Original Article
Human Herpesvirus-6 Infection in Children -- A Prospective Study of Complications and Reactivation
N Engl J Med 1994; 331:432-438August 18, 1994DOI: 10.1056/NEJM199408183310703
- Abstract
Background
Infection with human herpesvirus-6 (HHV-6) is nearly universal in infancy or early childhood. However, the course of this infection, its complications, and its potential for persistence or reactivation remain unclear.
Methods
We studied infants and children under the age of three years who presented to our emergency department with acute illnesses. Infants and young children without acute illness were studied as controls. HHV-6 infection was identified by blood-mononuclear-cell culture, serologic testing, and the polymerase chain reaction (PCR).
Results
No primary HHV-6 infection was found among 582 infants and young children with acute nonfebrile illnesses or among 352 controls without acute illness. Of 1653 infants and young children with acute febrile illnesses, 160 (9.7 percent) had primary HHV-6 infection, as documented by viremia and seroconversion. They ranged in age from 2 weeks to 25 months; 23 percent were under the age of 6 months. HHV-6 infections accounted for 20 percent of 365 visits to the emergency department for febrile illnesses among children 6 to 12 months old. Of the 160 infants and young children with acute HHV-6 infections, 21 (13 percent) were hospitalized, and 21 had seizures. Often the seizures appeared late and were prolonged or recurrent. HHV-6 infections accounted for one third of all febrile seizures in children up to the age of two years.
Media in This Article
Figure 1
Number of Children Presenting to the Emergency Department with Illness from Primary HHV-6 Infection (Bars) and Visits Due to Such Infection as a Percentage of All Emergency Department Visits for Acute Febrile Illnesses (Curve), According to Age.Figure 2
Geometric Mean Antibody Titers to HHV-6 at Follow-up, According to Age at the Onset of Acute Primary HHV-6 Infection.Article Activity
- Article
In follow-up studies over a period of one to two years, the HHV-6 genome persisted in blood mononuclear cells after primary infection in 37 of 56 children (66 percent). Reactivation, sometimes with febrile illnesses, was suggested by subsequent increases in antibody titers in 16 percent (30 of 187) and by PCR in 6 percent (17 of 278). No recurrent viremia was detected. Of 41 healthy newborns studied, 12 (29 percent) had the HHV-6 genome in their blood mononuclear cells; nevertheless, 6 of these newborns subsequently had primary HHV-6 infections.
Conclusions: In infants and young children HHV-6 infection is a major cause of visits to the emergency department, febrile seizures, and hospitalizations. Perinatal transmission may occur, with possible asymptomatic, transient, or persistent neonatal infection. (N Engl J Med 1994;331:432-8).
Although human herpesvirus-6 (HHV-6) was initially recovered from immunocompromised adults,1 subsequent reports from Japan showed that primary infection occurs in early childhood, predominantly as roseola2-7. Reports from other countries and our initial studies in infants in the United States showed a similar epidemiologic pattern, except that roseola was the clinical presentation in a minority of our cases despite the similarity of the strains recovered from the infants we studied and from the Japanese infants8-17. Many questions remained about the occurrence of primary infection, its subsequent course, the immune response, and complications that would be best addressed in a large prospective study of normal children with acute febrile and nonfebrile illnesses. The study we report here seeks to answer questions about routes of transmission, complications, and the frequency and circumstances of viral persistence and reactivation.
Methods
Subjects
Over a three-year period from July 1990 to July 1993 (a period that did not overlap with that of our initial study14), children under three years of age who presented to our emergency department with acute infections of all types were enrolled in the study. None of the children were included in the earlier study. Children were excluded from the study if blood sufficient for complete laboratory studies was not obtainable or if they had an underlying condition affecting immune function. Primary HHV-6 infection was diagnosed only if both HHV-6 viremia at the initial visit and subsequent seroconversion were documented. The child's history, the results of the physical examination, and the laboratory findings obtained in the emergency department were recorded on a standard form. Children with HHV-6 viremia proved by culture of peripheral-blood mononuclear cells obtained during the initial visit were followed by contacting each child's physician and family. A history was taken, clinical findings were assessed, additional blood specimens were obtained for HHV-6 isolation, and serologic tests, the polymerase chain reaction (PCR), and tests for other viral and bacterial agents were performed during convalescence and at the time of subsequent examinations conducted in the home, the physician's office, or the emergency department.
To compare the clinical findings associated with acute HHV-6 illness with those of other acute illnesses, a matched subgroup of children with acute illnesses that were subsequently shown not to be caused by HHV-6 was chosen and followed in a similar manner. Two or, when possible, three children with illnesses not caused by HHV-6 were matched to each child with HHV-6 illness, according to age, season of acute illness, and sex.
An additional group of children who were of similar ages were studied as normal controls. This group comprised normal, healthy children who were seen for routine care or who had conditions that were not acute, febrile, or infectious, such as orthopedic and surgical conditions.
Isolation of HHV-6
Mononuclear cells were separated from anticoagulated blood samples (0.5 to 3 ml) by density-gradient centrifugation (Histopaque 1077, Sigma Diagnostics, St. Louis) and cultivated with fresh cord-blood mononuclear cells as described elsewhere14. Positive cultures were confirmed by indirect immunofluorescent staining with monoclonal antibodies directed against the HHV-6 A or B variants and subsequently by PCR18,19.
Serologic Testing
IgG antibody to HHV-6 was determined by an indirect immunofluorescent-antibody assay described elsewhere14 that uses twofold dilutions (starting at 1:10) of serum and HSB-2 cells infected with an HHV-6 isolate containing both the HHV-6A and HHV-6B genomes16,17. Serum samples obtained during the acute illness and during convalescence were assayed simultaneously.
PCR
The sequences of the nested primers and the probe were derived from a segment of the HHV-6 genome near the left end of the portion unique to HHV-620. The primer sequences, which are conserved in HHV-6A (U1102) and HHV-6B (Z29), were as follows: external primers, 5'ATTGTGATGTACGTGGCCGTCTC and 5'GATCCATGGTCGTCTTTCCACG; and internal primers, 5'GCGGTCAACGTGCCGCTATCTAT and 5'GACATTTATAAGGGACCCGTTCG. The probe sequence was 5'GTCACGTATACCATTCCCAACC. The final nested product was 151 base pairs (bp) in length. DNA from blood mononuclear cells was prepared as described elsewhere,14 and PCR was performed on 2-microliter samples in a final volume of 25 microliters. HHV-6 specificity was confirmed by Southern blot hybridization. This method can reliably detect 10 copies of the HHV-6 genome. All tests on follow-up samples were repeated at least once. The primers were tested against other herpesviruses, including HHV-7, without detectable amplification. Each assay contained positive and negative controls, including uninfected cord-blood mononuclear cells, reaction mixture without DNA, and β-globin primers as performance controls21.
Statistical Analysis
Data pertaining to intervals were compared by the unpaired Student's t-test with Statworks, and proportions were compared by the chi-square test with Epi Info (Centers for Disease Control and Prevention, Atlanta). Odds ratios and 95 percent confidence intervals were calculated with Epi Info22.
