Original Article
A Novel Mutation in the Cystic Fibrosis Gene in Patients with Pulmonary Disease but Normal Sweat Chloride Concentrations
N Engl J Med 1994; 331:974-980October 13, 1994
- Abstract
Background
Many patients with chronic pulmonary disease similar to that seen in cystic fibrosis have normal (or nondiagnostic) sweat chloride values. It has been difficult to make the diagnosis of cystic fibrosis in these patients because no associated mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene has been identified.
Methods
We evaluated 23 patients with pulmonary disease characteristic of cystic fibrosis but with sweat chloride concentrations in the normal range. Mutations in the CFTR gene were sought by direct sequencing of polymerase chain reaction-amplified nasal epithelial messenger RNA and by testing the functioning of affected epithelium.
Results
A cytidine phosphate guanosine dinucleotide C-to-T point mutation in intron 19 of the CFTR gene, termed 3849+10 kb C to T, was identified in 13 patients from eight unrelated families. This mutation was found in patients from three different ethnic groups with three different extended haplotypes. The mutation leads to the creation of a partially active splice site in intron 19 and to the insertion into most CFTR transcripts of a new 84-base-pair “exon,” containing an in-frame stop codon, between exons 19 and 20. Normally spliced transcripts were also detected at a level approximately 8 percent of that found in normal subjects. This mutation is associated with abnormal nasal epithelial and sweat acinar epithelial function.
Conclusions
We have identified a point mutation in intron 19 of CFTR and abnormal epithelial function in patients who have cystic fibrosis-like lung disease but normal sweat chloride values. The identification of this mutation indicates that this syndrome is a form of cystic fibrosis. Screening for the mutation should prove diagnostically useful in this population of patients.
Media in This Article
Figure 1
Identification and Characterization of the Mutation in Intron 19.Figure 2
Sequence of the PCR Product from Intron 19 in the Index Patient, Her Father, and a Normal Control.Article Activity
- Article
Cystic fibrosis is an autosomal recessive genetic disorder that reflects mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene,1-3 which codes for a cyclic AMP (cAMP)-regulated chloride channel4,5. The disorder has a broad range of severity but has traditionally been manifested by chronic pulmonary disease, pancreatic exocrine insufficiency, elevated concentrations of chloride in sweat, and identified mutations, most commonly ΔF508 3,6.
There is a group of patients, however, who have chronic lung disease similar to that seen in cystic fibrosis but who have normal sweat chloride values6. These patients have no common mutation in the CFTR gene detectable by conventional genetic analysis of genomic DNA and thus present a diagnostic problem. To evaluate the diagnosis of cystic fibrosis in such patients, we characterized the physiologic functioning of epithelium in affected organs and sought mutations in the CFTR gene by direct sequencing of messenger RNA (mRNA) transcripts obtained from nasal epithelium and amplified by the polymerase chain reaction (PCR).
Methods
Patients
We evaluated 23 patients in 13 families who had disease resembling cystic fibrosis (obstructive airways disease and characteristic microbiologic contents of sputum, i.e., Staphylococcus aureus, Pseudomonas aeruginosa, or both) but who had sweat chloride values7 in the nondiagnostic or normal range8 (<60 mmol per liter in patients older than 15 years and <40 mmol per liter in patients 15 years old or younger, calculated as the median of at least three determinations). Pancreatic exocrine function was assessed by the measurement of stool fat during a 72-hour period (normal, <7 g per day per 100 g of fat ingested) or by clinical features and the measurement of serum vitamin E (normal, 5 to 20 mg per milliliter of solution), serum trypsinogen (normal, 10 to 57 ng per milliliter of solution), or both. Each patient was screened for 29 different mutations of CFTR9. The study protocol was approved by the institutional review board of the University of North Carolina, and informed consent was obtained.
Identification and Characterization of the Mutation in Intron 19
Total RNA was prepared by the method of Chirgwin et al.10 or the Ultraspect system (Biotecx, Houston) from nasal epithelial cells (5 × 105) obtained by scraping the inferior turbinates with a Rhinoprobe11. For the sequence analysis, reverse transcription was performed with CFTR-specific primers and avian moloney virus reverse transcriptase (Red Module, Invitrogen, San Diego, Calif.). The complementary DNA (cDNA) was amplified (for 35 cycles) to yield segments of cDNA of approximately 1 kilobase (kb). Each first-round PCR product was reamplified (for 35 cycles) with nested primers, resulting in overlapping products of 400 to 600 base pairs (bp). The second-round products were purified on low-melting-temperature agarose gels; single-stranded DNA was prepared by asymmetric PCR12 and purified by two rounds of spin dialysis (Centricon 100, Amicon, Beverly, Mass.). Dideoxy sequencing was done with Sequenase (United States Biochemical, Cleveland).
The region of CFTR cDNA spanning exon 18 to exon 20 was amplified with a primer complementary to bases 3552 to 3596 (exon 18) and a primer complementary to the junction of exons 20 and 21 (bases 3991 to 4009). After electrophoresis in composite gels consisting of 3 percent NuSieve agarose and 1 percent Seakem agarose (FMC Bioproducts, Rockland, Me.), the amplified fragment was detected by Southern hybridization with 32P-labeled oligonucleotide complementary to bases 3600 through 3619. EcoRI digests of phage clones (TE24II and TE28), which together span intron 19, were analyzed by the Southern blot assay with an insert-bearing PCR product (542 bp). The primers (forward primer, 5'TTGACTTGTCATCTTGATTTC3'; reverse primer, 5'CATTTTAATACTGCAACAGAT3') derived from the insert sequence (as described in the next section) were used to amplify DNA from a plasmid subclone (pTE24II-6) to provide sequences in regions flanking the 84-bp insert. In sequencing key regions of intron 19, primers were used to amplify a 437-bp PCR product from genomic DNA (forward primer 4712, 5'AGGCTTCTCAGTGATCTGTTG3'; reverse primer 4713, 5'GAATCATTCAGTGGGTATAAGCAG3').
Quantitation of CFTR mRNA
Total RNA was prepared from nasal epithelium with the Ultraspect system (Biotecx). Two micrograms of total RNA was used to synthesize cDNA (in 20-microliter reactions) with reverse transcriptase (Super Script, Life Technologies, Gaithersburg, Md.). After 20-fold dilution in water, 10-microliter aliquots of cDNA were included in the 50-microliter PCR reactions. The normal CFTR sequence was amplified with primer 051193-1 and a primer complementary to the junction of exons 19 and 20 (bases 3843 to 3867). Amplification of γ-actin sequences was performed in parallel with primers HAG3 and HAG413. CFTR and γ-actin sequences were amplified by 25 cycles of PCR (94 °C for 30 seconds, 65 °C for 30 seconds, and 72 °C for 1 minute) with the rapid-initiation technique (HotStart AmpliWax paraffin beads, Perkin-Elmer, Norwalk, Conn.). Plasmids carrying the CFTR sequence (pCFTR474) or the γ-actin sequence (pHF1)14 were amplified in parallel; the initial copy number of each plasmid was increased serially (10-fold, from 10 to 105). Amplification products were analyzed by Southern blot hybridization with 32P-labeled oligonucleotides complementary to CFTR (bases 3600 to 3619) or γ-actin15 (bases 1072 to 1096). The DNA fragments were quantitated by phosphor-screen autoradiography (PhosphorImager, Molecular Dynamics, Sunnyvale, Calif.).
Haplotype Determination
Extended haplotypes were constructed from an analysis of PCR-amplified DNA for the diallelic markers XV.2c and KM-1916 and the marker loci J44, GATT, M470, and TUB1817.
Sweat-Gland and Nasal Epithelial Function
Sweat ductal function was assessed by measurement of sweat chloride7 and by measurement of the potential difference (PD), or voltage, across the epithelium of the sweat duct18,19. Sweat acinar epithelial chloride secretion mediated by cAMP was assessed by measuring sweat formation after an intradermal injection of isoproterenol, aminophylline, and atropine20-22. We tested the nasal PD and the response to sequential superfusion with amiloride (10-4 M), chloride-free amiloride (in which the chloride is replaced by gluconate), and a combination of isoproterenol (10-5 M) and chloride-free amiloride23-25. The chloride-diffusion PD (an index of basal chloride permeability) indicates the change with chloride-free superfusion; values reported here are corrected (by adding -9 mV) for the change in voltage caused by the replacement of chloride by gluconate. The change in PD with isoproterenol correlates with the cAMP-activated permeability of chloride; a negative value indicates chloride secretion.
