Premature Coronary Arteriosclerosis. Annals of the New York Academy of Sciences 902:1, 302-306
    CrossRef

  508. 508

    P. C. Hindmarsh. (2000) What's best for the bones in Turner syndrome?. Clinical Endocrinology 52:5, 529-530
    CrossRef

  509. 509

    Karen Rubin. (2000) Pubertal development and bone. Current Opinion in Endocrinology & Diabetes 7:2, 65-70
    CrossRef

  510. 510

    Toshiaki Tanaka. (2000) Growth hormone therapy and puberty: the role of gonadotropin-releasing hormone analogue therapy. Current Opinion in Endocrinology & Diabetes 7:2, 77-81
    CrossRef

  511. 511

    Masami Muramatsu, Satoshi Inoue. (2000) Estrogen Receptors: How Do They Control Reproductive and Nonreproductive Functions?. Biochemical and Biophysical Research Communications 270:1, 1-10
    CrossRef

  512. 512

    Sumito Ogawa, Takayuki Hosoi, Masataka Shiraki, Hajime Orimo, Mitsuru Emi, Masami Muramatsu, Yasuyoshi Ouchi, Satoshi Inoue. (2000) Association of Estrogen Receptor β Gene Polymorphism with Bone Mineral Density. Biochemical and Biophysical Research Communications 269:2, 537-541
    CrossRef

  513. 513

    Orhan K. Öz, Joseph E. Zerwekh, Carolyn Fisher, Kathy Graves, Lydia Nanu, Rita Millsaps, Evan R. Simpson. (2000) Bone Has a Sexually Dimorphic Response to Aromatase Deficiency. Journal of Bone and Mineral Research 15:3, 507-514
    CrossRef

  514. 514

    Andrew C. Karaplis. (2000) Metabolic bone disease: Lessons from knockout mice. Drug Development Research 49:3, 159-166
    CrossRef

  515. 515

    William B. Ershler, Evan T. Keller. (2000) Age-Associated Increased Interleukin-6 Gene Expression, Late-Life Diseases, and Frailty. Annual Review of Medicine 51:1, 245-270
    CrossRef

  516. 516

    M. El Majdoubi, S. Ramaswamy, A. Sahu, T. M. Plant. (2000) Effects of Orchidectomy on Levels of the mRNAs Encoding Gonadotropin-Releasing Hormone and Other Hypothalamic Peptides in the Adult Male Rhesus Monkey (Macaca mulatta)1. Journal of Neuroendocrinology 12:2, 167-176
    CrossRef

  517. 517

    Makio Shozu, Ying Zhao, Evan R. Simpson. (2000) TGF-β1 stimulates expression of the aromatase (CYP19) gene in human osteoblast-like cells and THP-1 cells. Molecular and Cellular Endocrinology 160:1-2, 123-133
    CrossRef

  518. 518

    Y.Z Bagger, H.L Jørgensen, A.-M Heegaard, L Bayer, L Hansen, C Hassager. (2000) No major effect of estrogen receptor gene polymorphisms on bone mineral density or bone loss in postmenopausal danish women. Bone 26:2, 111-116
    CrossRef

  519. 519

    A.S Jørgensen, P Jacobsen, L.B Christiansen, P.S Bury, A Kanstrup, S.M Thorpe, S Bain, L Nærum, K Wassermann. (2000) Synthesis and pharmacology of a novel pyrrolo[2,1,5-cd]indolizine (NNC 45-0095), a high affinity non-steroidal agonist for the estrogen receptor. Bioorganic & Medicinal Chemistry Letters 10:4, 399-402
    CrossRef

  520. 520

    Timo Salmén, Anna-Mari Heikkinen, Anitta Mahonen, Heikki Kröger, Marja Komulainen, Seppo Saarikoski, Risto Honkanen, Pekka H. Mäenpää. (2000) Early Postmenopausal Bone Loss Is Associated with PvuII Estrogen Receptor Gene Polymorphism in Finnish Women: Effect of Hormone Replacement Therapy. Journal of Bone and Mineral Research 15:2, 315-321
    CrossRef

  521. 521

    Randi L. Wolf, Katie L. Stone, Jane A. Cauley. (2000) Update on the epidemiology of osteoporosis. Current Rheumatology Reports 2:1, 74-86
    CrossRef

  522. 522

    Reinhard Stege. (2000) Potential side-effects of endocrine treatment of long duration in prostate cancer. The Prostate 45:S10, 38-42
    CrossRef

  523. 523

    Hari K Bhat, Jaydutt V Vadgama. (2000) Hamster estrogen receptor cDNA: cloning and mRNA expression. The Journal of Steroid Biochemistry and Molecular Biology 72:1-2, 47-53
    CrossRef

  524. 524

    Purdie, Beardsworth. (1999) The selective oestrogen receptor modulation: evolution and clinical applications. British Journal of Clinical Pharmacology 48:6, 785-792
    CrossRef

  525. 525

    Richard O.C. Oreffo, Vesna Kusec, Silke Romberg, James T. Triffitt. (1999) Human bone marrow osteoprogenitors express estrogen receptor-alpha and bone morphogenetic proteins 2 and 4 mRNA during osteoblastic differentiation. Journal of Cellular Biochemistry 75:3, 382-392
    CrossRef

  526. 526

    KATHLEEN M. HOEGER, DAVID S. GUZICK. (1999) The Use of Androgens in Menopause. Clinical Obstetrics and Gynecology 42:4, 883
    CrossRef