Results
A total of 2587 children under three years of age were enrolled in this study (Table 1Table 1
Children Enrolled in the Study, 1990 through 1993.). Primary HHV-6 infection documented by both viremia and seroconversion occurred in 160 children, all of whom were in a group of 1653 children presenting with acute febrile illnesses. None of the blood-mononuclear-cell cultures for children without fever or for 352 normal control children grew HHV-6.Clinical and Epidemiologic Characteristics of Primary HHV-6 Infection
The incidence of HHV-6 did not vary according to the season, but the mean age at the time of the primary illness was 9.4 months (median, 8; range, 2 weeks to 25 months). Relatively few cases occurred in the first several months of life, and only one child became ill at an age greater than 24 months (Figure 1Figure 1
Number of Children Presenting to the Emergency Department with Illness from Primary HHV-6 Infection (Bars) and Visits Due to Such Infection as a Percentage of All Emergency Department Visits for Acute Febrile Illnesses (Curve), According to Age.). Children with acute HHV-6 illness accounted for 10 percent (159) of the 1553 children in the first 2 years of life and 21 percent (75) of the 365 children 6 to 12 months old who presented to our emergency department with acute febrile illnesses (Figure 1). The peak age at which the virus was acquired was six to nine months, with HHV-6 accounting for 45 of 186 visits (24 percent) for acute febrile illness. Children presenting to the emergency department with acute illnesses not caused by HHV-6 were similar in age (mean, 9.9 months) to those with HHV-6, but more of the children without HHV-6 were boys (64 percent vs. 50 percent, P<0.001).As compared with the 401 matched children with illnesses who were negative for HHV-6, the children with acute HHV-6 infection had a slightly earlier onset of symptoms (2.1 vs. 2.9 days, P = 0.006) and more abrupt and higher fever. At the time of the initial visit, 139 of 160 children with HHV-6 (87 percent) had temperatures above 39 °C (mean, 39.6 °C vs. 38.9 °C in HHV-6-negative children; P<0.001). The fever in the children with HHV-6 remained significantly higher (mean, 39.7 °C) for the first three days of the illness, and 15 percent remained febrile for six or more days.
Irritability, inflamed tympanic membranes, and the appearance of serious systemic illness were also noted significantly more often in HHV-6 primary infection. Cough and lower respiratory tract findings were associated less often with HHV-6 infection. Upper respiratory tract signs, however, occurred in 41 percent of HHV-6 illnesses, and gastrointestinal signs in one third. A rash, clinically compatible with roseola, was noted at the initial visit in nine children (6 percent). A characteristic rash developed in an additional 18 children on defervescence. Hence, roseola was eventually diagnosed in 27 children with HHV-6 illness (17 percent). The diagnoses assigned most frequently at the end of the evaluation by the emergency department among 157 children with primary HHV-6 infection were fever with otitis in 47 children (30 percent) and “fever of undetermined cause” or possible sepsis in 45 (29 percent). Among 401 matched children who were negative for HHV-6, these two diagnoses were assigned in 70 children (17 percent, P = 0.001) and 104 children (26 percent), respectively.
Children with HHV-6 illness had significantly lower mean numbers of peripheral-blood white cells (8900 vs. 14,300 per cubic millimeter, P<0.001), lymphocytes (3400 vs. 5300 per cubic millimeter, P = 0.01), and neutrophils (4500 vs. 7700 per cubic millimeter, P = 0.006) at the onset of illness and during the first four days.
Since roseola occurs primarily in children at an age of six months to three years,23-25 we examined the clinical features of HHV-6 illness in 36 children under the age of six months, or 23 percent of those with primary infection. Thirteen percent were under two months of age. Younger infants had a lower mean temperature than infants over the age of six months (38.9 °C vs. 39.8 °C, P<0.001) and less otitis, but more diarrhea, irritability, and need for hospitalization (12 of 35 [34 percent] vs. 9 of 121 [7 percent], P<0.001; odds ratio, 6.49; 95 percent confidence interval, 2.23 to 19.25).
Outcome and Complications
The mean duration of illness was 6 days (range, 1 to 21). Twenty-one children (13 percent) required hospitalization. The reasons for hospitalization were suspected sepsis and toxicity (65 percent), diarrhea and dehydration (15 percent), lower respiratory symptoms (10 percent), and seizures (10 percent). The average duration of hospitalization was four days (range, two to seven). Respiratory syncytial virus, isolated from one infant, was the only other pathogen found.
The principal complication was seizures, which occurred in 21 of the 160 children with HHV-6 (13 percent). Among the 1394 HHV-6-negative children 24 months of age or less, seizures complicated 9 percent of the febrile illnesses (P = 0.18). Among the 160 children with HHV-6 and the 401 matched controls, all of whom presented with acute febrile illnesses but no history of seizure, febrile seizures were documented in 67 (12 percent). Acute HHV-6 infection was associated with 21 of these seizures (31 percent). Thus, HHV-6 accounted for approximately one third of the first-time febrile seizures evaluated in the emergency department among these children two years old or younger. The median age of the children with HHV-6 who had seizures was 14 months (range, 7 to 24). The risk that seizures would complicate a primary infection was greatest among children 12 to 15 months old; 8 of 22 such children had seizures (36 percent). Among febrile HHV-6-negative children 12 to 15 months old, 17 of 131 had seizures (13 percent; P = 0.01; odds ratio, 0.26; 95 percent confidence interval, 0.09 to 0.8). Primary HHV-6 infection at any time in the second year of life carried an appreciable risk of seizures: the risk was 29 percent among children 12 to 18 months old and 36 percent among 14 children more than 18 months of age who had infection. All children were febrile at the time of their seizures; none had previously had seizures. Nine children had seizures late in the febrile course, on days 2 to 9. In three children seizures were prolonged and recurred within three days. Four children had seizures subsequently.
Cerebrospinal fluid was obtained from 36 children, including 9 with seizures, during the primary infection. Four samples in which there were appreciable numbers of red cells were uninterpretable. The other samples of cerebrospinal fluid were normal for the child's age with regard to numbers of white cells and concentrations of protein and glucose. No cerebrospinal fluid sample grew HHV-6, but HHV-6 was detected by PCR in 7 of 29 samples tested, including 2 of 7 samples from children with seizures.
Other complications that were observed in one to three children each were fever lasting two to three weeks, intermittent rash, arthralgias, arthritis, and encephalopathy.
Antibody Response, Initially and over Time
Serum samples obtained initially from 126 children with primary infection (79 percent) had little or no detectable HHV-6 antibody, whereas serum samples obtained during convalescence demonstrated seroconversion. The remaining infants, who had measurable antibody in the initial serum samples, were young infants with presumably maternal antibody. Serum samples obtained during convalescence demonstrated increases in antibody concentrations by four times or more, except that one young infant had a twofold increase rather than the decline expected in the absence of infection. The mean initial titer was 3.1 log2; during convalescence, the titer was 9.3 log2. Infants under the age of six months had higher initial titers (4.11 log2 vs. 2.93 log2, P<0.001). As compared with uninfected infants of the same age, infants who became infected with HHV-6 before they were two months old had significantly lower titers at the initial visit (5.02 log2 vs. 6.94 log2, P = 0.003).
There was an increase in HHV-6 antibody within three months of the acute infection that was maintained at average levels of 9 to 10 log2 for one year and that declined thereafter (Figure 2Figure 2
Geometric Mean Antibody Titers to HHV-6 at Follow-up, According to Age at the Onset of Acute Primary HHV-6 Infection.). Eleven infants with infection before three months of age had diminished antibody responses and a greater subsequent decline (Figure 2).Analysis of HHV-6 antibody in the total group of 2587 children according to age demonstrated the presence of passive antibody in all newborns at levels that declined over seven months, followed by a rapid increase caused by acquired infection (Figure 3Figure 3
Geometric Mean Antibody Titers to HHV-6 in 2427 Children and the Proportion in Whom the HHV-6 Genome Was Detected in Peripheral-Blood Mononuclear Cells by PCR, According to Age.).PCR
In all children with primary infection, PCR detected HHV-6 in peripheral-blood mononuclear cells during the acute illness. PCR remained positive in 53 of 68 sequential blood samples (78 percent) obtained within two months of the acute infection and in 37 of 56 samples (66 percent) obtained two months to two years after the primary infection.
PCR was also used to detect the HHV-6 genome in peripheral-blood mononuclear cells from the 2427 children without acute HHV-6 infection (Figure 3). PCR was positive in 23 of 204 infants (11 percent) in the first month of life who did not have acute HHV-6 illness. As the level of passive antibody declined, the rate of positivity by PCR rose rapidly, to 66 percent by one year of age. This correlated with a similar increase in mean antibody levels about two months later, indicating rapid acquisition of infection within six to nine months of the nadir of passive-antibody levels (Figure 3).