Results
Clinical Phenotype of Patients
The patients referred for study had obstructive lung disease, chest radiographs consistent with cystic fibrosis, and characteristic microbiologic features of sputum -- that is, mucoid P. aeruginosa, S. aureus, or both. Thirteen patients from eight families (Table 1Table 1
Clinical Features and Genotype of Patients with Pulmonary Disease and Normal Sweat Chloride Levels.) had at least one copy of the mutation in intron 19, as described below. Except for Patient 8A, these patients tended to have lung disease similar to or milder than that expected for their age as compared with a large population of patients with cystic fibrosis who were homozygous for ΔF508 27. Six of these study patients had never been hospitalized for their lung disease. Their sweat chloride values were nondiagnostic of cystic fibrosis, and the median value on multiple sweat tests was within the normal range. Most of the patients (10 of 13) had preservation of pancreatic exocrine function. One adult man (Patient 6A) who underwent fertility testing had an undeveloped vas deferens and obstructive azoospermia.Sweat-Gland and Nasal Epithelial Function
Eight patients underwent physiologic assessment of epithelial function. Sweat ductal PD measurements for all eight were normal (Table 2Table 2
Physiologic Studies of Sweat-Gland and Nasal Epithelial Function in Eight Patients with Pulmonary Disease and the Mutation in Intron 19 of CFTR.), in a manner consistent with effective sweat chloride absorption and normal sweat chloride concentrations. In contrast, the assessment of sweat acinar epithelial chloride secretory function revealed that none of these patients secreted chloride in response to the β-agonist isoproterenol, a pattern typical of classic cystic fibrosis. The patients' nasal bioelectric properties were also abnormal, similar to those seen in patients homozygous for ΔF508 (Table 2): the base-line PD and amiloride-sensitive PD were greater than normal, and the chloride diffusion PD (an index of chloride permeability) and the cAMP-mediated chloride secretory response to isoproterenol were smaller than normal.Genetic Analysis of Patients
The initial studies were of a 20-year-old woman (Patient 1 in Table 1). She was homozygous for the B haplotype16 and was the product of consanguineous mating (her paternal grandparents were first cousins, as were her parents). No mutation was identified when the coding region of her CFTR gene was sequenced. However, PCR amplification of cDNA spanning from exon 18 to exon 20 revealed two products that hybridized to an oligonucleotide complementary to exon 19 (Figure 1AFigure 1
Identification and Characterization of the Mutation in Intron 19.). The smaller product (474 bp), found in both normal subjects and the sample from the homozygous patient, corresponded to the normal CFTR sequence. The larger species (558 bp), found only in the sample from the patient, contained an 84-bp insert between exons 19 and 20 that included an in-frame TAA stop codon (Figure 1B). Hybridization of the relevant PCR product to EcoRI digests of phage clones TE24II and TE28 revealed, in addition to the expected bands overlapping exons 19 and 20, a 6.0-kb fragment common to both clones (Figure 1C). This fragment begins approximately 10 kb downstream of exon 19. Sequence analysis of DNA flanking the 84-bp insert from the 6.0-kb fragment revealed cryptic splice lariat and acceptor sequences 5' to the insert and a consensus splice-donor site 3' to the insert, except for the C residue at position 2 (Figure 1D).The sequence of genomic DNA (Figure 2Figure 2
Sequence of the PCR Product from Intron 19 in the Index Patient, Her Father, and a Normal Control.) revealed that the inbred patient had a T residue two bases downstream of the 84-bp insert, whereas a C residue was present in the normal subject. The father was heterozygous for the C-to-T mutation at this position. This substitution creates a sequence with strong homology to a splice-donor site (Figure 1D).The C-to-T mutation in intron 19 is termed a 3849+10 kb C-to-T mutation (3849 is the number of the last base in exon 19, and 10 kb indicates that the mutation is approximately 10 kb downstream from 3849). The mutation creates a new HphI restriction site, and we used HphI restriction digestion to screen the other patients with cystic fibrosis who had normal sweat chloride values. Thirteen patients had at least one copy of the mutation in intron 19 (Table 1): two were homozygous for the mutation, nine were compound heterozygotes with ΔF508, and two siblings were compound heterozygotes with W1282X. The mutation in intron 19 was associated with three different ethnic origins (Pakistani, Ashkenazi Jewish, and northern European white) and at least three different extended haplotypes (data not shown).
Correlation of Mutation with Disease
One patient who was homozygous for the mutation in intron 19 (Patient 2 in Table 1) was homozygous for the C haplotype; although consanguinity could not be documented, both parents traced their ancestry to the same Jewish community in Eastern Europe. The pedigree of this patient's family shows the correlation of the disease with the mutation in intron 19 (Figure 3Figure 3
Detection of the 3849+10 kb C-to-T Mutation by PCR and HphI Digestion.); neither of two clinically unaffected sisters was homozygous for the mutation. Sixteen siblings or parents of affected persons were genotyped, and the mutation in intron 19 was associated with known cystic fibrosis mutations only in persons who had clinical disease compatible with cystic fibrosis. We screened 137 cystic fibrosis chromosomes with unidentified mutations from patients with cystic fibrosis who had clearly elevated sweat chloride values and 60 non-cystic fibrosis chromosomes derived from obligate carriers. No mutations in intron 19 were found.Expression of Normally Spliced CFTR mRNA
Normally spliced CFTR mRNA was detected in the nasal epithelial sample from one patient homozygous for the mutation in intron 19 (Figure 4AFigure 4
Quantitation of Normally Spliced CFTR mRNA Expressed in Nasal Epithelial Cells from a Patient with the Intron 19 Mutation., lanes 1 through 5) relative to the normal sample (Figure 4A, lanes 6 through 10). The amount of normal CFTR mRNA in the sample from the patient was only 8 percent of that in the normal sample (Figure 4B). Similar results were obtained by an alternative method using quantitative competitive PCR with other samples from this patient. The amount of normal CFTR mRNA was only 5 to 10 percent of that in nasal epithelial samples from three normal subjects.Discussion
Patients with clinical disease compatible with cystic fibrosis who do not have diagnostic sweat chloride values are commonly evaluated at cystic fibrosis centers6,26,28,29. It has been difficult to establish firmly the diagnosis of cystic fibrosis in these patients, because testing for specific biologic markers for cystic fibrosis18,23,24 is not widely available and only one mutation in CFTR (G551S), found infrequently in such patients, has been associated with this syndrome22.
We identified a change in a single base pair in intron 19, termed a 3849+10 kb C-to-T mutation, in 13 patients who had this syndrome of cystic fibrosis-like lung disease and normal sweat chloride values. The C-to-T mutation in intron 19 leads to novel alternative splicing through the partial activation of a cryptic splice site and the insertion into most CFTR transcripts of a new 84-bp “exon,” complete with an in-frame stop codon between exons 19 and 20 (Figure 1B). The C residue at position 2 of the cryptic (nonfunctional) splice-donor site in normal genomic DNA (Figure 1D) is part of a cytidine phosphate guanosine dinucleotide, which is the site of frequent point mutations30. No other sequence variant was found in the coding region of a patient who was homozygous for the mutation in intron 19. This mutation was not found in 60 normal chromosomes or in 137 cystic fibrosis chromosomes associated with elevated sweat chloride values. These findings, along with the correlation of this change of a base pair with the disease, demonstrates that these 13 patients have a form of cystic fibrosis.
The molecular nature of the mutation in intron 19 is compatible with the exon-shuffling theory,31 which proposes that point mutations that create or destroy splice sites can cause the insertion or deletion of clusters of amino acids (“exons”), thereby increasing the rate at which proteins can evolve. A similar intronic mutation has been described in the small second intervening sequence of the beta-globin gene32. Such splice mutations are not easily detected with genomic DNA, and an approach using mRNA offers a better opportunity to identify them. Once they are identified, the presence of new unique restriction sites permits rapid diagnosis based on DNA analysis.
The 3849+10 kb C-to-T mutation is found in patients with sufficient sweat-duct epithelial chloride absorption to produce normal sweat. Patients with the mutation in intron 19 also appear to have milder pulmonary disease than do patients homozygous for ΔF508, although the varying severity of pulmonary disease among patients with the same genotype27 precludes a definitive analysis in our small and prospectively selected population. In this small group there was no obvious difference in clinical phenotype between patients homozygous for the mutation in intron 19 and those heterozygous for the mutation.
A clue to the molecular basis of the variant phenotype was provided by the analysis of mRNA transcripts expressed in these patients. No full-length CFTR protein is expected to be translated from the mRNA containing the 84-bp insert with the in-frame stop codon, but mRNA without the insert (occurring at approximately 8 percent of the normal level in respiratory epithelium) would be associated with the synthesis of normal CFTR protein. Whereas these patients have lung disease, Chu et al. have reported that some people with in-frame splice skipping of exon 9 have no lung disease and only 8 to 12 percent of normal CFTR transcripts (i.e., those containing exon 9) in bronchial epithelium33. The apparent difference between these two studies is probably due to technical and molecular considerations.
Modulation of the clinical phenotype associated with the reduced production of a normal protein has been reported. Mutations in the regulatory elements of the beta-globin gene leading to reduced amounts of normal beta chain (i.e., beta-thalassemia) are associated with milder disease than are mutations leading to nonfunctional or absent beta chains34. With respect to these patients with cystic fibrosis-like lung disease and normal sweat chloride values, the differences in disease expression at the organ level, such as abnormal airway epithelial function as compared with normal sweat ductal function, may reflect quantitative differences in the requirement for functional CFTR protein, differences in tissue-specific RNA splicing, or both.