  527. 527

    Emma L. Duncan, Matthew A. Brown, Janet Sinsheimer, John Bell, Andrew J. Carr, B. Paul Wordsworth, John A. H. Wass. (1999) Suggestive Linkage of the Parathyroid Receptor Type 1 to Osteoporosis. Journal of Bone and Mineral Research 14:12, 1993-1999
    CrossRef

  528. 528

    Anke Mueller-Fahrnow, Ursula Egner. (1999) Ligand-binding domain of estrogen receptors. Current Opinion in Biotechnology 10:6, 550-556
    CrossRef

  529. 529

    SD Chernausek, KM Attie. (1999) Role of oestrogen therapy in the management of short stature in Turner syndrome. Acta Paediatrica 88:s433, 130-132
    CrossRef

  530. 530

    Elizabeth L Schubert, Ming K Lee, Beth Newman, Mary-Claire King. (1999) Single nucleotide polymorphisms (SNPs) in the estrogen receptor gene and breast cancer susceptibility. The Journal of Steroid Biochemistry and Molecular Biology 71:1-2, 21-27
    CrossRef

  531. 531

    O. Vidal, M. Lindberg, L. Sävendahl, D.B. Lubahn, E.M. Ritzen, J.Å. Gustafsson, C. Ohlsson. (1999) Disproportional Body Growth in Female Estrogen Receptor-α-Inactivated Mice. Biochemical and Biophysical Research Communications 265:2, 569-571
    CrossRef

  532. 532

    Christian P. Pavlovich, W. Reid Pitts. (1999) RE: OSTEOPOROSIS AFTER ORCHIECTOMY FOR PROSTATE CANCER. The Journal of Urology1392
    CrossRef

  533. 533

    Cesare Carani, Vincenzo Rochira, Marco Faustini-Fustini, Antonio Balestrieri, Granata. (1999) Role of oestrogen in male sexual behaviour: insights from the natural model of aromatase deficiency. Clinical Endocrinology 51:4, 517-524
    CrossRef

  534. 534

    G. F. Weinbauer, J. Wessels. (1999) 'Paracrine' control of spermatogenesis. Andrologia 31:5, 249-262
    CrossRef

  535. 535

    Marian F. Young, Suzanne C. Dieudonn??. (1999) Estrogen receptors in bone. Current Opinion in Orthopedics 10:5, 361-366
    CrossRef

  536. 536

    Christian P. Pavlovich, W. Reid Pitts. (1999) RE: OSTEOPOROSIS AFTER ORCHIECTOMY FOR PROSTATE CANCER. The Journal of Urology 162:4, 1392
    CrossRef

  537. 537

    S.H. Windahl, O. Vidal, G. Andersson, J.A. Gustafsson, C. Ohlsson. (1999) Increased cortical bone mineral content but unchanged trabecular bone mineral density in female ERβ–/– mice. Journal of Clinical Investigation 104:7, 895-901
    CrossRef

  538. 538

    JULIA SPENCER BARTHOLD, JOHN V. KRYGER, AMY M. DERUSHA, BARRY P. DUEL, ROMAN JEDNAK, DEBRA F. SKAFAR. (1999) EFFECTS OF AN ENVIRONMENTAL ENDOCRINE DISRUPTOR ON FETAL DEVELOPMENT, ESTROGEN RECEPTOR alpha AND EPIDERMAL GROWTH FACTOR RECEPTOR EXPRESSION IN THE PORCINE MALE GENITAL TRACT. The Journal of Urology 162:3, 864-871
    CrossRef

  539. 539

    Craig D. Rubin. (1999) Southwestern Internal Medicine Conference. The American Journal of the Medical Sciences 318:3, 158
    CrossRef

  540. 540

    C. VANDEVYVER, J. VANHOOF, K. DECLERCK, P. STINISSEN, C. VANDERVORST, L. MICHIELS, J.J. CASSIMAN, S. BOONEN, J. RAUS, P. GEUSENS. (1999) Lack of Association Between Estrogen Receptor Genotypes and Bone Mineral Density, Fracture History, or Muscle Strength in Elderly Women. Journal of Bone and Mineral Research 14:9, 1576-1582
    CrossRef

  541. 541

    DANIEL F. GUNTHER, ALI S. CALIKOGLU, LOUIS E. UNDERWOOD. (1999) The Effects of the Estrogen Receptor Blocker, Faslodex (ICI 182,780), on Estrogen-Accelerated Bone Maturation in Mice. Pediatric Research 46:3, 269-273
    CrossRef

  542. 542

    Teake Kooistra, Jef J Emeis. (1999) Hormone replacement therapy. Current Opinion in Chemical Biology 3:4, 495-499
    CrossRef

  543. 543

    John P. Bilezikian, Etah S. Kurland, Clifford J. Rosen. (1999) Male Skeletal Health and Osteoporosis. Trends in Endocrinology & Metabolism 10:6, 244-250
    CrossRef

  544. 544

    Carreau, Genissel, Bilinska, Levallet. (1999) Sources of oestrogen in the testis and reproductive tract of the male. International Journal of Andrology 22:4, 211-223
    CrossRef

  545. 545

    E Seeman. (1999) The structural basis of bone fragility in men. Bone 25:1, 143-147
    CrossRef

  546. 546

    S. K. Lim, Y. J. Won, H. C. Lee, K. B. Huh, Y. S. Park. (1999) A PCR Analysis of ERα and ERβ mRNA Abundance in Rats and the Effect of Ovariectomy. Journal of Bone and Mineral Research 14:7, 1189-1196
    CrossRef