The rate of PCR positivity in children with acute illnesses not attributable to HHV-6 infection was compared with the rate in healthy controls to determine whether subsequent acute illness enhanced the detection of HHV-6, possibly from reactivation. When rates of PCR positivity were compared according to age, they were not significantly different in well and acutely ill children.
Reactivation
The possibility of reactivation was assessed with HHV-6 cultures, measurement of antibody titers, and PCR analysis of sequential blood samples in 301 children (102 with primary HHV-6 infection and 199 negative for HHV-6) followed for one to two years (Table 2Table 2
Serologic and PCR Analysis of Sequential Blood Samples Possibly Indicative of HHV-6 Reactivation in 301 Children Followed for One to Two Years.). HHV-6 was not grown from any follow-up blood sample. The only evidence of a possible reactivation in children with HHV-6 infection was a second fourfold increase in the antibody titer in 27 of 102 children (26 percent) and PCR findings in 7 of 102 (7 percent). Among all 301 children followed, evidence of possible reactivation was detected by measurement of antibody titers in 30 of 187 children (16 percent) and by PCR in 17 of 278 (6 percent). Only three children had concurrent increases in antibody titers and recurrent PCR positivity. The testing of multiple specimens for concurrent pathogens possibly associated with reactivation was rewarding in only one child, in whom a positive PCR recurred during infection with respiratory syncytial virus.HHV-6 DNA in Mononuclear Cells in the First Month of Life
To evaluate the frequency and meaning of detection of the HHV-6 genome by PCR in mononuclear cells of neonates, we performed sequential PCR analyses of blood samples (not cord blood) obtained from 41 infants in the first month of life. The infants had no evidence of acute HHV-6 infection, and the samples were analyzed over an average period of 8 months (range, 2 to 32). Twelve neonates (29 percent) were positive by PCR. Six of them were shown during follow-up to have acquired primary HHV-6 infection subsequently. Five of the others became negative by PCR, and the sixth remained positive without evidence of acquiring infection. Of the 29 infants initially negative by PCR, 14 acquired primary HHV-6 infection during the follow-up period.
Discussion
HHV-6 infection is ubiquitous in young children and results in an appreciable burden on our health care resources. It accounted for 10 percent of visits to the emergency department for acute febrile illness among children in the first 2 years of life, and for 20 percent of such visits among those 6 to 12 months old. Its protean manifestations and the lack of means of diagnosis often resulted in lengthy and costly evaluations and hospitalizations. The actual human and financial costs, however, cannot be estimated without a better understanding of the spectrum and consequences of HHV-6 infection.
Although we could not detect HHV-6 viremia in any of the 582 children with afebrile conditions or in the 352 healthy controls, the frequency of mild or asymptomatic primary infection remains undefined and the sequelae of such infections remain unknown. Most initial HHV-6 infections in normal children are benign, although there are case reports of occasional complications, including thrombocytopenia, granulocytopenia, hepatitis, and disseminated infection26-29. The most common complications are central nervous system manifestations, as has been long suggested by reports associating roseola with seizures, bulging of the anterior fontanelle, meningoencephalitis, and encephalopathy4,26,30-34. HHV-6 accounted for one third of the febrile seizures evaluated in children two years of age or less in our emergency department. Seizures occurred in 19.4 percent of those 6 months or older and in 36 percent of those 12 to 15 months of age -- significantly more often than in age-matched children with febrile illnesses not due to HHV-6. The mechanism by which HHV-6 causes central nervous system manifestations remains unclear, but it may involve more than the high fevers. The lack of an inflammatory response in the cerebrospinal fluid samples from our children with or without seizures is noteworthy. However, we have detected HHV-6 DNA in the cerebrospinal fluid of children with past primary infection as well as in those with acute infection35,36. In several recent Japanese reports HHV-6 DNA was detected in the cerebrospinal fluid of infants with roseola complicated by neurologic symptoms and in eight patients with recurrent febrile convulsions37-39. These findings raise the possibility of direct invasion of the central nervous system during the viremic phase of the initial illness, with possible subsequent latency. One infant with fatal HHV-6-associated encephalitis, however, had HHV-6 DNA in cerebrospinal fluid but not in brain tissue40.
The potential of HHV-6 to become latent and to reactivate has been suggested by reports, mostly in adults, of increases in antibody levels during concurrent illnesses and by the recovery of virus from blood and respiratory secretions in previously infected immunocompromised patients5,13,41-46. In normal children there is little information on the potential of HHV-6 for latency and reactivation after primary infection. Our follow-up of children after primary infection indicates that the HHV-6 genome persists in the majority for months. Whether this is persistence rather than true latency is unclear. Few of these normal children had evidence to suggest subsequent reactivation. The apparent reappearance of HHV-6 in the blood mononuclear cells could be a consequence of our technical ability to detect the genome at low levels, although all PCR results were confirmed by repeat testing. The results of the serial antibody measurements also suggest that persistent virus may occasionally be restimulated under certain conditions, even in normal children. Another possibility, however, is reinfection with another strain.
Viremia was detected only during primary HHV-6 illness and not during follow-up or in the 2235 children with other acute illnesses. Although reactivation of HHV-6 with viremia was reported in three Japanese children convalescing from measles,47 we could not show that subsequent illnesses engendered a reactivation with viremia. Measles was not among the acute febrile illnesses in our population, but in normal children HHV-6 viremia appears to be rare, even with subsequent febrile illness. Nevertheless, the diagnosis of primary HHV-6 infection should probably not be based on the presence of viremia alone. Diagnosis based on seroconversion alone is even less reliable, considering the number of children who after seroconversion from primary infection had a second fourfold increase in titers. Even IgM antibody may be present during reactivation and in 4 to 5 percent of normal adolescents and adults48.
Classic descriptions of roseola have noted that it characteristically occurs between six months and three years of age, and rarely in the first few months of life, presumably because of protection by maternal antibody23,24,49,50. An appreciable proportion of the primary infections documented in our study occurred in the first months of life; 19 percent of infants were 4 months old or less, and 13 percent were under 2 months, including one 14-day-old. That maternal antibody was present at the time of these acute infections suggests that passive antibody is not uniformly protective. The level of maternal antibody may partly determine the degree and durability of protection and thus the age at which infection occurs. Our infants who acquired their infections in the first months of life had lower mean antibody titers than infants of similar age who were not yet infected. Alternatively, infection in young infants may be acquired from the mother before or during birth or through breast-feeding. The youngest infant previously described to have virologically confirmed infection was 21 days old, and perinatal transmission was questioned but not confirmed51. However, specific IgM antibody has been detected in 2 of 799 samples of cord blood, but HHV-6 DNA was not detected concurrently52. HHV-6 DNA has been detected, however, in one fetus of a mother with human immunodeficiency virus infection,53 suggesting potential intrauterine transmission with compromised maternal immunity. The absence of HHV-6 DNA in samples of breast milk suggests that breast-feeding is not a major mode of transmission54.
Primary infection is most likely acquired by contact with HHV-6 silently shed in secretions of caretakers once the level of passive maternal antibody has declined5,23,24. Vertical transmission also appears plausible, considering the frequency of viremia in our young infants and that of HHV-6 DNA in blood mononuclear cells. The import of these findings and the effect on the infant's subsequent immunity remain uncertain. Many neonates with HHV-6 DNA in their blood mononuclear cells appeared to have HHV-6 only transiently, and protection against subsequent primary infection did not necessarily result. These findings could support several hypotheses. The presence of the HHV-6 genome in the infant's mononuclear cells during the neonatal period indicates intrauterine or perinatal transmission of maternally reactivated HHV-6, which in the face of adequate levels of maternal antibody may become an “aborted infection” without immunologic memory. Alternatively or in addition, perinatal or neonatal acquisition of HHV-6 could lead to an altered immunologic response to HHV-6 or to an increased risk of latency.
Supported by a grant (R01 AI33020-02) from the National Institute of Allergy and Infectious Diseases and in part by a grant (5-MO1-RR-000-44) to the General Clinical Research Center of the University of Rochester from the National Center for Research Resources, National Institutes of Health.