The identification of a mutation in the CFTR gene in patients with normal sweat chloride concentrations has several implications for diagnosis and treatment. First, consideration of the diagnosis of cystic fibrosis must extend to patients with suppurative pulmonary disease and normal sweat chloride values. The mutation in intron 19 may be relatively common, because it was seen in three ethnic groups and on three different extended haplotypes. Furthermore, this mutation has been noted on 104 chromosomes reported to the Cystic Fibrosis Gene Analysis Consortium since our initial report,35 and it accounts for about 4 percent of the mutations in Ashkenazi patients with cystic fibrosis in Israel36. Whereas this mutation is common in patients with cystic fibrosis and normal sweat chloride values, it has also been reported in patients with borderline or raised sweat chloride concentrations37,38.
Second, patients with the mutation in intron 19 have low levels of normal CFTR mRNA. Future ability to quantitate the expression of CFTR protein in patients with cystic fibrosis and this mutation will provide information about the levels of CFTR expression needed to achieve a normal phenotype in a variety of affected epithelial sites. This information may provide a better understanding of CFTR function and serve as a guide for protein or gene therapy.
Finally, increased understanding of CFTR gene regulation, mRNA splicing, and protein expression may give patients with the mutation in intron 19 therapeutic alternatives: the up-regulation of CFTR gene expression, the inhibition of alternative splicing, and the stabilization of CFTR protein would presumably all improve the defense mechanisms of the lung.
Note added in proof: Since submitting this manuscript, we have identified 6 of approximately 45 men known to have this mutation who do not have obstructive azoospermia according to semen analysis or who have fathered children, or both, including one of our patients (Patient 7A in Table 1)37 (and Bowman M, Cutting G, Dreyfus D, McCoy K, Gelfand E, Bethel R: personal communication). This is higher than the expected prevalence of fertility (<1 percent) in men with other mutations in CFTR.
Supported by grants (HL34322 and RR000046) from the National Institutes of Health, grants (R06 and Z440) from the Cystic Fibrosis Foundation, and a grant (R6041L) from the American Lung Association of North Carolina
We are indebted to Drs. John Bloom, Rebecca Buckley, Gerald Fernald, Frank Kellogg, Peter Manos, Nathan Seriss, and Gerald Strope for providing information about patients; to Lynn Bonitz, R.N., B.S., for assistance in acquiring blood samples from patients; to Dr. Lloyd Edwards for statistical advice; to Drs. Michael Swift and William Marzluff for thoughtful discussions; to Drs. Lap-Chee Tsui and Joanna Rommens for providing phage clones TE28 and TE24II and plasmid pTE24II6, and for valuable discussions; to Nancy Callanan, M.S., for assistance in developing the family pedigrees; to Nina Church, M.Sc., Joe Robinson, M.Sc., and Beverly M. Wood, M.T. (A.S.C.P.), for technical assistance; and to Lisa Brown for editorial assistance.
Source Information
From the Applied Technology Genetics Corp., Malvern, Pa. (W.E.H.); the Department of Medicine (L.H.B., Z.Z., J.C.O., R.C.B., M.R.K.) and the Division of Molecular Pathology (Z.Z., K.J.F., L.M.S.), University of North Carolina, Chapel Hill; Children's Hospital Medical Center, Cincinnati (T.E.B.); the Department of Pediatrics, Duke University, Durham, N.C. (A.S.); Schneider Children's Hospital-Long Island Jewish Medical Center, New Hyde Park, N.Y. (J.D.G.); and the Pediatric Pulmonary Division, Columbia-Presbyterian Medical Center, New York (L.Q.).
Address reprint requests to Dr. Knowles at the Division of Pulmonary Diseases, 724 Burnett-Womack Bldg., CB 7020, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599-7020.
- References
References
1
Riordan JR ,Rommens JM ,Kerem B , et al. Identification of the cystic fibrosis gene: cloning and characterization of complementary DNA. Science 1989;245:1066-1073[Erratum, Science 1989;245:1437.]
CrossRef | Web of Science | Medline2
Kerem B ,Rommens JM ,Buchanan JA , et al. Identification of the cystic fibrosis gene: genetic analysis. Science 1989;245:1073-1080
CrossRef | Web of Science | Medline3
Collins FS . Cystic fibrosis: molecular biology and therapeutic implications. Science 1992;256:774-779
CrossRef | Web of Science | Medline4
Anderson MP ,Gregory RJ ,Thompson S , et al. Demonstration that CFTR is a chloride channel by alteration of its anion selectivity. Science 1991;253:202-205
CrossRef | Web of Science | Medline5
Bear CE ,Li C ,Kartner N , et al. Purification and functional reconstitution of the cystic fibrosis transmembrane conductance regulator (CFTR). Cell 1992;68:809-818
CrossRef | Web of Science | Medline6
Boat TF, Welsh MJ, Beaudet AL. Cystic fibrosis. In: Scriver CR, Beaudet AL, Sly WS, Valle D, eds. The metabolic basis of inherited disease. Vol. 2. 6th ed. New York: McGraw-Hill, 1989:2649-80.
7
Gibson LE ,Cooke RE . A test for concentration of electrolytes in sweat in cystic fibrosis of the pancreas utilizing pilocarpine by iontophoresis. Pediatrics 1959;23:545-549
Web of Science | Medline8
Davis PB ,Del Rio S ,Muntz JA ,Dieckman L . Sweat chloride concentration in adults with pulmonary diseases. Am Rev Respir Dis 1983;128:34-37
Web of Science | Medline9
Friedman KJ ,Highsmith WE Jr ,Silverman LM . Detecting multiple cystic fibrosis mutations by polymerase chain reaction-mediated site-directed mutagenesis. Clin Chem 1991;37:753-755
Web of Science | Medline10
Chirgwin JM ,Przybyla AE ,MacDonald RJ ,Rutter WJ . Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 1979;18:5294-5299
CrossRef | Web of Science | Medline11
Knowles MR ,Carson JL ,Collier AM ,Gatzy JT ,Boucher RC . Measurements of nasal transepithelial electric potential differences in normal human subjects in vivo. Am Rev Respir Dis 1981;124:484-490
Web of Science | Medline12
Gyllensten UB ,Erlich HA . Generation of single-stranded DNA by the polymerase chain reaction and its application to direct sequencing of the HLA-DQA locus. Proc Natl Acad Sci U S A 1988;85:7652-7656
CrossRef | Web of Science | Medline13
Trapnell BC ,Chu C-S ,Paakko PK , et al. Expression of the cystic fibrosis transmembrane conductance regulator gene in the respiratory tract of normal individuals and individuals with cystic fibrosis. Proc Natl Acad Sci U S A 1991;88:6565-6569
CrossRef | Web of Science | Medline14
Gunning P ,Ponte P ,Okayama H ,Engel J ,Blau H ,Kedes L . Isolation and characterization of full-length cDNA clones for human alpha-, beta-, and gamma-actin mRNAs: skeletal but not cytoplasmic actins have an amino-terminal cysteine that is subsequently removed. Mol Cell Biol 1983;3:787-795
Web of Science | Medline15
Erba HP ,Gunning P ,Kedes L . Nucleotide sequence of the human gamma cytoskeletal actin mRNA: anomalous evolution of vertebrate non-muscle actin genes. Nucleic Acids Res 1986;14:5275-5294
CrossRef | Web of Science | Medline16
Beaudet AL ,Spence JE ,Montes M , et al. Experience with new DNA markers for the diagnosis of cystic fibrosis. N Engl J Med 1988;318:50-51
Full Text | Web of Science | Medline17
Dork T ,Neumann T ,Wulbrand U , et al. Intra- and extragenic marker haplotypes of CFTR mutations in cystic fibrosis families. Hum Genet 1992;88:417-425
CrossRef | Web of Science | Medline18
Quinton PM ,Bijman J . Higher bioelectric potentials due to decreased chloride absorption in the sweat glands of patients with cystic fibrosis. N Engl J Med 1983;308:1185-1189
Full Text | Web of Science | Medline19
Bijman J ,Quinton PM . Influence of abnormal Cl- impermeability on sweating in cystic fibrosis. Am J Physiol 1984;247:C3-C9
Web of Science | Medline20
Sato K ,Sato F . Defective beta adrenergic response of cystic fibrosis sweat glands in vivo and in vitro. J Clin Invest 1984;73:1763-1771
CrossRef | Web of Science | Medline21
Sato K ,Sato F . Variable reduction in beta-adrenergic sweat secretion in cystic fibrosis heterozygotes. J Lab Clin Med 1988;111:511-518
Medline22
Strong TV ,Smit LS ,Turpin SV , et al. Cystic fibrosis gene mutation in two sisters with mild disease and normal sweat electrolyte levels. N Engl J Med 1991;325:1630-1634
Full Text | Web of Science | Medline23
Knowles M ,Gatzy J ,Boucher R . Increased bioelectric potential difference across respiratory epithelia in cystic fibrosis. N Engl J Med 1981;305:1489-1495
Full Text | Web of Science | Medline24
Knowles M ,Gatzy J ,Boucher R . Relative ion permeability of normal and cystic fibrosis nasal epithelium. J Clin Invest 1983;71:1410-1417
CrossRef | Web of Science | Medline25
Knowles M ,Gatzy J ,Boucher R . Modulation of nasal epithelial ion permeability in normal and cystic fibrosis subjects in vivo. Clin Res 1983;31:858A-858A abstract.26
Davis PB ,Hubbard VS ,Di Sant'Agnese PA . Low sweat electrolytes in a patient with cystic fibrosis. Am J Med 1980;69:643-646
CrossRef | Web of Science | Medline27
Kerem E ,Corey M ,Kerem B-S , et al. The relation between genotype and phenotype in cystic fibrosis -- analysis of the most common mutation (ΔF508). N Engl J Med 1990;323:1517-1522
Full Text | Web of Science | Medline28
Shwachman H. The heterogeneity of cystic fibrosis. In: Bergsma D, ed. The Fourth Conference on the Clinical Delineation of Birth Defects: Part XIII: G.I. tract including liver and pancreas. Birth defects: original article series. Baltimore: Williams & Wilkins, 1972:102-7.