  547. 547

    Candace Good, Mark Tulchinsky, David Mauger, Laurence M Demers, Richard S Legro. (1999) Bone mineral density and body composition in lean women with polycystic ovary syndrome. Fertility and Sterility 72:1, 21-25
    CrossRef

  548. 548

    Charles Sklar. (1999) Reproductive physiology and treatment-related loss of sex hormone production. Medical and Pediatric Oncology 33:1, 2-8
    CrossRef

  549. 549

    Judith A. Hoyland, Charlotte Baris, Lindsay Wood, Pauline Baird, Peter L. Selby, Anthony J. Freemont, Isobel P. Braidman. (1999) Effect of ovarian steroid deficiency on oestrogen receptor ? expression in bone. The Journal of Pathology 188:3, 294-303
    CrossRef

  550. 550

    Matthew R. Smith. (1999) Androgen Deprivation and Osteoporosis. The Prostate Journal 1:4, 161-165
    CrossRef

  551. 551

    Emilie F. Rissman, Scott R. Wersinger, Heather N. Fugger, Thomas C. Foster. (1999) Sex with knockout models: behavioral studies of estrogen receptor α. Brain Research 835:1, 80-90
    CrossRef

  552. 552

    I. Galeraud-Denis, E. Marie, S. Carreau. (1999) Estrogènes et spermatozoïdes. Andrologie 9:2, 252-260
    CrossRef

  553. 553

    Olle Vidal, Lars-Gunnar Kindblom, Claes Ohlsson. (1999) Expression and Localization of Estrogen Receptor-β in Murine and Human Bone. Journal of Bone and Mineral Research 14:6, 923-929
    CrossRef

  554. 554

    Teresa Sunyer, Jennifer Lewis, Patricia Collin-Osdoby, Philip Osdoby. (1999) Estrogen’s bone-protective effects may involve differential IL-1 receptor regulation in human osteoclast-like cells. Journal of Clinical Investigation 103:10, 1409-1418
    CrossRef

  555. 555

    X. Z. Zhang, D. N. Kalu, B. Erbas, J. L. Hopper, E. Seeman. (1999) The Effects of Gonadectomy on Bone Size, Mass, and Volumetric Density in Growing Rats Are Gender-, Site-, and Growth Hormone-Specific. Journal of Bone and Mineral Research 14:5, 802-809
    CrossRef

  556. 556

    David A. Stevens, Graham R. Williams. (1999) Hormone regulation of chondrocyte differentiation and endochondral bone formation. Molecular and Cellular Endocrinology 151:1-2, 195-204
    CrossRef

  557. 557

    Susan C Nagel, Frederick S vom Saal, Wade V Welshons. (1999) Developmental effects of estrogenic chemicals are predicted by an in vitro assay incorporating modification of cell uptake by serum. The Journal of Steroid Biochemistry and Molecular Biology 69:1-6, 343-357
    CrossRef

  558. 558

    S.R Davis. (1999) The therapeutic use of androgens in women. The Journal of Steroid Biochemistry and Molecular Biology 69:1-6, 177-184
    CrossRef

  559. 559

    Evan Simpson, Margaret Jones, Susan Davis, Gary Rubin. (1999) Do intracrine mechanisms regulate aromatase expression?. The Journal of Steroid Biochemistry and Molecular Biology 69:1-6, 447-452
    CrossRef

  560. 560

    Francis. (1999) The effects of testosterone on osteoporosis in men. Clinical Endocrinology 50:4, 411-414
    CrossRef

  561. 561

    S Patel, M Pazianas, J Tobias, T.J Chambers, S Fox, J Chow. (1999) Early effects of hormone replacement therapy on bone. Bone 24:3, 245-248
    CrossRef

  562. 562

    Robert D. Blank. (1999) Linkage, Association, and the Genetic Analysis of Bone Mineral Density and Related Phenotypes. Journal of Clinical Densitometry 2:1, 59-70
    CrossRef

  563. 563

    Donna Shoupe. (1999) Androgens and bone: Clinical implications for menopausal women. American Journal of Obstetrics and Gynecology 180:3, S329-S333
    CrossRef

  564. 564

    Eleonore I.E. Mayer, Janos Homoki, Michael B. Ranke. (1999) Spontaneous growth and bone age development in a patient with 17α-hydroxylase deficiency: Evidence of the role of sexual steroids in prepubertal bone maturation. The Journal of Pediatrics 134:3, 371-375
    CrossRef

  565. 565

    A. Samuels, M. J. Perry, J. H. Tobias. (1999) High-Dose Estrogen Induces De Novo Medullary Bone Formation in Female Mice. Journal of Bone and Mineral Research 14:2, 178-186
    CrossRef

  566. 566

    J.H Tobias, J.E Compston. (1999) Does estrogen stimulate osteoblast function in postmenopausal women?. Bone 24:2, 121-124
    CrossRef

  567. 567

    J. Kennedy, C. Baris, J.A. Hoyland, P.L. Selby, A.J. Freemont, I.P. Braidman. (1999) Immunofluorescent localization of estrogen receptor-α in growth plates of rabbits, but not in rats, at sexual maturity. Bone 24:1, 9-16
    CrossRef

  568. 568

    E. M. Colin, G. J. C. M. Van Den Bemd, M. Van Aken, S. Christakos, H. R. De Jonge, H. F. Deluca, J. M. Prahl, J. C. Birkenhäger, C. J. Buurman, H. A. P. Pols, J. P. T. M. van Leeuwen. (1999) Evidence for Involvement of 17β-Estradiol in Intestinal Calcium Absorption Independent of 1,25-Dihydroxyvitamin D3 Level in the Rat. Journal of Bone and Mineral Research 14:1, 57-64
    CrossRef