We are indebted to Bruce P. Lanphear, M.D., M.P.H., and to Richard F. Raubertas, Ph.D., for their excellent review of the manuscript.
Source Information
From the Departments of Pediatrics (C.B.H., K.C.S., M.T.C., K.M.M., M.A.C., A.K., R.A.I., L.G.E.), Medicine (C.B.H., C.E.L.), Microbiology and Immunology (S.D., L.G.E.), and Neurology (L.G.E.), University of Rochester School of Medicine and Dentistry, Rochester, N.Y.
- References
References
1
Salahuddin SZ ,Ablashi DV ,Markham PD , et al. Isolation of a new virus, HBLV, in patients with lymphoproliferative disorders. Science 1986;234:596-601
CrossRef | Web of Science | Medline2
Yamanishi K ,Okuno T ,Shiraki K , et al. Identification of human herpesvirus-6 as a causal agent for exanthem subitum. Lancet 1988;1:1065-1067
CrossRef | Web of Science | Medline3
Okada K ,Ueda K ,Kusuhara K , et al. Exanthema subitum and human herpesvirus 6 infection: clinical observations in fifty-seven cases. Pediatr Infect Dis J 1993;12:204-208
CrossRef | Web of Science | Medline4
Asano Y ,Nakashima T ,Yoshikawa T ,Suga S ,Yazaki T . Severity of human herpesvirus-6 viremia and clinical findings in infants with exanthem subitum. J Pediatr 1991;118:891-895
CrossRef | Web of Science | Medline5
Yamanishi K . Human herpesvirus 6. Microbiol Immunol 1992;36:551-561
Web of Science | Medline6
Yanagi K ,Harada S ,Ban F ,Oya A ,Okabe N ,Tobinai K . High prevalence of antibody to human herpesvirus-6 and decrease in titer with increase in age in Japan. J Infect Dis 1990;161:153-154
CrossRef | Web of Science | Medline7
Kusuhara K ,Ueda K ,Miyazaki C ,Okada K ,Tokugawa K . Attack rate of exanthem subitum in Japan. Lancet 1992;340:482-482
CrossRef | Web of Science | Medline8
Ablashi DV ,Salahuddin SZ ,Josephs SF ,Balachandran N ,Krueger GR ,Gallo RC . Human herpesvirus-6 (HHV-6). In Vivo 1991;5:193-199
Medline9
Enders G ,Biber M ,Meyer G ,Helftenbein E . Prevalence of antibodies to human herpesvirus 6 in different age groups, in children with exanthema subitum, other acute exanthematous childhood diseases, Kawasaki syndrome, and acute infections with other herpesviruses and HIV. Infection 1990;18:12-15
CrossRef | Web of Science | Medline10
Huang L-M ,Lee C-Y ,Chen J-Y , et al. Primary human herpesvirus 6 infections in children: a prospective serologic study. J Infect Dis 1992;165:1163-1164
CrossRef | Web of Science | Medline11
Linnavuori K ,Peltola H ,Hovi T . Serology versus clinical signs or symptoms and main laboratory findings in the diagnosis of exanthema subitum (roseola infantum). Pediatrics 1992;89:103-106
Web of Science | Medline12
Portolani M ,Cermelli C ,Moroni A , et al. Human herpesvirus-6 infections in infants admitted to hospital. J Med Virol 1993;39:146-151
CrossRef | Web of Science | Medline13
Chou S . Human herpesvirus 6 infection and associated disease. J Lab Clin Med 1993;121:388-393
Medline14
Pruksananonda P ,Hall CB ,Insel RA , et al. Primary human herpesvirus 6 infection in young children. N Engl J Med 1992;326:1445-1450
Free Full Text | Web of Science | Medline15
Pellett PE ,Lindquester GJ ,Feorino P ,Lopez C . Genomic heterogeneity of human herpesvirus 6 isolates. Adv Exp Med Biol 1990;278:9-18
Web of Science | Medline16
Dewhurst S ,Chandran B ,McIntyre K ,Schnabel K ,Hall CB . Phenotypic and genetic polymorphisms among human herpesvirus-6 isolates from North American infants. Virology 1992;190:490-493
CrossRef | Web of Science | Medline17
Dewhurst S ,McIntyre K ,Schnabel K ,Hall CB . Human herpesvirus 6 (HHV-6) variant B accounts for the majority of symptomatic primary HHV-6 infections in a population of U.S. infants. J Clin Microbiol 1993;31:416-418
Web of Science | Medline18
Chandran B ,Tirawatnapong S ,Pfeiffer B ,Ablashi DV . Antigenic relationships among human herpesvirus-6 isolates. J Med Virol 1992;37:247-254
CrossRef | Web of Science | Medline19
Pellett PE ,Sanchez-Martinez D ,Dominguez G , et al. A strongly immunoreactive virion protein of human herpesvirus 6 variant B strain Z29: identification and characterization of the gene and mapping of a variant-specific monoclonal antibody reactive epitope. Virology 1993;195:521-531
CrossRef | Web of Science | Medline20
Efstathiou S ,Lawrence GL ,Brown CM ,Barrell BG . Identification of homologues to the human cytomegalovirus US22 gene family in human herpesvirus 6. J Gen Virol 1992;73:1661-1671
CrossRef | Web of Science | Medline21
Saiki RK ,Gelfand DH ,Stoffel S , et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 1988;239:487-491
CrossRef | Web of Science | Medline22
Dean AD, Dean JA, Burton JH, Dicker RC. Epi Info, version 5: a word processing, database, and statistics program for epidemiology on microcomputers. Atlanta: Centers for Disease Control, 1990.
23
Breese BB Jr . Roseola infantum (exanthem subitum). N Y State J Med 1941;41:1854-185924
Kempe CH ,Shaw EB ,Jackson JR ,Silver HK . Studies of the etiology of exanthema subitum (roseola infantum). J Pediatr 1950;37:561-568
CrossRef | Web of Science | Medline25
Clemens HH . Exanthem subitum (roseola infantum). J Pediatr 1945;26:66-77
CrossRef | Web of Science26
Huang LM ,Lee CY ,Chen JY , et al. Roseola infantum caused by human herpesvirus-6: report of 7 cases with emphasis on complications. J Formos Med Assoc 1991;90:579-582
Medline27
Takikawa T ,Hayashibara H ,Harada Y ,Shiraki K . Liver dysfunction, anaemia, and granulocytopenia after exanthema subitum. Lancet 1992;340:1288-1289
CrossRef | Web of Science | Medline28
Asano Y ,Yoshikawa T ,Suga S ,Yazaki T ,Kondo K ,Yamanishi K . Fatal fulminant hepatitis in an infant with human herpesvirus-6 infection. Lancet 1990;335:862-863
CrossRef | Web of Science | Medline29
Prezioso PJ ,Cangiarella J ,Lee M , et al. Fatal disseminated infection with human herpesvirus-6. J Pediatr 1992;120:921-923
CrossRef | Web of Science | Medline30
Berenberg W ,Wright S ,Janeway CA . Roseola infantum (exanthem subitum). N Engl J Med 1949;241:253-259
Full Text | Web of Science | Medline31
Burnstine RC ,Paine RS . Residual encephalopathy following roseola infantum. Am J Dis Child 1959;98:144-152
Web of Science32
Moller KL . Exanthema subitum and febrile convulsions. Acta Paediatr 1956;45:534-540
CrossRef | Medline33
Posson DD . Exanthem subitum (roseola infantum) complicated by prolonged convulsions and hemiplegia. J Pediatr 1949;35:235-236
CrossRef | Web of Science | Medline34
Ishiguro N ,Yamada S ,Takahashi T , et al. Meningo-encephalitis associated with HHV-6 related exanthem subitum. Acta Paediatr Scand 1990;79:987-989
CrossRef | Web of Science | Medline35
Hall CB ,Pruksananonda P ,Insel RA , et al. Human herpes virus 6 (HHV-6) infection in children. Pediatr Res 1991;29:Suppl:173A-173A abstract.