29
Stern RC ,Boat TF ,Abramowsky CR ,Matthews LW ,Wood RE ,Doershuk CF . Intermediate-range sweat chloride concentration and Pseudomonas bronchitis: a cystic fibrosis variant with preservation of exocrine pancreatic function. JAMA 1978;239:2676-2680
CrossRef | Web of Science | Medline30
Cooper DN ,Krawczak M . The mutational spectrum of single base-pair substitutions causing human genetic disease: patterns and predictions. Hum Genet 1990;85:55-74
CrossRef | Web of Science | Medline31
Gilbert W . Why genes in pieces? Nature 1978;271:501-501
CrossRef | Web of Science | Medline32
Cheng T-C ,Orkin SH ,Antonarakis SE , et al. β-Thalassemia in Chinese: use of in vivo RNA analysis and oligonucleotide hybridization in systematic characterization of molecular defects. Proc Natl Acad Sci U S A 1984;81:2821-2825
CrossRef | Web of Science | Medline33
Chu C-S ,Trapnell BC ,Curristin SM ,Cutting GR ,Crystal RG . Extensive posttranscriptional deletion of the coding sequences for part of nucleotide-binding fold 1 in respiratory epithelial mRNA transcripts of the cystic fibrosis transmembrane conductance regulator gene is not associated with the clinical manifestations of cystic fibrosis. J Clin Invest 1992;90:785-790
CrossRef | Web of Science | Medline34
Weatherall DJ, Clegg JB, Higgs DR, Wood WG. The hemoglobinopathies. In: Scriver CR, Beaudet AL, Sly WS, Valle D, eds. The metabolic basis of inherited disease. Vol. 2. 6th ed. New York: McGraw-Hill, 1989:2281-339.
35
The Cystic Fibrosis Genetic Analysis Consortium
CrossRef | Web of Science | Medline36
Abeliovich D ,Lavon IP ,Lerer I , et al. Screening for five mutations detects 97% of cystic fibrosis (CF) chromosomes and predicts a carrier frequency of 1:29 in the Jewish Ashkenazi population. Am J Hum Genet 1992;51:951-956
Web of Science | Medline37
Gilbert F, Giampietro P, Li Z, Rosales N, NY CF Research Network 38
Augarten A ,Kerem B-S ,Yahav Y , et al. Mild cystic fibrosis and normal or borderline sweat test in patients with the 3849 + 10 kb C-to-T mutation. Lancet 1993;342:25-26
CrossRef | Web of Science | Medline
- Citing Articles (127)
Citing Articles
1
S.K. Cordovado, M. Hendrix, C.N. Greene, S. Mochal, M.C. Earley, P.M. Farrell, M. Kharrazi, W.H. Hannon, P.W. Mueller. (2011) CFTR mutation analysis and haplotype associations in CF patients. Molecular Genetics and Metabolism
CrossRef2
Miles Weinberger. (2011) When Asthma is not Asthma. Clinical Pulmonary Medicine 18:5, 207-214
CrossRef3
Marie C. Earley, Anita Laxova, Philip M. Farrell, Rena Driscoll-Dunn, Suzanne Cordovado, Peter J. Mogayzel, Michael W. Konstan, W. Harry Hannon. (2011) Implementation of the first worldwide quality assurance program for cystic fibrosis multiple mutation detection in population-based screening. Clinica Chimica Acta 412:15-16, 1376-1381
CrossRef4
Catherine Costa, Virginie Pruliere-Escabasse, Alix de Becdelievre, Christine Gameiro, Lisa Golmard, Caroline Guittard, Laurence Bassinet, Thierry Bienvenu, Marie Des Georges, Ralph Epaud, Eric Bieth, Irina Giurgea, Abdel Aissat, Alexandre Hinzpeter, Bruno Costes, Pascale Fanen, Michel Goossens, Mireille Claustres, André Coste, Emmanuelle Girodon. (2011) A recurrent deep-intronic splicing CF mutation emphasizes the importance of mRNA studies in clinical practice. Journal of Cystic Fibrosis
CrossRef5
Lucy Costantino, Laura Claut, Valentina Paracchini, Domenico A. Coviello, Carla Colombo, Luigi Porcaro, Patrizia Capasso, Maddalena Zanardelli, Giovanna Pizzamiglio, Dario Degiorgio, Manuela Seia. (2010) A novel donor splice site characterized by CFTR mRNA analysis induces a new pseudo-exon in CF patients. Journal of Cystic Fibrosis 9:6, 411-418
CrossRef6
Paola Rimessi, Marina Fabris, Matteo Bovolenta, Elena Bassi, Sofia Falzarano, Francesca Gualandi, Claudio Rapezzi, Fabio Coccolo, Daniela Perrone, Alessandro Medici, Alessandra Ferlini. (2010) Antisense Modulation of Both Exonic and Intronic Splicing Motifs Induces Skipping of a DMD Pseudo-Exon Responsible for X-Linked Dilated Cardiomyopathy. Human Gene Therapy 21:9, 1137-1146
CrossRef7
Ashish Dhir, Emanuele Buratti. (2010) Alternative splicing: role of pseudoexons in human disease and potential therapeutic strategies. FEBS Journal 277:4, 841-855
CrossRef8
Maggie Sifain, Clement L. Ren. (2010) Diagnosing Cystic Fibrosis at All Ages. Clinical Pulmonary Medicine 17:1, 14-19
CrossRef9
Sondess Hadj Fredj, Taïeb Messaoud, Carine Templin, Marie des Georges, Slaheddine Fattoum, Mireille Claustres. (2009) Cystic Fibrosis Transmembrane Conductance Regulator Mutation Spectrum in Patients with Cystic Fibrosis in Tunisia. Genetic Testing and Molecular Biomarkers 13:5, 577-581
CrossRef10
Pramod Kumar Garg, Rajni Khajuria, Madhulika Kabra, Shivaram S. Shastri. (2009) Association of SPINK1 Gene Mutation and CFTR Gene Polymorphisms in Patients With Pancreas Divisum Presenting With Idiopathic Pancreatitis. Journal of Clinical Gastroenterology 43:9, 848-852
CrossRef11
Dmitry V Kazakov, Sybilla Thoma-Uszynski, Tomas Vanecek, Denisa Kacerovska, Petr Grossmann, Michal Michal. (2009) A Case of Brooke-Spiegler Syndrome With a Novel Germline Deep Intronic Mutation in the CYLD Gene Leading to Intronic Exonization, Diverse Somatic Mutations, and Unusual Histology. The American Journal of Dermatopathology 31:7, 664-673
CrossRef12
Thomas Rio Frio, Terri L. McGee, Nicholas M. Wade, Christian Iseli, Jacques S. Beckmann, Eliot L. Berson, Carlo Rivolta. (2009) A single-base substitution within an intronic repetitive element causes dominant retinitis pigmentosa with reduced penetrance. Human Mutation 30:9, 1340-1347
CrossRef13
J.B. Rose, L. Ellis, B. John, S. Martin, T. Gonska, M. Solomon, E. Tullis, M. Corey, K. Adeli, P.R. Durie. (2009) Does the Macroduct® collection system reliably define sweat chloride concentration in subjects with intermediate results?. Clinical Biochemistry 42:12, 1260-1264
CrossRef14
Manuela Seia, Lucy Costantino, Valentina Paracchini, Luigi Porcaro, Patrizia Capasso, Domenico Coviello, Carlo Corbetta, Erminio Torresani, Domenico Magazzù, Vincenza Consalvo, Alice Monti, Diana Costantini, Carla Colombo. (2009) Borderline sweat test: Utility and limits of genetic analysis for the diagnosis of cystic fibrosis. Clinical Biochemistry 42:7-8, 611-616
CrossRef15
Felix G. Riepe, Miguel X. P. van Bemmelen, Francois Cachat, Hansjörg Plendl, Ivan Gautschi, Nils Krone, Paul-Martin Holterhus, Gerald Theintz, Laurent Schild. (2009) Revealing a subclinical salt-losing phenotype in heterozygous carriers of the novel S562P mutation in the α subunit of the epithelial sodium channel. Clinical Endocrinology 70:2, 252-258
CrossRef16
Heidi R. Madden, Sue Fletcher, Mark R. Davis, Steve D. Wilton. (2009) Characterization of a complex Duchenne muscular dystrophy-causing dystrophin gene inversion and restoration of the reading frame by induced exon skipping. Human Mutation 30:1, 22-28