  569. 569

    D.J. Rickard, M. Subramaniam, T.C. Spelsberg. (1999) Molecular and cellular mechanisms of estrogen action on the skeleton. Journal of Cellular Biochemistry 75:S32, 123-132
    CrossRef

  570. 570

    Andrew K. Shiau, Danielle Barstad, Paula M. Loria, Lin Cheng, Peter J. Kushner, David A. Agard, Geoffrey L. Greene. (1998) The Structural Basis of Estrogen Receptor/Coactivator Recognition and the Antagonism of This Interaction by Tamoxifen. Cell 95:7, 927-937
    CrossRef

  571. 571

    CHANDRA S. CHAURASIA, CHU-EN CHEN, JASON RUBIN, STEPHEN L. DEWEY. (1998) Neuropharmacology: Effects of Tamoxifen on Striatal Dopamine and 5-Hydroxytryptamine Release in Freely Moving Male Rats: An In-vivo Microdialysis Investigation. Journal of Pharmacy and Pharmacology 50:12, 1377-1385
    CrossRef

  572. 572

    Stefan Nilsson, George Kuiper, Jan-Åke Gustafsson. (1998) ERβ a Novel Estrogen Receptor Offers the Potential for New Drug Development. Trends in Endocrinology & Metabolism 9:10, 387-395
    CrossRef

  573. 573

    B. Ongphiphadhanakul, R. Rajatanavin, S. Chanprasertyothin, N. Piaseu, L. Chailurkit. (1998) Serum oestradiol and oestrogen-receptor gene polymorphism are associated with bone mineral density independently of serum testosterone in normal males. Clinical Endocrinology 49:6, 803-809
    CrossRef

  574. 574

    S. Reutrakul, B. Ongphiphadhanakul, N. Piaseu, S. Krittiyawong, S. Chanprasertyothin, P. Bunnag, R. Rajatanavin. (1998) The effects of oestrogen exposure on bone mass in male to female transsexuals. Clinical Endocrinology 49:6, 811-814
    CrossRef

  575. 575

    D Vanderschueren, S Boonen, R Bouillon. (1998) Action of androgens versus estrogens in male skeletal homeostasis. Bone 23:5, 391-394
    CrossRef

  576. 576

    Ripla Beri, Narender Kumar, T. Savage, L. Benalcazar, Kalyan Sundaram. (1998) Estrogenic and progestational activity of 7α-methyl-19-nortestosterone, a synthetic androgen. The Journal of Steroid Biochemistry and Molecular Biology 67:3, 275-283
    CrossRef

  577. 577

    Richard M Sharpe. (1998) The Roles of Oestrogen in the Male. Trends in Endocrinology & Metabolism 9:9, 371-377
    CrossRef

  578. 578

    A Verdonck. (1998) Comparative effects of neonatal and prepubertal castration on craniofacial growth in rats. Archives of Oral Biology 43:11, 861-871
    CrossRef

  579. 579

    Susan R. Davis, Henry G. Burger. (1998) The rationale for physiological testosterone replacement in women. Baillière's Clinical Endocrinology and Metabolism 12:3, 391-405
    CrossRef

  580. 580

    Julia A Taylor, Kendall J Lewis, Dennis B Lubahn. (1998) Estrogen receptor mutations. Molecular and Cellular Endocrinology 145:1-2, 61-66
    CrossRef

  581. 581

    James D. Shull, Diane F. Birt, Rodney D. McComb, Thomas J. Spady, Karen L. Pennington, Carla M. Shaw-Bruha. (1998) Estrogen induction of prolactin-producing pituitary tumors in the Fischer 344 rat: Modulation by dietary-energy but not protein consumption. Molecular Carcinogenesis 23:2, 96-105
    CrossRef

  582. 582

    Ronald S. Swerdloff, Christina Wang. (1998) Dihydrotestosterone: A rationale for its use as a non-aromatizable androgen replacement therapeutic agent. Baillière's Clinical Endocrinology and Metabolism 12:3, 501-506
    CrossRef

  583. 583

    John K. Amory, William J. Bremner. (1998) The use of testosterone as a male contraceptive. Baillière's Clinical Endocrinology and Metabolism 12:3, 471-484
    CrossRef

  584. 584

    George G.J.M. Kuiper, Paul J. Shughrue, Istvan Merchenthaler, Jan-Åke Gustafsson. (1998) The Estrogen Receptor β Subtype: A Novel Mediator of Estrogen Action in Neuroendocrine Systems. Frontiers in Neuroendocrinology 19:4, 253-286
    CrossRef

  585. 585

    Laurence Katznelson. (1998) Therapeutic role of androgens in the treatment of osteoporosis in men. Baillière's Clinical Endocrinology and Metabolism 12:3, 453-470
    CrossRef

  586. 586

    Lorenz C. Hofbauer, Kevin C. Hicok, Sundeep Khosla. (1998) Effects of gonadal and adrenal androgens in a novel androgen-responsive human osteoblastic cell line. Journal of Cellular Biochemistry 71:1, 96-108
    CrossRef

  587. 587

    Evan R. Simpson. (1998) Genetic mutations resulting in estrogen insufficiency in the male. Molecular and Cellular Endocrinology 145:1-2, 55-59
    CrossRef

  588. 588

    Bilezikian, John P., Morishima, Akira, Bell, Jennifer, Grumbach, Melvin M., . (1998) Increased Bone Mass as a Result of Estrogen Therapy in a Man with Aromatase Deficiency. New England Journal of Medicine 339:9, 599-603
    Full Text