Web of Science36
Caserta MT ,Schnabel KS ,McIntyre KM ,Costanzo M ,Hall CB . Central nervous system persistence of human herpesvirus 6 (HHV-6). Clin Infect Dis 1993;17:557-557 abstract.37
Yoshikawa T ,Nakashima T ,Suga S , et al. Human herpesvirus-6 DNA in cerebrospinal fluid of a child with exanthem subitum and meningoencephalitis. Pediatrics 1992;89:888-890
Web of Science | Medline38
Kondo K ,Nagafuji H ,Hata A ,Tomomori C ,Yamanishi K . Association of human herpesvirus 6 infection of the central nervous system with recurrence of febrile convulsions. J Infect Dis 1993;167:1197-1200
CrossRef | Web of Science | Medline39
Suga S ,Yoshikawa T ,Asano Y , et al. Clinical and virological analyses of 21 infants with exanthem subitum (roseola infantum) and central nervous system complications. Ann Neurol 1993;33:597-603
CrossRef | Web of Science | Medline40
Asano Y ,Yoshikawa T ,Kajita Y , et al. Fatal encephalitis/encephalopathy in primary human herpesvirus-6 infection. Arch Dis Child 1992;67:1484-1485
CrossRef | Web of Science | Medline41
Yoshikawa T ,Suga S ,Asano Y , et al. Human herpesvirus-6 infection in bone marrow transplantation. Blood 1991;78:1381-1384
Web of Science | Medline42
Cone RW ,Hackman RC ,Huang M-LW , et al. Human herpesvirus 6 in lung tissue from patients with pneumonitis after bone marrow transplantation. N Engl J Med 1993;329:156-161
Free Full Text | Web of Science | Medline43
Pellett PE ,Black JB ,Yamamoto M . Human herpesvirus 6: the virus and the search for its role as a human pathogen. Adv Virus Res 1992;41:1-52
CrossRef | Web of Science | Medline44
Caserta MT ,Hall CB . Human herpesvirus-6. Annu Rev Med 1993;44:377-383
CrossRef | Web of Science | Medline45
Drobyski WR ,Dunne WM ,Burd EM , et al. Human herpesvirus-6 (HHV-6) infection in allogeneic bone marrow transplant recipients: evidence of a marrow-suppressive role for HHV-6 in vivo. J Infect Dis 1993;167:735-739
CrossRef | Web of Science | Medline46
Asano Y ,Yoshikawa T ,Suga S , et al. Reactivation of herpesvirus type 6 in children receiving bone marrow transplants for leukemia. N Engl J Med 1991;324:634-635
Web of Science | Medline47
Suga S ,Yoshikawa T ,Asano Y ,Nakashima T ,Kobayashi I ,Yazaki T . Activation of human herpesvirus-6 in children with acute measles. J Med Virol 1992;38:278-282
CrossRef | Web of Science | Medline48
Suga S ,Yoshikawa T ,Asano Y , et al. IgM neutralizing antibody responses to human herpesvirus-6 in patients with exanthem subitum or organ transplantation. Microbiol Immunol 1992;36:495-506
Web of Science | Medline49
Cherry JD. Roseola infantum (exanthem subitum). In: Feigin RD, Cherry JD, eds. Textbook of pediatric infectious diseases. 3rd ed. Vol. 2. Philadelphia: W.B. Saunders, 1992:1789-92.
50
Yoshikawa T ,Suga S ,Asano Y ,Yazaki T ,Ozaki T . Neutralizing antibodies to human herpesvirus-6 in healthy individuals. Pediatr Infect Dis J 1990;9:589-590
CrossRef | Web of Science | Medline51
Kawaguchi S ,Suga S ,Kozawa T ,Nakashima T ,Yoshikawa T ,Asano Y . Primary human herpesvirus-6 infection (exanthem subitum) in the newborn. Pediatrics 1992;90:628-630
Web of Science | Medline52
Dunne WM Jr ,Demmler GJ . Serological evidence for congenital transmission of human herpesvirus 6. Lancet 1992;340:121-122
Web of Science | Medline53
Aubin J-T ,Poirel L ,Agut H , et al. Intrauterine transmission of human herpesvirus 6. Lancet 1992;340:482-483
CrossRef | Web of Science | Medline54
Dunne WM Jr ,Jevon M . Examination of human breast milk for evidence of human herpesvirus 6 by polymerase chain reaction. J Infect Dis 1993;168:250-250
CrossRef | Web of Science | Medline
- Citing Articles (208)
Citing Articles
1
D. J. Clark, J. Catusse, A. Stacey, P. Borrow, U. A. Gompels. (2013) Activation of CCR2+ human proinflammatory monocytes by human herpesvirus-6B chemokine N-terminal peptide. Journal of General Virology 94:Pt_7, 1624-1635
2
Katherine N Ward. Human Herpesviruses-6 and -7 (HHV-6A, HHV-6B and HHV-7). In: eLS. John Wiley & Sons, Ltd, 2013.
3
Anoop S. Pulickal, Simi Ramachandran, Philippe Rizek, Pramod Narula, Romaine Schubert. (2013) Chorea and Developmental Regression Associated With Human Herpes Virus-6 Encephalitis. Pediatric Neurology 48:3, 249-251
4
J. Le, S. Gantt, . (2013) Human Herpesvirus 6, 7 and 8 in Solid Organ Transplantation. American Journal of Transplantation 13:s4, 128-137
5
Marie Studahl, Lars Lindquist, Britt-Marie Eriksson, Göran Günther, Malin Bengner, Elisabeth Franzen-Röhl, Jan Fohlman, Tomas Bergström, Elisabeth Aurelius. (2013) Acute Viral Infections of the Central Nervous System in Immunocompetent Adults: Diagnosis and Management. Drugs 73:2, 131-158
6
Giulia Cassina, Domenico Russo, Davide De Battista, Francesco Broccolo, Paolo Lusso, Mauro S. Malnati. (2013) Calibrated real-time polymerase chain reaction for specific quantitation of HHV-6A and HHV-6B in clinical samples. Journal of Virological Methods
7
Joséphine M. Reynaud, Branka Horvat. (2013) Human Herpesvirus 6 and Neuroinflammation. ISRN Virology 2013, 1-11
8
Benedict D. Michael, Tom Solomon. (2012) Seizures and encephalitis: Clinical features, management, and potential pathophysiologic mechanisms. Epilepsia 53, 63-71
9
Leon G. Epstein, Shlomo Shinnar, Dale C. Hesdorffer, Douglas R. Nordli, Aaliyah Hamidullah, Emma K. T. Benn, John M. Pellock, L. Matthew Frank, Darrell V. Lewis, Solomon L. Moshe, Ruth C. Shinnar, Shumei Sun, . (2012) Human herpesvirus 6 and 7 in febrile status epilepticus: The FEBSTAT study. Epilepsiano-no
10
Irmeli Lautenschlager, Raymund R. Razonable. (2012) Human herpesvirus-6 infections in kidney, liver, lung, and heart transplantation: review. Transplant International 25:5, 493-502
11
Jordi Carratalà, Miguel Montejo, Pilar Pérez-Romero. (2012) Infections caused by herpes viruses other than cytomegalovirus in solid organ transplant recipients. Enfermedades Infecciosas y Microbiología Clínica 30, 63-69
12
Titilayo Oluwabusi, Sunil K. Sood. (2012) Update on the management of simple febrile seizures. Current Opinion in Pediatrics1
13
Teemu Karlsson, Laura Mannonen, Raisa Loginov, Maija Lappalainen, Krister Höckerstedt, Irmeli Lautenschlager. (2012) Development of a new quantitative real-time HHV-6-PCR and monitoring of HHV-6 DNAaemia after liver transplantation. Journal of Virological Methods
14
James F. Bale. Viral Infections of the Nervous System. In: Swaiman's Pediatric Neurology. Elsevier, 2012:1262-1290.