CrossRef17
S Deleu, E Gonzalez-Merino, N Gaspard, TMU Nguyen, P Vanderhaeghen, L Lagneaux, M Toungouz, Y Englert, F Devreker. (2009) Human cystic fibrosis embryonic stem cell lines derived on placental mesenchymal stromal cells. Reproductive BioMedicine Online 18:5, 704-716
CrossRef18
Neeraj Sharma, Meenu Singh, Naveen Acharya, Shrawan K. Singh, Babu R. Thapa, Gurjeet Kaur, Rajendra Prasad. (2008) Implication of the Cystic Fibrosis Transmembrane Conductance Regulator Gene in Infertile Family Members of Indian CF Patients. Biochemical Genetics 46:11-12, 847-856
CrossRef19
Karen Z. Voter, Clement L. Ren. (2008) Diagnosis of Cystic Fibrosis. Clinical Reviews in Allergy & Immunology 35:3, 100-106
CrossRef20
A. Labbé, I. Creveaux. (2008) Bronchiolite folliculaire révélatrice d’une mucoviscidose. Quinze ans après le diagnostic initial. Revue des Maladies Respiratoires 25:9, 1149-1150
CrossRef21
Ranit Jaron, Yasmin Yaakov, Joseph Rivlin, Hannah Blau, Lea Bentur, Yakov Yahav, Eitan Kerem, Haim Bibi, Elie Picard, Michael Wilschanski. (2008) Nasal potential difference in non-classic cystic fibrosis—long term follow up. Pediatric Pulmonology 43:6, 545-549
CrossRef22
C. Castellani, H. Cuppens, M. Macek, J.J. Cassiman, E. Kerem, P. Durie, E. Tullis, B.M. Assael, C. Bombieri, A. Brown, T. Casals, M. Claustres, G.R. Cutting, E. Dequeker, J. Dodge, I. Doull, P. Farrell, C. Ferec, E. Girodon, M. Johannesson, B. Kerem, M. Knowles, A. Munck, P.F. Pignatti, D. Radojkovic, P. Rizzotti, M. Schwarz, M. Stuhrmann, M. Tzetis, J. Zielenski, J.S. Elborn. (2008) Consensus on the use and interpretation of cystic fibrosis mutation analysis in clinical practice. Journal of Cystic Fibrosis 7:3, 179-196
CrossRef23
Katherine Zhang, Inga Nowak, Diane Rushlow, Brenda L. Gallie, Dietmar R. Lohmann. (2008) Patterns of missplicing caused by RB1 gene mutations in patients with retinoblastoma and association with phenotypic expression. Human Mutation 29:4, 475-484
CrossRef24
Shivaram S. Shastri, Madhulika Kabra, Sushil Kumar Kabra, Ravindra M. Pandey, P.S.N. Menon. (2008) Characterisation of mutations and genotype–phenotype correlation in cystic fibrosis: Experience from India. Journal of Cystic Fibrosis 7:2, 110-115
CrossRef25
Arie Augarten, Amir Ben Tov, Igal Madgar, Asher Barak, Hanna Akons, Joseph Laufer, Ori Efrati, Micha Aviram, Lea Bentur, Hannah Blau, Gideon Paret, Michael Wilschanski, Bat-Sheva Kerem, Yaakov Yahav. (2008) The changing face of the exocrine pancreas in cystic fibrosis: the correlation between pancreatic status, pancreatitis and cystic fibrosis genotype. European Journal of Gastroenterology & Hepatology 20:3, 164-168
CrossRef26
Reza Alibakhshi, Roya Kianishirazi, Jean-Jacques Cassiman, Mahdi Zamani, Harry Cuppens. (2008) Analysis of the CFTR gene in Iranian cystic fibrosis patients: Identification of eight novel mutations. Journal of Cystic Fibrosis 7:2, 102-109
CrossRef27
Corinne Bareil, Caroline Guittard, Jean-Pierre Altieri, Carine Templin, Mireille Claustres, Marie des Georges. (2007) Comprehensive and Rapid Genotyping of Mutations and Haplotypes in Congenital Bilateral Absence of the Vas Deferens and Other Cystic Fibrosis Transmembrane Conductance Regulator-Related Disorders. The Journal of Molecular Diagnostics 9:5, 582-588
CrossRef28
Manish J. Butte, Charles Haines, Francisco A. Bonilla, Jennifer Puck. (2007) IL-7 receptor deficient SCID with a unique intronic mutation and post-transplant autoimmunity due to chronic GVHD. Clinical Immunology 125:2, 159-164
CrossRef29
Todd M. Christensen, Mohamed Jama, Victor Ponek, Elaine Lyon, Jean Amos Wilson, Marcy L. Hoffmann, Bassem A. Bejjani. (2007) Design, Development, Validation, and Use of Synthetic Nucleic Acid Controls for Diagnostic Purposes and Application to Cystic Fibrosis Testing. The Journal of Molecular Diagnostics 9:3, 315-319
CrossRef30
Catherine Dehainault, Dorothée Michaux, Sabine Pagès-Berhouet, Virginie Caux-Moncoutier, François Doz, Laurence Desjardins, Jérôme Couturier, Philippe Parent, Dominique Stoppa-Lyonnet, Marion Gauthier-Villars, Claude Houdayer. (2007) A deep intronic mutation in the RB1 gene leads to intronic sequence exonisation. European Journal of Human Genetics 15:4, 473-477
CrossRef31
Liat Linde, Stephanie Boelz, Malka Nissim-Rafinia, Yifat S. Oren, Michael Wilschanski, Yasmin Yaacov, Dov Virgilis, Gabriele Neu-Yilik, Andreas E. Kulozik, Eitan Kerem, Batsheva Kerem. (2007) Nonsense-mediated mRNA decay affects nonsense transcript levels and governs response of cystic fibrosis patients to gentamicin. Journal of Clinical Investigation 117:3, 683-692
CrossRef32
Kelvin D MacDonald, Karen R McKenzie, Pamela L Zeitlin. (2007) Cystic Fibrosis Transmembrane Regulator Protein Mutations. Pediatric Drugs 9:1, 1-10
CrossRef33
Kevin W. Southern. (2007) Cystic Fibrosis and Formes Frustes of CFTR-Related Disease. Respiration 74:3, 241-251
CrossRef34
Jacob Yahav, Zmira Samra, Hannah Blau, Gabriel Dinari, Gabriel Chodick, Haim Shmuely. (2006) Helicobacter pylori and Clostridium difficile in Cystic Fibrosis Patients. Digestive Diseases and Sciences 51:12, 2274-2279
CrossRef35
Carry R. Cutting. (2006) Ursachen der Variationen bei den Phänotypen der Mukoviszidose. Annales Nestlé (Deutsche Ausg.) 64:3, 113-120
CrossRef36
Kris De Boeck. (2006) Diagnostische Verfahren, klinische Merkmale und Beratung bei Mukoviszidose (cystischer Fibrose, CF). Annales Nestlé (Deutsche Ausg.) 64:3, 121-132
CrossRef37
Wanda F. Reynolds, Isabelle Sermet-Gaudelus, Valérie Gausson, Marie-Noëlle Feuillet, Jean-Paul Bonnefont, Gérard Lenoir, Béatrice Descamps-Latscha, Véronique Witko-Sarsat. (2006) Myeloperoxidase Promoter Polymorphism −463G Is Associated With More Severe Clinical Expression of Cystic Fibrosis Pulmonary Disease. Mediators of Inflammation 2006, 1-9
CrossRef38
David R. Koehler, Helena Frndova, Kitty Leung, Emily Louca, Donna Palmer, Philip Ng, Colin McKerlie, Peter Cox, Allan L. Coates, Jim Hu. (2005) Aerosol delivery of an enhanced helper-dependent adenovirus formulation to rabbit lung using an intratracheal catheter. The Journal of Gene Medicine 7:11, 1409-1420
CrossRef39
Garry R Cutting. (2005) MODIFIER GENETICS: Cystic Fibrosis. Annual Review of Genomics and Human Genetics 6:1, 237-260
CrossRef40
Christophe Béroud, Dalil Hamroun, Gwenaëlle Collod-Béroud, Catherine Boileau, Thierry Soussi, Mireille Claustres. (2005) UMD (Universal Mutation Database): 2005 update. Human Mutation 26:3, 184-191
CrossRef41
Van Khanh Tran, Zhujun Zhang, Mariko Yagi, Atsushi Nishiyama, Yasuaki Habara, Yasuhiro Takeshima, Masafumi Matsuo. (2005) A novel cryptic exon identified in the 3′ region of intron 2 of the human dystrophin gene. Journal of Human Genetics 50:8, 425-433