  589. 589

    Gunapala Shetty, Hanumanthappa Krishnamurthy, Hegganahalli N Krishnamurthy, Ajay S Bhatnagar, Nuggehali R Moudgal. (1998) Effect of long-term treatment with aromatase inhibitor on testicular function of adult male bonnet monkeys (M. radiata). Steroids 63:7-8, 414-420
    CrossRef

  590. 590

    A Verdonck. (1998) Effect of testosterone replacement after neonatal castration on craniofacial growth in rats. Archives of Oral Biology 43:7, 551-557
    CrossRef

  591. 591

    Antoinette Maassen VanDenBrink, Monique N. Vergouwe, Roel A. Ophoff, Susan L. Naylor, Hans G. Dauwerse, Pramod R. Saxena, Michel D. Ferrari, Rune R. Frants. (1998) Chromosomal localization of the 5-HT1F receptor gene: No evidence for involvement in response to sumatriptan in migraine patients. American Journal of Medical Genetics 77:5, 415-420
    CrossRef

  592. 592

    K. S. Korach, J. Lindzey. (1998) Alterations des fonctions de reproduction chez les souris males deficientes en recepteur aux estrogenes. Andrologie 8:2, 199-203
    CrossRef

  593. 593

    Bernd Stein, May S Kung Sutherland. (1998) IL-6 as a drug discovery target. Drug Discovery Today 3:5, 202-213
    CrossRef

  594. 594

    John P. Bilezikian. (1998) Estrogens and Postmenopausal Osteoporosis: Was Albright Right After All?. Journal of Bone and Mineral Research 13:5, 774-776
    CrossRef

  595. 595

    B. Lawrence Riggs, Sundeep Khosla, L. Joseph Melton. (1998) A Unitary Model for Involutional Osteoporosis: Estrogen Deficiency Causes Both Type I and Type II Osteoporosis in Postmenopausal Women and Contributes to Bone Loss in Aging Men. Journal of Bone and Mineral Research 13:5, 763-773
    CrossRef

  596. 596

    Uitterlinden, André G., Burger, Huibert, Huang, Qiuju, Yue, Fang, McGuigan, Fiona E.A., Grant, Struan F.A., Hofman, Albert, van Leeuwen, Johannes P.T.M., Pols, Huibert A.P., Ralston, Stuart H., . (1998) Relation of Alleles of the Collagen Type Iα1 Gene to Bone Density and the Risk of Osteoporotic Fractures in Postmenopausal Women. New England Journal of Medicine 338:15, 1016-1021
    Full Text

  597. 597

    S. C. Dieudonné, T. Xu, J. Y. Chou, S. A. Kuznetsov, K. Satomura, M. Mankani, N. S. Fedarko, E. P. Smith, P. Gehron Robey, M. F. Young. (1998) Immortalization and Characterization of Bone Marrow Stromal Fibroblasts from a Patient with a Loss of Function Mutation in the Estrogen Receptor-α Gene. Journal of Bone and Mineral Research 13:4, 598-608
    CrossRef

  598. 598

    J.K. Richer, C.A. Lange, A.M. Wierman, K.M. Brooks, L. Tung, G.S. Takimoto, K.B. Horwitz. (1998) Progesterone receptor variants found in breast cells repress transcription by wild-type receptors. Breast Cancer Research and Treatment 48:3, 231-241
    CrossRef

  599. 599

    Makio Shozu, Evan R. Simpson. (1998) Aromatase expression of human osteoblast-like cells. Molecular and Cellular Endocrinology 139:1-2, 117-129
    CrossRef

  600. 600

    U. Sarma, M. Edwards, K. Motoyoshi, A.M. Flanagan. (1998) Inhibition of bone resorption by 17β-estradiol in human bone marrow cultures. Journal of Cellular Physiology 175:1, 99-108
    CrossRef

  601. 601

    Paul van Kesteren, Paul Lips, Louis J. G. Gooren, Henk Asscheman, Jos Megens. (1998) Long-term follow-up of bone mineral density and bone metabolism in transsexuals treated with cross-sex hormones. Clinical Endocrinology 48:3, 347-354
    CrossRef

  602. 602

    Thomas J Spady, Djuana M.E Harvell, Mary C Snyder, Karen L Pennington, Rodney D McComb, James D Shull. (1998) Estrogen-induced tumorigenesis in the Copenhagen rat: disparate susceptibilities to development of prolactin-producing pituitary tumors and mammary carcinomas. Cancer Letters 124:1, 95-103
    CrossRef

  603. 603

    Brian T Pentecost. (1998) Expression and estrogen regulation of the HEM45 mRNA in human tumor lines and in the rat uterus. The Journal of Steroid Biochemistry and Molecular Biology 64:1-2, 25-33
    CrossRef

  604. 604

    John A. Eisman. (1998) Vitamin D Polymorphisms and Calcium Homeostasis: A New Concept of Normal Gene Variants and Physiologic Variation. Nutrition Reviews 56, S22-S29
    CrossRef

  605. 605

    Marie L, Peter W. Ramwell. (1998) Cardiovascular effects of estrogen. Current Opinion in Nephrology and Hypertension 7:1, 83
    CrossRef

  606. 606

    Yoshihisa Umekita, Yoshiatsu Sagara, Hiroki Yoshida. (1998) Estrogen Receptor Mutations and Changes in Estrogen Receptor and Progesterone Receptor Protein Expression in Metastatic or Recurrent Breast Cancer. Cancer Science 89:1, 27-32
    CrossRef