15
Shlomo Shinnar. Febrile Seizures. In: Swaiman's Pediatric Neurology. Elsevier, 2012:790-797.
16
Mundeep K. Kainth, Mary T. Caserta. (2011) Molecular Diagnostic Tests for Human Herpesvirus 6. The Pediatric Infectious Disease Journal 30:8, 701-702
17
Mundeep K. Kainth, Mary T. Caserta. (2011) Molecular Diagnostic Tests For Human Herpesvirus 6. The Pediatric Infectious Disease Journal 30:7, 604-605
18
J. G. Millichap. (2011) Outcome of 1st Seizure After Nonfebrile Acute GI Illness. AAP Grand Rounds 25:3, 25-25
19
Jin-Mei Li, Ding Lei, Fang Peng, Yi-Jun Zeng, Liang Li, Zeng-Liang Xia, Xiao-Qiang Xia, Dong Zhou. (2011) Detection of human herpes virus 6B in patients with mesial temporal lobe epilepsy in West China and the possible association with elevated NF-κB expression. Epilepsy Research 94:1-2, 1-9
20
Jieun Choi, Hyun Jin Min, Jeon-Soo Shin. (2011) Increased levels of HMGB1 and pro-inflammatory cytokines in children with febrile seizures. Journal of Neuroinflammation 8:1, 135
21
Amy S. Paller, Anthony J. Mancini. Exanthematous Diseases of Childhood. In: Hurwitz Clinical Pediatric Dermatology. Elsevier, 2011:370-389.
22
Carrie L. Byington, Jeremy Kendrick, Xiaoming Sheng. (2011) Normative Cerebrospinal Fluid Profiles in Febrile Infants. The Journal of Pediatrics 158:1, 130-134
23
Mary T. Caserta. Roseola (Human Herpes Viruses 6 and 7). In: Nelson Textbook of Pediatrics. Elsevier, 2011:1117-1120.
24
Pitt Niehusmann, Tobias Mittelstaedt, Christian G. Bien, Jan F. Drexler, Alexander Grote, Susanne Schoch, Albert J. Becker. (2010) Presence of human herpes virus 6 DNA exclusively in temporal lobe epilepsy brain tissue of patients with history of encephalitis. Epilepsia 51:12, 2478-2483
25
Joseph M Lam. (2010) Characterizing viral exanthems. Pediatric Health 4:6, 623-635
26
Carolus Schenke, Miguel A Alejandre-Alcázar, Wolfgang Holter, Klaus Korn, Thomas Papadopoulos, Henrik Köhler. (2010) Aplastic Anemia Following Hepatitis Associated With Human Herpesvirus 6. Journal of Pediatric Gastroenterology and Nutrition 51:4, 527-529
27
Karen Yao, John R. Crawford, Anthony L. Komaroff, Dharam V. Ablashi, Steven Jacobson. (2010) Review part 2: Human herpesvirus-6 in central nervous system diseases. Journal of Medical Virology 82:10, 1669-1678
28
Robert Saddawi-Konefka, John R. Crawford. (2010) Chronic Viral Infection and Primary Central Nervous System Malignancy. Journal of Neuroimmune Pharmacology 5:3, 387-403
29
Saba Ahmad, Eric D. Marsh. (2010) Febrile Status Epilepticus: Current State of Clinical and Basic Research. Seminars in Pediatric Neurology 17:3, 150-154
30
Sung-Hwan Kim, Hyun-Young Lee, Yeun-Hee Kim. (2010) Subsequent Afebrile Seizure in Children Who Have a First Seizure With Fever After 6 Years of Age. Pediatric Neurology 43:2, 122-126
31
Huamin Tang, Yasuko Mori. (2010) Human herpesvirus-6 entry into host cells. Future Microbiology 5:7, 1015-1023
32
Mary T. Caserta, Caroline Breese Hall, Kenneth Schnabel, Geraldine Lofthus, Andrea Marino, Lynne Shelley, Christina Yoo, Jennifer Carnahan, Linda Anderson, Hongyue Wang. (2010) Diagnostic assays for active infection with human herpesvirus 6 (HHV-6). Journal of Clinical Virology 48:1, 55-57
33
J. C. Sterling. Virus Infections. In: Rook's Textbook of Dermatology. Wiley-Blackwell, 2010:1-81.
34
William J. Britt. Betaherpesviruses: Cytomegalovirus, Human Herpesviruses 6 and 7. In: Topley & Wilson's Microbiology and Microbial Infections. John Wiley & Sons, Ltd, 2010.
35
Dean D. Erdman. Propagation and Identification of Viruses. In: Topley & Wilson's Microbiology and Microbial Infections. John Wiley & Sons, Ltd, 2010.
36
Danielle M Zerr. Common Viral Infections of Childhood. Informa Healthcare, 2010:226-245.
37
Ioanna Laina, Vassiliki P. Syriopoulou, George L. Daikos, Eleftheria S. Roma, Foteini Papageorgiou, Talia Kakourou, Maria Theodoridou. (2010) Febrile Seizures and Primary Human Herpesvirus 6 Infection. Pediatric Neurology 42:1, 28-31
38
Huamin TANG, Tomohiko SADAOKA, Yasuko MORI. (2010) Human herpesvirus-6 and human herpesvirus-7 (HHV-6, HHV-7). Uirusu 60:2, 221-236
39
Tenagne Haile-Mariam, Michael Alan Polis. Viral Illnesses. In: Rosen's Emergency Medicine – Concepts and Clinical Practice. Elsevier, 2010:1700-1722.
40
TARA N. PALMORE, DAVID K. HENDERSON. Nosocomial Herpesvirus Infections. In: Mandell, Douglas, and Bennett's Principles and Practice of Infectious Diseases. Elsevier, 2010:3771-3780.
41
JEFFREY I. COHEN. Human Herpesvirus Types 6 and 7. In: Mandell, Douglas, and Bennett's Principles and Practice of Infectious Diseases. Elsevier, 2010:2011-2015.