CrossRef42
Iris Schrijver, Eneli Oitmaa, Andres Metspalu, Phyllis Gardner. (2005) Genotyping Microarray for the Detection of More Than 200 CFTR Mutations in Ethnically Diverse Populations. The Journal of Molecular Diagnostics 7:3, 375-387
CrossRef43
K. Mennicke, R. D. Klingenberg, M. Bals-Pratsch, K. Diedrich, E. Schwinger. (2005) Rational approach to genetic testing of cystic fibrosis (CF) in infertile men. Andrologia 37:1, 1-9
CrossRef44
Malka Nissim-Rafinia, Micha Aviram, Scott H Randell, Liat Shushi, Efrat Ozeri, Ornit Chiba-Falek, Ofer Eidelman, Harvey B Pollard, James R Yankaskas, Batsheva Kerem. (2004) Restoration of the cystic fibrosis transmembrane conductance regulator function by splicing modulation. EMBO reports 5:11, 1071-1077
CrossRef45
Federica Sangiuolo, Maria Rosaria D’Apice, Stefano Gambardella, Nicola Di Daniele, Giuseppe Novelli. (2004) Toward the pharmacogenomics of cystic fibrosis – an update. Pharmacogenomics 5:7, 861-878
CrossRef46
Stephanie Hirtz, Tanja Gonska, Hans H. Seydewitz, Jörg Thomas, Peter Greiner, Joachim Kuehr, Matthias Brandis, Irmgard Eichler, Herculano Rocha, Ana—Isabel Lopes, Celeste Barreto, Anabela Ramalho, Margarida D. Amaral, Karl Kunzelmann, Marcus Mall. (2004) CFTR Cl− channel function in native human colon correlates with the genotype and phenotype in cystic fibrosis. Gastroenterology 127:4, 1085-1095
CrossRef47
Elaine A. Sugarman, Elizabeth M. Rohlfs, Lawrence M. Silverman, Bernice A. Allitto. (2004) CFTR mutation distribution among U.S. Hispanic and African American individuals: Evaluation in cystic fibrosis patient and carrier screening populations. Genetics in Medicine 6:5, 392-399
CrossRef48
Danielle Dorsaneo, Drucy Borowitz, Jack Sharp, Richard Moss. (2004) Allergic Bronchopulmonary Aspergillosis with Normal Serum IgE in a Child with Cystic Fibrosis. Pediatric Asthma, Allergy & Immunology 17:2, 146-150
CrossRef49
Xavier Dray, Thierry Bienvenu, Nadine Desmazes—dufeu, Daniel Dusser, Philippe Marteau, Dominique Hubert. (2004) Distal intestinal obstruction syndrome in adults with cystic fibrosis. Clinical Gastroenterology and Hepatology 2:6, 498-503
CrossRef50
A. Coste, E. Girodon, S. Louis, V. Pruli??re-Escabasse, M. Goossens, R. Peyn??gre, E. Escudier. (2004) Atypical Sinusitis in Adults Must Lead to Looking for Cystic Fibrosis and Primary Ciliary Dyskinesia. The Laryngoscope 114:5, 839-843
CrossRef51
MN Feuillet-Fieux, M Ferrec, N Gigarel, L Thuillier, I Sermet, J Steffann, G Lenoir, JP Bonnefont. (2004) Novel CFTR mutations in black cystic fibrosis patients. Clinical Genetics 65:4, 284-287
CrossRef52
Dominique Hubert, Isabelle Fajac, Thierry Bienvenu, Nadine Desmazes-Dufeu, Madiha Ellaffi, Josette Dall'Ava-Santucci, Daniel Dusser. (2004) Diagnosis of cystic fibrosis in adults with diffuse bronchiectasis. Journal of Cystic Fibrosis 3:1, 15-22
CrossRef53
Margaret W. Leigh. (2004) Diagnosis of CF despite normal or borderline sweat chloride. Paediatric Respiratory Reviews 5, S357-S359
CrossRef54
Christophe Béroud, Alain Carrié, Chérif Beldjord, Nathalie Deburgrave, Stéphane Llense, Nadège Carelle, Cécile Peccate, Jean-Marie Cuisset, Florence Pandit, Frédérique Carré-Pigeon, Michèle Mayer, Rémi Bellance, Dominique Récan, Jamel Chelly, Jean-Claude Kaplan, France Leturcq. (2004) Dystrophinopathy caused by mid-intronic substitutions activating cryptic exons in the DMD gene. Neuromuscular Disorders 14:1, 10-18
CrossRef55
Vinay Gowda, Michael Roberts, Robert Wolfe, William B. Klaustermeyer. (2003) Recurrent cough and normal sweat chloride test. Annals of Allergy, Asthma & Immunology 91:6, 527-530
CrossRef56
Wilschanski, Michael, Yahav, Yaacov, Yaacov, Yasmin, Blau, Hannah, Bentur, Lea, Rivlin, Joseph, Aviram, Micha, Bdolah-Abram, Tali, Bebok, Zsuzsa, Shushi, Liat, Kerem, Batsheva, Kerem, Eitan, . (2003) Gentamicin-Induced Correction of CFTR Function in Patients with Cystic Fibrosis and CFTR Stop Mutations. New England Journal of Medicine 349:15, 1433-1441
Full Text57
Rebecca K. Rowntree, Ann Harris. (2003) The Phenotypic Consequences of CFTR Mutations. Annals of Human Genetics 67:5, 471-485
CrossRef58
Edward F McKone, Scott S Emerson, Karen L Edwards, Moira L Aitken. (2003) Effect of genotype on phenotype and mortality in cystic fibrosis: a retrospective cohort study. The Lancet 361:9370, 1671-1676
CrossRef59
Lucas L. Kulczycki, Marzena Kostuch, Joseph A. Bellanti. (2003) A clinical perspective of cystic fibrosis and new genetic findings: Relationship of CFTR mutations to genotype-phenotype manifestations. American Journal of Medical Genetics 116A:3, 262-267
CrossRef60
Mehmet Okyay K?l?n
, Vasiliki Ninidu Ninis, Elif Da?l?, M
CrossRef61
Groman, Joshua D., Meyer, Michelle E., Wilmott, Robert W., Zeitlin, Pamela L., Cutting, Garry R., . (2002) Variant Cystic Fibrosis Phenotypes in the Absence of CFTR Mutations. New England Journal of Medicine 347:6, 401-407
Full Text62
Francesco Salvatore, Olga Scudiero, Giuseppe Castaldo. (2002) Genotype-phenotype correlation in cystic fibrosis: The role of modifier genes. American Journal of Medical Genetics 111:1, 88-95
CrossRef63
Shlomit Orgad, Michal Berkenstadt, Reuven Achiron, Yaakov Yahav, Ephraim Gazit, Gad Barkai, Ron Loewenthal. (2002) Hyperechogenic bowel loops and meconium ileus in a fetus carrying the D1152H and G542X cystic fibrosis CFTR mutations. Prenatal Diagnosis 22:7, 636-637
CrossRef64
C. Schaedel, I. de Monestrol, L. Hjelte, M. Johannesson, R. Kornf
CrossRef65
Satoru Naruse*, Motoji Kitagawa, Hiroshi Ishiguro, Kotoyo Fujiki, Tetsuo Hayakawa. (2002) Cystic fibrosis and related diseases of the pancreas. Best Practice & Research Clinical Gastroenterology 16:3, 511-526
CrossRef66
A GREGG, J SIMPSON. (2002) Genetic screening for cystic fibrosis. Obstetrics and Gynecology Clinics of North America 29:2, 329-340
CrossRef67
Barker, Alan F., . (2002) Bronchiectasis. New England Journal of Medicine 346:18, 1383-1393
Full Text68
Antony E Shrimpton. (2002) Molecular diagnosis of cystic fibrosis. Expert Review of Molecular Diagnostics 2:3, 240-256
CrossRef69
Jean Amos, Meeta Patnaik. (2002) Commercial molecular diagnostics in the U.S.: The Human Genome Project to the clinical laboratory. Human Mutation 19:4, 324-333
CrossRef70
A Visich, J Zielenski, C Castaños, G Diez, M Grenoville, E Segal, C Barreiro, L-C Tsui, L Chertkoff. (2002) Complete screening of the CFTR gene in Argentine cystic fibrosis patients. Clinical Genetics 61:3, 207-213
CrossRef71
Anne Vankeerberghen, Harry Cuppens, Jean-Jacques Cassiman. (2002) The cystic fibrosis transmembrane conductance regulator: an intriguing protein with pleiotropic functions. Journal of Cystic Fibrosis 1:1, 13-29
CrossRef72