  607. 607

    EVELIEN F. GEVERS, JAN-MAARTEN WIT, IAIN C. A. F. ROBINSON. (1998) Effects of Long-Term Gonadotropin-Releasing Hormone Analog Treatment on Growth, Growth Hormone (GH) Secretion, GH Receptors, and GH-Binding Protein in the Rat. Pediatric Research 43:1, 111-120
    CrossRef

  608. 608

    Fuleihan, Ghada El-Hajj, . (1997) Tissue-Specific Estrogens — The Promise for the Future. New England Journal of Medicine 337:23, 1686-1687
    Full Text

  609. 609

    Stephan Tenbaum, Aria Baniahmad. (1997) Nuclear receptors: Structure, function and involvement in disease. The International Journal of Biochemistry & Cell Biology 29:12, 1325-1341
    CrossRef

  610. 610

    Kaj Grandien, Anders Berkenstam, Jan-Åke Gustafsson. (1997) The estrogen receptor gene: Promoter organization and expression. The International Journal of Biochemistry & Cell Biology 29:12, 1343-1369
    CrossRef

  611. 611

    H. Mizunuma, T. Hosoi, H. Okano, M. Soda, T. Tokizawa, I. Kagami, S. Miyamoto, Y. Ibuki, S. Inoue, M. Shiraki, Y. Ouchi. (1997) Estrogen receptor gene polymorphism and bone mineral density at the lumbar spine of pre- and postmenopausal women. Bone 21:5, 379-383
    CrossRef

  612. 612

    Gail A. Greendale, Sharon Edelstein, Elizabeth Barrett-Connor. (1997) Endogenous Sex Steroids and Bone Mineral Density in Older Women and Men: The Rancho Bernardo Study. Journal of Bone and Mineral Research 12:11, 1833-1843
    CrossRef

  613. 613

    Ming Zhao Cheng, Gul Zaman, Simon C. F. Rawlinson, Andrew A. Pitsillides, Rosemary F. L. Suswillo, Lance E. Lanyon. (1997) Enhancement by Sex Hormones of the Osteoregulatory Effects of Mechanical Loading and Prostaglandins in Explants of Rat Ulnae. Journal of Bone and Mineral Research 12:9, 1424-1430
    CrossRef

  614. 614

    Nelly Mauras, Nancy E. Vieira, Alfred L. Yergey. (1997) Estrogen therapy enhances calcium absorption and retention and diminishes bone turnover in young girls with turner's syndrome: A calcium kinetic study. Metabolism 46:8, 908-913
    CrossRef

  615. 615

    Leigh C. Murphy, Helmut Dotzlaw, Etienne Leygue, Deborah Douglas, Amanda Coutts, Peter H. Watson. (1997) Estrogen receptor variants and mutations. The Journal of Steroid Biochemistry and Molecular Biology 62:5-6, 363-372
    CrossRef

  616. 616

    Carani, Cesare, Qin, Kenan, Simoni, Manuela, Faustini-Fustini, Marco, Serpente, Stefania, Boyd, Jeff, Korach, Kenneth S., Simpson, Evan R., . (1997) Effect of Testosterone and Estradiol in a Man with Aromatase Deficiency. New England Journal of Medicine 337:2, 91-95
    Full Text

  617. 617

    F.S. Czerwiec, J.J. Liaw, S.-B. Liu, C. Perez-Stable, R. Grumbles, G.A. Howard, B.A. Roos, K.L. Burnstein. (1997) Absence of androgen-mediated transcriptional effects in osteoblastic cells despite presence of androgen receptors. Bone 21:1, 49-56
    CrossRef

  618. 618

    Hirotaka Iwase, Shunzo Kobayashi. (1997) Alterations and polymorphisms of the estrogen receptor gene in breast cancer. Breast Cancer 4:2, 57-66
    CrossRef

  619. 619

    Tatsuo Suda, Ichiro Nakamura, Eijiro Jimi, Naoyuki Takahashi. (1997) Regulation of Osteoclast Function. Journal of Bone and Mineral Research 12:6, 869-879
    CrossRef

  620. 620

    Emilie F. Rissman, Scott R. Wersinger, Julia A. Taylor, Dennis B. Lubahn. (1997) Estrogen Receptor Function as Revealed by Knockout Studies: Neuroendocrine and Behavioral Aspects. Hormones and Behavior 31:3, 232-243
    CrossRef

  621. 621

    George G.J.M Kuiper, Jan-Åke Gustafsson. (1997) The novel estrogen receptor-β subtype: potential role in the cell- and promoter-specific actions of estrogens and anti-estrogens. FEBS Letters 410:1, 87-90
    CrossRef

  622. 622

    Kjell Carlström, Reinhard Stege, Peter Henriksson, Mirtha Grande, Per Olov Gunnarsson, Åke Pousette. (1997) Possible bone-preserving capacity of high-dose intramuscular depot estrogen as compared to orchidectomy in the treatment of patients with prostatic carcinoma. The Prostate 31:3, 193-197
    CrossRef

  623. 623

    Jonathan Lindzey, Kenneth S Korach. (1997) Developmental and Physiological Effects of Estrogen Receptor Gene Disruption in Mice. Trends in Endocrinology & Metabolism 8:4, 137-145
    CrossRef

  624. 624

    T. Shigematsu, A. Miyamoto, C. Mukai, H. Oshima, C. Sekiguchi, Y. Kawaguchi, T. Hosoya. (1997) Changes in bone and calcium metabolism with space flight. Osteoporosis International 7:S3, 63-67
    CrossRef