42
R. R. Razonable, D. M. Zerr, . (2009) HHV-6, HHV-7 and HHV-8 in Solid Organ Transplant Recipients. American Journal of Transplantation 9, S97-S100
43
E. H. Tsao, P. Kellam, C. S. Y. Sin, J. Rasaiyaah, P. D. Griffiths, D. A. Clark. (2009) Microarray-based determination of the lytic cascade of human herpesvirus 6B. Journal of General Virology 90:11, 2581-2591
44
Tetsushi Yoshikawa, Masahiro Ohashi, Fumi Miyake, Ayano Fujita, Chie Usui, Ken Sugata, Sadao Suga, Shuji Hashimoto, Yoshizo Asano. (2009) Exanthem Subitum-Associated Encephalitis: Nationwide Survey in Japan. Pediatric Neurology 41:5, 353-358
45
V. Zawar, R. Kumar. (2009) Multiple recurrences of pityriasis rosea of Vidal: a novel presentation. Clinical and Experimental Dermatology 34:5, e114-e116
46
Matthew Bates, Mwaka Monze, Humphrey Bima, Mirriam Kapambwe, David Clark, Francis C. Kasolo, Ursula A. Gompels. (2009) Predominant human herpesvirus 6 variant A infant infections in an HIV-1 endemic region of Sub-Saharan Africa. Journal of Medical Virology 81:5, 779-789
47
Katherine N Ward. (2009) Unique route for human herpesvirus transmission: HHV-6 and chromosomal integration. Future Virology 4:3, 221-224
48
Marije P. Hennus, Joris M. van Montfrans, Adrianus J. van Vught, Kiki Tesselaar, Jaap-Jan Boelens, Nicolaas J. Jansen. (2009) Life-threatening human herpes virus-6 infection in early childhood: Presenting symptom of a primary immunodeficiency?. Pediatric Critical Care Medicine 10:2, e16-e18
49
Marylou V. Solbrig. (2009) Diagnosing encephalitis? Consider human herpesvirus type 6. Annals of Neurology 65:3, 235-237
50
Jae Won Moon, Jang Hee Kang, Hyun Ji Kim, Soon Ok Byun. (2009) Risk factor of influenza virus infection to febrile convulsions and recurrent febrile convulsions in children. Korean Journal of Pediatrics 52:7, 785
51
Svetlana Kozireva, Dmitrijs Užameckis, Mihails Bariševs, Modra Murovska. (2009) Sensitivity and Reproducibility of Polymerase Chain Reaction Assays for Detection of Human Herpesviruses 6 and 7. Proceedings of the Latvian Academy of Sciences. Section B. Natural, Exact, and Applied Sciences. 63:4, 180-185
52
Kaoru Wada, Sachiko Mizoguchi, Yoshinori Ito, Jun-ichi Kawada, Yohei Yamauchi, Tsuneo Morishima, Yukihiro Nishiyama, Hiroshi Kimura. (2009) Multiplex real-time PCR for the simultaneous detection of herpes simplex virus, human herpesvirus 6, and human herpesvirus 7. Microbiology and Immunology 53:1, 22-29
53
Mark R. Schleiss. (2009) Persistent and Recurring Viral Infections: The Human Herpesviruses. Current Problems in Pediatric and Adolescent Health Care 39:1, 7-23
54
H. Agut, A. Gautheret-Dejean, D. Boutolleau, P. Bonnafous. (2009) Infections à herpèsvirus humains 6 et 7. EMC - Maladies infectieuses 6:4, 1-5
55
John J. Millichap, J. Gordon Millichap. (2008) Methods of Investigation and Management of Infections Causing Febrile Seizures. Pediatric Neurology 39:6, 381-386
56
Renata Artimos de Oliveira Vianna, Marilda Mendonça Siqueira, Luiz Antonio Bastos Camacho, Sérgio Setúbal, Wendy Knowles, David W. Brown, Solange Artimos de Oliveira. (2008) The accuracy of anti-human herpesvirus 6 IgM detection in children with recent primary infection. Journal of Virological Methods 153:2, 273-275
57
William H. Theodore, Leon Epstein, William D. Gaillard, Shlomo Shinnar, Mark S. Wainwright, Steven Jacobson. (2008) Human herpes virus 6B: A possible role in epilepsy?. Epilepsia 49:11, 1828-1837
58
Mary T. Caserta, Thomas G. O’Connor, Peter A. Wyman, Hongyue Wang, Jan Moynihan, Wendi Cross, Xin Tu, Xia Jin. (2008) The associations between psychosocial stress and the frequency of illness, and innate and adaptive immune function in children. Brain, Behavior, and Immunity 22:6, 933-940
59
Benjamin E. Gewurz, Francisco M. Marty, Lindsey R. Baden, Joel T. Katz. (2008) Human herpesvirus 6 encephalitis. Current Infectious Disease Reports 10:4, 292-299
60
Laurent Chevret, David Boutolleau, Nadia Halimi-Idri, Sophie Branchereau, Catherine Baujard, Monique Fabre, Agnès Gautheret-Dejean, Dominique Debray. (2008) Human herpesvirus-6 infection: A prospective study evaluating HHV-6 DNA levels in liver from children with acute liver failure. Journal of Medical Virology 80:6, 1051-1057
61
Francesco Drago, Francesco Broccolo, Elisa Zaccaria, Mauro Malnati, Clementina Cocuzza, Paolo Lusso, Alfredo Rebora. (2008) Pregnancy outcome in patients with pityriasis rosea. Journal of the American Academy of Dermatology 58:5, S78-S83
62
Jacques De Keyser, Jop P. Mostert, Marcus W. Koch. (2008) Dysfunctional astrocytes as key players in the pathogenesis of central nervous system disorders. Journal of the Neurological Sciences 267:1-2, 3-16
63
Stephanie Yee-Guardino. (2008) Beta-Herpesviruses in Febrile Children with Cancer. Emerging Infectious Diseases 14:4, 579-585
64
Jieun Choi, Sookyong Koh. (2008) Role of Brain Inflammation in Epileptogenesis. Yonsei Medical Journal 49:1, 1
65
Craig M. Wilson, David O. Freedman. Antiparasitic Agents. In: Principles and Practice of Pediatric Infectious Disease. Elsevier, 2008:1488-1506.
66
Antonio E. Muñiz. Classic Viral Exanthems. In: Pediatric Emergency Medicine. Elsevier, 2008:846-858.
67
Arne Fetveit. (2007) Assessment of febrile seizures in children. European Journal of Pediatrics 167:1, 17-27
68
M. T. Caserta, C. B. Hall, K. Schnabel, G. Lofthus, M. P. McDermott. (2007) Human Herpesvirus (HHV)-6 and HHV-7 Infections in Pregnant Women. Journal of Infectious Diseases 196:9, 1296-1303
69
Christopher Hurt, Dominick Tammaro. (2007) Diagnostic Evaluation of Mononucleosis-Like Illnesses. The American Journal of Medicine 120:10, 911.e1-911.e8
70
Henry J. Baskin, Gary Hedlund. (2007) Neuroimaging of herpesvirus infections in children. Pediatric Radiology 37:10, 949-963
71
Laura Mannonen, Eila Herrgård, Pekka Valmari, Paula Rautiainen, Kari Uotila, Marjo-Riitta Aine, Pirkko Karttunen-Lewandowski, Juhani Sankala, Tiina Wallden, Marjaleena Koskiniemi. (2007) Primary Human Herpesvirus-6 Infection in the Central Nervous System Can Cause Severe Disease. Pediatric Neurology 37:3, 186-191
72
Guntram Bezold, Joseph A. Politch, Nancy B. Kiviat, Jane M. Kuypers, Hans Wolff, Deborah J. Anderson. (2007) Prevalence of sexually transmissible pathogens in semen from asymptomatic male infertility patients with and without leukocytospermia. Fertility and Sterility 87:5, 1087-1097
73
A. C. Rentz, J. Stevenson, W. Hymas, D. Hillyard, G. J. Stoddard, E. W. Taggart, C. L. Byington. (2007) Human herpesvirus 6 in the newborn intensive care unit. European Journal of Clinical Microbiology & Infectious Diseases 26:4, 297-299
74
Hoe Nam Leong, Philip W. Tuke, Richard S. Tedder, Aysha Begum Khanom, Roger P. Eglin, Claire E. Atkinson, Katherine N. Ward, Paul D. Griffiths, Duncan A. Clark. (2007) The prevalence of chromosomally integrated human herpesvirus 6 genomes in the blood of UK blood donors. Journal of Medical Virology 79:1, 45-51
75
Ricardo García-Muñoz, Alicia Galar, Cristina Moreno, Paula Rodríguez-Otero, Elena Panizo-Morgado, Mariano Ponz-Sarvisê, Mirian Fernandez-Alonso, Manuel Rubio, Juana Merino, Braulia Cuesta, Carlos Panizol, Felipe Prosper. (2007) Parvovirus B19 acute infection and a reactivation of cytomegalovirus and herpesvirus 6 in a chronic myeloid leukemia patient during treatment with dasatinib (BMS-354825). Leukemia & Lymphoma 48:12, 2461-2464
76
Mary T. Caserta. Human Herpesvirus 6 Infection & Roseola. In: Pediatric Clinical Advisor. Elsevier, 2007:280.
77
Karen L. Roos. Viral Infections. In: Textbook of Clinical Neurology. Elsevier, 2007:919-942.