Heiko Witt, Michael Becker. (2002) Genetics of Chronic Pancreatitis. Journal of Pediatric Gastroenterology and Nutrition 34:2, 125-136
CrossRef73
Vicky A. LeGrys, DrA, MT(ASCP). (2001) The Sweat Test for the Diagnosis of Cystic Fibrosis. Laboratory Medicine 32:12, 750-755
CrossRef74
Louise A. Metherell, Scott A. Akker, Patricia B Munroe, Stephen J Rose, Mark Caulfield, Martin O. Savage, Shern L. Chew, Adrian J.L. Clark. (2001) Pseudoexon Activation as a Novel Mechanism for Disease Resulting in Atypical Growth-Hormone Insensitivity. The American Journal of Human Genetics 69:3, 641-646
CrossRef75
S. Orgad, S. Neumann, R. Loewenthal, I. Netanelov-Shapira, E. Gazit. (2001) Prevalence of Cystic Fibrosis Mutations in Israeli Jews. Genetic Testing 5:1, 47-52
CrossRef76
V. Scotet, M. De Braekeleer, M.-P. Audrézet, L. Lodé, C. Verlingue, I. Quéré, B. Mercier, I. Duguépéroux, J.-P. Codet, M.-P. Moineau, P. Parent, C. Férec. (2001) Prevalence of CFTR mutations in hypertrypsinaemia detected through neonatal screening for cystic fibrosis. Clinical Genetics 59:1, 42-47
CrossRef77
C. Koch, H. Cuppens, M. Rainisio, U. Madessani, H.K. Harms, M.E. Hodson, G. Mastella, J. Navarro, B. Strandvik, S.G. McKenzie, . (2001) European Epidemiologic Registry of Cystic Fibrosis (ERCF): Comparison of major disease manifestations between patients with different classes of mutations. Pediatric Pulmonology 31:1, 1-12
CrossRef78
Arie Augarten, Haim Shmilovich, Ram Doolman, Micha Aviram, Hannah Akons, Lea Ben Tur, Hannah Blau, Eitan Kerem, Joseph Rivlin, Ben-Ami Sela, Amir Szeinberg, Yaacov Yahav. (2000) Serum lipase levels as a diagnostic marker in cystic fibrosis patients with normal or borderline sweat tests. Pediatric Pulmonology 30:4, 320-323
CrossRef79
Madhulika Kabra, S.K. Kabra, Manju Ghosh, Aarti Khanna, Sadhana Arora, P.S.N. Menon, Ishwar C. Verma, Andrew Wallace. (2000) Is the spectrum of mutations in Indian patients with cystic fibrosis different?. American Journal of Medical Genetics 93:2, 161-163
CrossRef80
John E. Mickle, Garry R. Cutting. (2000) GENOTYPE-PHENOTYPE RELATIONSHIPS IN CYSTIC FIBROSIS. Medical Clinics of North America 84:3, 597-607
CrossRef81
Alan Cade, M.P. Walters, N. McGinley, J. Firth, K.G. Brownlee, S.P. Conway, J.M. Littlewood. (2000) Evaluation of fecal pancreatic elastase-1 as a measure of pancreatic exocrine function in children with cystic fibrosis. Pediatric Pulmonology 29:3, 172-176
CrossRef82
M. Stuhrmann, T. Dork. (2000) CFTR gene mutations and male infertility. Andrologia 32:2, 71-83
CrossRef83
Emmanuelle Girodon-Boulandet, C
CrossRef84
Richard D. Bagnall, Naushin H. Waseem, Peter M. Green, Brian Colvin, Christine Lee, Francesco Giannelli. (1999) Creation of a novel donor splice site in intron 1 of the factor VIII gene leads to activation of a 191 bp cryptic exon in two haemophilia A patients. British Journal of Haematology 107:4, 766-771
CrossRef85
C Arduino, M Gallo, A Brusco, S Garnerone, Mr Piana, S Di Maggio, G Gerbino Promis, M Ferrone, A Angeli, E Gaia. (1999) Polyvariant mutant CFTR genes in patients with chronic pancreatitis. Clinical Genetics 56:5, 401-405
CrossRef86
Suresh T. Chari, Eugene P. DiMagno. (1999) Chronic pancreatitis. Current Opinion in Gastroenterology 15:5, 398
CrossRef87
Kerem, Eitan, Bistritzer, Tzvy, Hanukoglu, Aaron, Hofmann, Thomas, Zhou, Zhaoqing, Bennett, William, MacLaughlin, Eithne, Barker, Pierre, Nash, Martin, Quittell, Lynne, Boucher, Richard, Homolya, Vera, Keenan, Bruce, Knowles, Michael R., . (1999) Pulmonary Epithelial Sodium-Channel Dysfunction and Excess Airway Liquid in Pseudohypoaldosteronism. New England Journal of Medicine 341:3, 156-162
Full Text88
Katsunobu Takenaka, Hideki Sakai, Hiroyasu Yamakawa, Shin-ichi Yoshimura, Morio Kumagai, Haruki Yamakawa, Shigeru Nakashima, Yoshinori Nozawa, Noboru Sakai. (1999) Polymorphism of the endoglin gene in patients with intracranial saccular aneurysms. Journal of Neurosurgery 90:5, 935-938
CrossRef89
(1999) Mutations of the Cystic Fibrosis Gene and Pancreatitis. New England Journal of Medicine 340:3, 238-239
Full Text90
Sebastian Beck, Deborah Penque, Susana Garcia, Anita Gomes, Carlos Farinha, Lucinda Mata, S
CrossRef91
A. Augarten, D. Katznelson, L. Dubenbaum, R. Doolman, B-A. Sela, A. Lusky, A. Szeinberg, B-S. Kerem, G. Paret, E. Gazit, J. Sack, Y. Yahav. (1998) Serum lipase levels pre and post Landh meal: Evaluation of exocrine pancreatic status in cystic fibrosis. International Journal of Clinical & Laboratory Research 28:4, 226-229
CrossRef92
RICHARD KRAEMER, PETER BIRRER, SABINA LIECHTI-GALLATI. (1998) Genotype-Phenotype Association in Infants with Cystic Fibrosis at the Time of Diagnosis. Pediatric Research 44:6, 920-926
CrossRef93
Ornit Chiba-Falek, Eitan Kerem, Tzipora Shoshani, Micha Aviram, Arei Augarten, Lea Bentur, Asher Tal, Elisabath Tullis, Ayelet Rahat, Batsheva Kerem. (1998) The Molecular Basis of Disease Variability among Cystic Fibrosis Patients Carrying the 3849+10 kb C→T Mutation. Genomics 53:3, 276-283
CrossRef94
Beryl J. Rosenstein. (1998) WHAT IS A CYSTIC FIBROSIS DIAGNOSIS?. Clinics in Chest Medicine 19:3, 423-441
CrossRef95
John E. Mickle, Garry R. Cutting. (1998) CLINICAL IMPLICATIONS OF CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR MUTATIONS. Clinics in Chest Medicine 19:3, 443-458
CrossRef96
Min-Hui Liang, Karin K Wertz, C.Michael Bowman, Evelyn Hsu, Bertrand Shapiro, Lee-Jun C Wong. (1998) 3849 + 10 kb C → T Splicing Mutation in Hispanic CF Patients. Molecular Genetics and Metabolism 64:3, 213-216
CrossRef97
Eliete Rabbi-Bortolini, Andr
CrossRef98
Marc De Braekeleer, Christian Allard, Jean-Pierre Leblanc, Gervais Aubin, Fernand Simard. (1998) Correlation of Sweat Chloride Concentration with Genotypes in Cystic Fibrosis Patients in Saguenay Lac-Saint-Jean, Quebec, Canada. Clinical Biochemistry 31:1, 33-36
CrossRef99
Bettina C Hilman. (1997) Genetic and Immunologic Aspects of Cystic Fibrosis. Annals of Allergy, Asthma & Immunology 79:5, 379-394
CrossRef100
Robin O Go, Thomas R Martin, Mitchell R Lester. (1997) A Wheezy Infant Unresponsive to Bronchodilators. Annals of Allergy, Asthma & Immunology 78:5, 449-456
CrossRef101
Stern, Robert C., . (1997) The Diagnosis of Cystic Fibrosis. New England Journal of Medicine 336:7, 487-491
Full Text102
I Durieu, F Bey-Omar, J Rollet, D Boggio, G Bellon, Y Morel, D Vital Durand. (1997) Stérilité masculine par agénésie bilatérale des canaux déférents: une nouvelle forme clinique de mucoviscidose?. La Revue de Médecine Interne 18:2, 114-118
CrossRef103
S. M. Sawyer, C. F. Robertson, G. Bowes. (1997) Cystic fibrosis: a changing clinical perspective. Australian and New Zealand Journal of Medicine 27:1, 6-11
CrossRef104