  625. 625

    P.D. Broulik, L. Stárka. (1997) Effect of antiandrogens casodex and epitestosterone on bone composition in mice. Bone 20:5, 473-475
    CrossRef

  626. 626

    DEBRA K. KATZMAN, ROBERT B. ZIPURSKY. (1997) Adolescents with Anorexia Nervosa: The Impact of the Disorder on Bones and Brains. Annals of the New York Academy of Sciences 817:1 Adolescent Nu, 127-137
    CrossRef

  627. 627

    Krishnankutty Sudhir, Tony M Chou, Louis M Messina, Stuart J Hutchison, Kenneth S Korach, Kanu Chatterjee, Gabor M Rubanyi. (1997) Endothelial dysfunction in a man with disruptive mutation in oestrogen-receptor gene. The Lancet 349:9059, 1146-1147
    CrossRef

  628. 628

    G.B. Cutler. (1997) The role of estrogen in bone growth and maturation during childhood and adolescence. The Journal of Steroid Biochemistry and Molecular Biology 61:3-6, 141-144
    CrossRef

  629. 629

    A. Conley, J. Corbin, T. Smith, M. Hinshelwood, Z. Liu, E. Simpson. (1997) Porcine aromatases: studies on tissue-specific, functionally distinct isozymes from a single gene?. The Journal of Steroid Biochemistry and Molecular Biology 61:3-6, 407-413
    CrossRef

  630. 630

    Franz Jakob, Heide Siggelkow, Dorothee Homann, Josef Köhrle, Jerzy Adamski, Norbert Schütze. (1997) Local estradiol metabolism in osteoblast- and osteoclast-like cells. The Journal of Steroid Biochemistry and Molecular Biology 61:3-6, 167-174
    CrossRef

  631. 631

    Christoph A. Meier. (1997) Minireview: Regulation of Gene Expression by Nuclear Hormone Receptors. Journal of Receptors and Signal Transduction 17:1-3, 319-335
    CrossRef

  632. 632

    Y. Ishida, J.N.M. Heersche. (1997) Progesterone stimulates proliferation and differentiation of osteoprogenitor cells in bone cell populations derived from adult female but not from adult male rats. Bone 20:1, 17-25
    CrossRef

  633. 633

    Fabio Celotti, Paola Negri-Cesi, Angelo Poletti. (1997) Steroid Metabolism in the Mammalian Brain: 5Alpha-Reduction and Aromatization. Brain Research Bulletin 44:4, 365-375
    CrossRef

  634. 634

    G. K. Wakley, G. L. Evans, R. T. Turner. (1997) Short-Term effects of high dose estrogen on tibiae of growing male rats. Calcified Tissue International 60:1, 37-42
    CrossRef

  635. 635

    Leigh C. Murphy, Etienne Leygue, Helmut Dotzlaw, Deborah Douglas, Amanda Coutts, Peter H. Watson. (1997) Oestrogen Receptor Variants and Mutations in Human Breast Cancer. Annals of Medicine 29:3, 221-234
    CrossRef

  636. 636

    A. Hafidi, M. H. Gharbi. (1996) Androgènes et sexualité masculine. Andrologie 6:S4, 387-397
    CrossRef

  637. 637

    Margaret A Shupnik. (1996) Gonadal hormone feedback on pituitary gonadotropin genes. Trends in Endocrinology & Metabolism 7:8, 272-276
    CrossRef

  638. 638

    EP Smith, KS Korach. (1996) Oestrogen receptor deficiency: consequences for growth. Acta Paediatrica 85:s417, 39-43
    CrossRef

  639. 639

    Pamela A. Clark, Alan D. Rogol. (1996) GROWTH HORMONES AND SEX STEROID INTERACTIONS AT PUBERTY. Endocrinology & Metabolism Clinics of North America 25:3, 665-681
    CrossRef

  640. 640

    D. Vanderschueren, E. Herck, R. Coster, R. Bouillon. (1996) Aromatization of androgens is important for skeletal maintenance of aged male rats. Calcified Tissue International 59:3, 179-183
    CrossRef

  641. 641

    K. Sato, K. Nohtomi, K. Shizume, H. Demura, H. Kanatani, M. Kiyoki, Y. Ohashi, S. Ejiri, H. Ozawa. (1996) 17 β-estradiol increases calcium content in fetal mouse parietal bones cultured in serum-free medium only at physiological concentrations. Bone 19:3, 213-221
    CrossRef

  642. 642

    P. Negri-Cesi, A. Poletti, F. Celotti. (1996) Metabolism of steroids in the brain: a new insight into the role of 5α-reductase and aromatase in brain differentiation and functions. The Journal of Steroid Biochemistry and Molecular Biology 58:5-6, 455-466
    CrossRef

  643. 643

    Dieter Engelkamp, Veronica van Heyningen. (1996) Transcription factors in disease. Current Opinion in Genetics & Development 6:3, 334-342
    CrossRef

  644. 644

    John A Eisman. (1996) Vitamin D receptor gene variants: implicatiosn for therapy. Current Opinion in Genetics & Development 6:3, 361-365
    CrossRef

  645. 645

    H. Kalervo Väänänen, Pirkko L. Härkönen. (1996) Estrogen and bone metabolism. Maturitas 23, S65-S69
    CrossRef

  646. 646

    C. Lea, N. Kendall, A. M. Flanagan. (1996) Casodex (a nonsteroidal antiandrogen) reduces cancellous, endosteal, and periosteal bone formation in estrogen-replete female rats. Calcified Tissue International 58:4, 268-272
    CrossRef

  647. 647

    Ming Zhao Cheng, Gul Zaman, Simon C. F. Rawlinson, Rosemary F. L. Suswillo, Professor Lance E. Lanyon. (1996) Mechanical loading and sex hormone interactions in organ cultures of rat ulna. Journal of Bone and Mineral Research 11:4, 502-511
    CrossRef

  648. 648

    Eric S. Orwoll. (1996) Androgens as anabolic agents for bone. Trends in Endocrinology & Metabolism 7:3, 77-84
    CrossRef

  649. 649

    Shinji Kobayashi, Satoshi Inoue, Takayuki Hosoi, Yasuyoshi Ouchi, Masataka Shiraki, Hajime Orimo. (1996) Association of bone mineral density with polymorphism of the estrogen receptor gene. Journal of Bone and Mineral Research 11:3, 306-311
    CrossRef

  650. 650

    Hideo Koike, Richard H. Karas, Wendy E. Baur, Thomas F. O'Donnell, Michael E. Mendelsohn. (1996) Differential-display polymerase chain reaction identifies nucleophosmin as an estrogen-regulated gene in human vascular smooth muscle cells. Journal of Vascular Surgery 23:3, 477-482
    CrossRef

  651. 651

    Klaus Graumann, James L. Wittliff, Wolfgang Raffelsberger, Lynne Miles, Alois Jungbauer, Tauseef R. Butt. (1996) Structural and functional analysis of N-terminal point mutants of the human estrogen receptor. The Journal of Steroid Biochemistry and Molecular Biology 57:5-6, 293-300
    CrossRef

  652. 652

    TOSHIAKI TANAKA. (1996) Growth hormone treatment in Noonan syndrome. Pediatrics International 38:1, 99-101
    CrossRef

  653. 653

    Jeff Boyd, Hiroyuki Takahashi, Steven E. Waggoner, Lovell A. Jones, Richard A. Hajek, J. Taylor Wharton, Fu-shing Liu, Takafumi Fujino, J. Carl Barrett, John A. McLachlan. (1996) Molecular genetic analysis of clear cell adenocarcinomas of the vagina and cervix associated and unassociated with diethylstilbestrol exposure in utero. Cancer 77:3, 507-513
    CrossRef

  654. 654

    C. Gennari, R. Nuti. (1996) Bone loss in men. Calcified Tissue International 58:1, 1-3
    CrossRef

  655. 655

    R. Marcus. (1996) Endogenous and nutritional factors affecting bone. Bone 18:1, S11-S13
    CrossRef

  656. 656

    L.C.J. Dorssers, T. Van Agthoven. (1996) Genetic Mechanisms of Estrogen-Independence in Breast Cancer. Pathology - Research and Practice 192:7, 743-751
    CrossRef

  657. 657

    S. Hoshino, S. Inoue, T. Hosoi, T. Saito, A. Ikegami, M. Kaneki, Y. Ouchi, H. Orimo. (1995) Demonstration of isoforms of the estrogen receptor in the bone tissues and in osteoblastic cells. Calcified Tissue International 57:6, 466-468
    CrossRef

  658. 658

    Steven G. Soule, Gerard Conway, Gordana M. Prelevic, Malcolm Prentice, Jean Ginsburg, Howard S. Jacobs. (1995) Osteopenia as a feature of the androgen insensitivity syndrome. Clinical Endocrinology 43:6, 671-675
    CrossRef

  659. 659

    Miguel Beato, Peter Herrlich, Günther Schütz. (1995) Steroid hormone receptors: Many Actors in search of a plot. Cell 83:6, 851-857
    CrossRef

  660. 660

    M Hermanussen. (1995) Growth promotion by oxandrolone in a girl with short stature and early pubertal development treated with growth hormone and gonadotropin-releasing hormone-analogue. A case study. Acta Paediatrica 84:10, 1207-1210
    CrossRef

  661. 661

    Toni P. Miles, Christine Himes. (1995) Biological and social determinants of body size across the life span. Population Research and Policy Review 14:3, 327-346
    CrossRef

  662. 662

    John A. Eisman. (1995) Vitamin D receptor gene alleles and osteoporosis: An affirmative view. Journal of Bone and Mineral Research 10:9, 1289-1293
    CrossRef

  663. 663

    J.D. Zajac, G.L. Warne. (1995) Disorders of sexual development. Baillière's Clinical Endocrinology and Metabolism 9:3, 555-579
    CrossRef

  664. 664

    GR Frank. (1995) The role of estrogen in pubertal skeletal physiology: epiphyseal maturation and mineralization of the skeleton. Acta Paediatrica 84:6, 627-630
    CrossRef

  665. 665

    D. Vanderschueren, R. Bouillon. (1995) Androgens and bone. Calcified Tissue International 56:5, 341-346
    CrossRef

  666. 666

    Christoph Wiltschke, Suzanne A.W. Fuqua. (1995) Clinical relevance of estrogen receptor variants in breast cancer. Trends in Endocrinology & Metabolism 6:3, 77-82
    CrossRef

  667. 667

    Carl D. Malchoff, Diana M. Malchoff. (1995) Glucocorticoid resistance in humans. Trends in Endocrinology & Metabolism 6:3, 89-95
    CrossRef

  668. 668

    Wendell W. Weber. (1995) Influence of heredity on human sensitivity to environmental chemicals. Environmental and Molecular Mutagenesis 25:S2, 102-114
    CrossRef

  669. 669

    Federman, Daniel D., . (1994) Life without Estrogen. New England Journal of Medicine 331:16, 1088-1089
    Full Text