W. Edward Highsmith, Lauranell H. Burch, Zhaoqing Zhou, John C. Olsen, Theresa V. Strong, Terry Smith, Kenneth J. Friedman, Lawrence M. Silverman, Richard C. Boucher, Francis S. Collins, Michael R. Knowles. (1997) Identification of a splice site mutation (2789+5 G>A) associated with small amounts of normal CFTRmRNA and mild cystic fibrosis. Human Mutation 9:4, 332-338
CrossRef105
T Casals, P Pacheco, C Barreto, J Giménez, MD Ramos, S Pereira, JA Pinheiro, N Cobos, A Curvelo, C Vázquez, H Rocha, JL Séculi, E Pérez, J Dapena, E Carrilho, A Duarte, AM Palacio, V Nunes, J Lavinha, X Estivill. (1997) Missense mutation R1066C in the second transmembrane domain of CFTR causes a severe cystic fibrosis phenotype: Study of 19 heterozygous and 2 homozygous patients. Human Mutation 10:5, 387-392
CrossRef106
Kenneth J. Friedman, Ruth A. Heim, Michael R. Knowles, Lawrence M. Silverman. (1997) Rapid characterization of the variable length polythymidine tract in the cystic fibrosis (CFTR) gene: Association of the 5T allele with selected CFTR mutations and its incidence in atypical sinopulmonary disease. Human Mutation 10:2, 108-115
CrossRef107
Elizabeth M. Adams, Jeffrey A. Becker, Linda Griffith, Ava Segal, Paul H. Plotz, Nina Raben. (1997) Glycogenosis type II: A juvenile-specific mutation with an unusual splicing pattern and a shared mutation in African Americans. Human Mutation 10:2, 128-134
CrossRef108
Antony E. Shrimpton, Drucy Borowitz, Phillip Swender. (1997) Cystic fibrosis mutation frequencies in upstate New York. Human Mutation 10:6, 436-442
CrossRef109
Eitan Kerem, Batsheva Kerem. (1996) Genotype-phenotype correlations in cystic fibrosis. Pediatric Pulmonology 22:6, 387-395
CrossRef110
Thilo Dörk, Manfred Stuhrmann. (1996) Molekularbiologie der Mukoviszidose. Biologie in unserer Zeit 26:5, 282-291
CrossRef111
B. Tümmler, T. Storrs, V. Dziadek, T. Dörk, B. Tümmler, H. Hardt, T. Meitinger, A. Golla, R. M. Bertele-Harms, H. K. Harms, E. Schröder, A. Claaß, J. Rutjes, R. Scheppenheim, I. Bauer, K. Breuel, M. Stuhrmann, J. Schmidke, M. Linder, A. Eigel, J. Horst, R. Kaiser, M. J. Lentze, K. Schmidt, X. Estivill. (1996) Geographic distribution and origin of CFTR mutations in Germany. Human Genetics 97:6, 727-731
CrossRef112
Xavier Estivill. (1996) Complexity in a monogenic disease. Nature Genetics 12:4, 348-350
CrossRef113
David Hughes, Andrew Wallace, Joanne Taylor, May Tassabehji, Roger McMahon, Alison Hill, Norman Nevin, Colin Graham. (1996) Fluorescent multiplex microsatellites used to define haplotypes associated with 75 CFTR mutations from the UK on 437 CF chromosomes. Human Mutation 8:3, 229-235
CrossRef114
Jean M. DeMarchi, C. Thomas Caskey, C. Sue Richards. (1996) Population-specific screening by mutation analysis for diseases frequent in Ashkenazi Jews. Human Mutation 8:2, 116-125
CrossRef115
David J. Hughes, Alison J.M. Hill, Milan Macek, Aileen O. Redmond, Norman C. Nevin, Colin A. Graham. (1996) Mutation characterization ofCFTR gene in 206 Northern Irish CF families: Thirty mutations, including two novel, account for
94% of CF chromosomes. Human Mutation 8:4, 340-347
CrossRef116
Núria Morral, Thilo Dörk, Roser Llevadot, Violetta Dziadek, Bernard Mercier, Claude Férec, Bruno Costes, Emmanuelle Girodon, Julian Zielenski, Lap-Chee Tsui, Burkhard Tümmler, Xavier Estivill. (1996) Haplotype analysis of 94 cystic fibrosis mutations with seven polymorphicCFTR DNA markers. Human Mutation 8:2, 149-159
CrossRef117
(1995) A Cystic Fibrosis Mutation Associated with Mild Lung Disease. New England Journal of Medicine 333:24, 1644-1644
Full Text118
Arie Augarten, Shoshana Hacham, Eitan Kerem, Bat Sheva Kerem, Amir Szeinberg, Joseph Laufer, Ram Doolman, Ruth Altshuler, Hana Blau, Lea Bentur, Ephraim Gazit, Daniel Katznelson, Yaacov Yahav. (1995) The significance of sweat Cl/Na ratio in patients with borderline sweat test. Pediatric Pulmonology 20:6, 369-371
CrossRef119
John G. Hay, Noel G. McElvaney, Juan Herena, Ronald G. Crystal. (1995) Modification of Nasal Epithelial Potential Differences of Individuals with Cystic Fibrosis Consequent to Local Administration of a Normal CFTR cDNA Adenovirus Gene Transfer Vector. Human Gene Therapy 6:11, 1487-1496
CrossRef120
Knowles, Michael R., Hohneker, Kathy W., Zhou, Zhaoqing, Olsen, John C., Noah, Terry L., Hu, Ping-Chuan, Leigh, Margaret W., Engelhardt, John F., Edwards, Lloyd J., Jones, Kim R., Grossman, Mariann, Wilson, James M., Johnson, Larry G., Boucher, Richard C., . (1995) A Controlled Study of Adenoviral-Vector–Mediated Gene Transfer in the Nasal Epithelium of Patients with Cystic Fibrosis. New England Journal of Medicine 333:13, 823-831
Full Text121
Fred Gilbert, Zhen Li, Iordanis Arzimanoglou, Martin Bialer, Carolyn Denning, Jack Gorvoy, Joyce Honorof, Celia Ores, Lynne Quittell, Leonard Rossoff, Kathleen Valverde. (1995) Clinical spectrum in homozygotes and compound heterozygotes inheriting cystic fibrosis mutation 3849+10kbC>T: Singnificance for geneticists. American Journal of Medical Genetics 58:4, 356-359
CrossRef122
J.A. Dodge. (1995) Male fertility in cystic fibrosis. The Lancet 346:8975, 587-588
CrossRef123
JWS. (1995) News for the practitioner. European Journal of Pediatrics 154:8, 684-685
CrossRef124
R.C Stern, C.F Doershuk, M Drumm. (1995) 3849+10 kb C→T mutation and disease severity in cystic fibrosis. The Lancet 346:8970, 274-276
CrossRef125
Chillón, Miguel, Casals, Teresa, Mercier, Bernard, Bassas, Lluís, Lissens, Willy, Silber, Sherman, Romey, Marie-Catherine, Ruiz-Romero, Javier, Verlingue, Claudine, Claustres, Mireille, Nunes, Virginia, Férec, Claude, Estivill, Xavier, . (1995) Mutations in the Cystic Fibrosis Gene in Patients with Congenital Absence of the Vas Deferens. New England Journal of Medicine 332:22, 1475-1480
Full Text126
Donald J. Davidson, Julia R. Dorin, Gerard McLachlan, Vincent Ranaldi, David Lamb, Catherine Doherty, John Govan, David J. Porteous. (1995) Lung disease in the cystic fibrosis mouse exposed to bacterial pathogens. Nature Genetics 9:4, 351-357
CrossRef127
Martin J. Schwarz, Geraldine M. Malone, Andrea Haworth, Jeremy P. Cheadle, A. Linda Meredith, Anne Gardner, I. Hilary Sawyer, Margaret Connarty, Nick Dennis, Anneke Seller, Ann Harris, Rohan Taylor, Simon Dear, Helen Middleton-Price, Cathie McMahon, Ed Mayall, Rob McMahon, David E. Barton, Martin Giles, Victoria Lindley, Davinder S. Plaha, Susan Price, Abid Sharif, Gareth S. Cross, Ann Dalton, Graham Taylor, Andrew Wallace, Mayada Tassabehji, Joanne L. Whittaker, Rachel Butler, Ann Curtis, Ros Pinkett, Annette J. Gilfillan, David J. H. Brock, G. Scott Higgins, George Lanyon, Zosia Miedzybrodzka, Mark Davidson, Colin A. Graham, Alison J. M. Hill. (1995) Cystic fibrosis mutation analysis: Report from 22 U.K. regional genetics laboratories. Human Mutation 6:4, 326-333
CrossRef