78
Karen L. Kwong, Shu Y. Lam, Tak L. Que, Sik N. Wong. (2006) Influenza A and Febrile Seizures in Childhood. Pediatric Neurology 35:6, 395-399
79
Eszter Csoma, Tamás Deli, József Kónya, László Csernoch, Zoltán Beck, Lajos Gergely. (2006) Human herpesvirus 6A decreases the susceptibility of macrophages to R5 variants of human immunodeficiency virus 1: Possible role of RANTES and IL-8. Virus Research 121:2, 161-168
80
Jodi M. Smith, Ruth A. McDonald. (2006) Emerging viral infections in transplantation. Pediatric Transplantation 10:7, 838-843
81
Sandrine Kagialis-Girard, Brigitte Durand, Valérie Mialou, Marie-Pierre Pagès, Claire Galambrun, Yves Bertrand, Claude Negrier. (2006) Human herpesvirus 6 infection and transient acquired myelodysplasia in children. Pediatric Blood & Cancer 47:5, 543-548
82
H ENOKI, S TAKEDA, R MATSUBAYASHI, T MATSUBAYASHI. (2006) Steroid therapy in an infant with human herpesvirus 6 encephalopathy. Brain and Development 28:9, 597-599
83
Danielle M. Zerr, Lisa M. Frenkel, Meei-Li Huang, Margaret Rhoads, Long Nguy, Mark A. Del Beccaro, Lawrence Corey. (2006) Polymerase chain reaction diagnosis of primary human herpesvirus-6 infection in the acute care setting. The Journal of Pediatrics 149:4, 480-485
84
David Boutolleau, Caroline Duros, Pascale Bonnafous, Delphine Caïola, Alexandre Karras, Nathalie De Castro, Marie Ouachée, Philippe Narcy, Marie Gueudin, Henri Agut, Agnès Gautheret-Dejean. (2006) Identification of human herpesvirus 6 variants A and B by primer-specific real-time PCR may help to revisit their respective role in pathology. Journal of Clinical Virology 35:3, 257-263
85
Michael P. Glotzbecker, John P. Dormans, Bruce R. Pawel, Brian P. Wills, Yagnya Joshi, Michael Elkan, Richard L. Hodinka. (2006) Langerhans cell histiocytosis and human herpes virus 6 (HHV-6), an analysis by real-time polymerase chain reaction. Journal of Orthopaedic Research 24:3, 313-320
86
Elisabetta Caselli, Arianna Bracci, Monica Galvan, Michela Boni, Antonella Rotola, Carlo Bergamini, Claudio Cermelli, Paola Dal Monte, Ursula A. Gompels, Enzo Cassai, Dario Di Luca. (2006) Human herpesvirus 6 (HHV-6) U94/REP protein inhibits betaherpesvirus replication. Virology 346:2, 402-414
87
Samantha S. Soldan, Andrew D. Goodman, Steven Jacobson. HHV-6 and the Central Nervous System. Elsevier, 2006:213-223.
88
Henri Agut, Agnes Gautheret-Dejean. Serologic Testing for Acute and Chronic Infection. Elsevier, 2006:91-103.
89
Tetsushi Yoshikawa. HHV-6 and the Integument. Elsevier, 2006:163-171.
90
U.A. Gompels, F.C. Kasolo. HHV-6 Genome: Similar and Different. Elsevier, 2006:23-46.
91
Dharam V. Ablashi. Strain Variants of HHV-6. Elsevier, 2006:79-89.
92
Caroline Breese Hall. Epidemiology of HHV6. Elsevier, 2006:119-129.
93
Judith A. Britz. Human Herpesvirus-6 and the Cellular Immune System. Elsevier, 2006:201-212.
94
Gerhard R.F. Krueger, Brigitte Schneider. Pathologic Features of HHV-6 Disease. Elsevier, 2006:133-148.
95
Stephen Dewhurst, Birgit Bradel-Tretheway. Molecular Testing for HHV-6 Infection. Elsevier, 2006:105-117.
96
David Rekhtman, Eli M. Eisenstein. (2005) Glucocorticoids for Treatment of Severe Pediatric Drug Hypersensitivity Syndrome. Pediatric Asthma, Allergy & Immunology 18:3, 156-160
97
Katherine N. Ward, Anton D. Thiruchelvam, Xosé Couto-Parada. (2005) Unexpected occasional persistence of high levels of HHV-6 DNA in sera: Detection of variants A and B. Journal of Medical Virology 76:4, 563-570
98
Katherine N Ward. (2005) Human herpesviruses-6 and -7 infections. Current Opinion in Infectious Diseases 18:3, 247-252
99
R. J. Whitley, F. D. Lakeman. (2005) Human Herpesvirus 6 Infection of the Central Nervous System: Is It Just a Case of Mistaken Association?. Clinical Infectious Diseases 40:6, 894-895
100
K.N. Ward. (2005) The natural history and laboratory diagnosis of human herpesviruses-6 and -7 infections in the immunocompetent. Journal of Clinical Virology 32:3, 183-193
101
Zerr , Danielle M. , Meier , Amalia S. , Selke , Stacy S. , Frenkel , Lisa M. , Huang , Meei-Li , Wald , Anna , Rhoads , Margaret P. , Nguy , Long , Bornemann , Rena , Morrow , Rhoda Ashley , Corey , Lawrence , . (2005) A Population-Based Study of Primary Human Herpesvirus 6 Infection. New England Journal of Medicine 352:8, 768-776
Free Full Text102
Jenny Ahlqvist, Julie Fotheringham, Nahid Akhyani, Karen Yao, Anna Fogdell-Hahn, Steven Jacobson. (2005) Differential tropism of human herpesvirus 6 (HHV-6) variants and induction of latency by HHV-6A in oligodendrocytes. Journal of Neurovirology 11:4, 384-394
103
N. Nishimura, T. Yoshikawa, T. Ozaki, H. Sun, F. Goshima, Y. Nishiyama, Y. Asano, T. Kurata, T. Iwasaki. (2005) In vitro and in vivo analysis of human herpesvirus-6 U90 protein expression. Journal of Medical Virology 75:1, 86-92
104
Arun Chakrabarty, Karl Beutner. (2004) Therapy of other viral infections: herpes to hepatitis. Dermatologic Therapy 17:6, 465-490
105
Mary T. Caserta, Michael P. McDermott, Stephen Dewhurst, Kenneth Schnabel, Jennifer A. Carnahan, Lynne Gilbert, Gladys Lathan, Geraldine K. Lofthus, Caroline B. Hall. (2004) Human herpesvirus 6 (HHV6) DNA persistence and reactivation in healthy children. The Journal of Pediatrics 145:4, 478-484
106
Robert F. Pass. (2004) HHV6 and HHV7: Persistence and vertical transmission. The Journal of Pediatrics 145:4, 432-435
107
Caroline Breese Hall, Mary T. Caserta, Kenneth C. Schnabel, Christian Boettrich, Michael P. McDermott, Geraldine K. Lofthus, Jennifer A. Carnahan, Stephen Dewhurst. (2004) Congenital infections with human herpesvirus 6 (HHV6) and human herpesvirus 7 (HHV7). The Journal of Pediatrics 145:4, 472-477
108
G Bogdanovic, Å G Jernberg, P Priftakis, L Grillner, B Gustafsson. (2004) Human herpes virus 6 or Epstein–Barr virus were not detected in Guthrie cards from children who later developed leukaemia. British Journal of Cancer 91:5, 913-915
109
Asad Ansari, Shaobing Li, Mark J. Abzug, Adriana Weinberg. (2004) Human Herpesviruses 6 and 7 and Central Nervous System Infection in Children 1. Emerging Infectious Diseases 10:8, 1450-1454
110
Mary T. Caserta. (2004) Human herpesvirus 6 infection of the central nervous system. Current Infectious Disease Reports 6:4, 316-321
111
Keiko Tanaka-Taya, Junji Sashihara, Hiroki Kurahashi, Kiyoko Amo, Hiromi Miyagawa, Kazuhiro Kondo, Shintaro Okada, Koichi Yamanishi. (2004) Human herpesvirus 6 (HHV-6) is transmitted from parent to child in an integrated form and characterization of cases with chromosomally integrated HHV-6 DNA. Journal of Medical Virology 73:3, 465-473
112
Tetsushi Yoshikawa. (2004) Human herpesvirus 6 infection in hematopoietic stem cell transplant patients. British Journal of Haematology 124:4, 421-432
113
Nahed M. Abdel-Haq, Basim I. Asmar. (2004) Human herpesvirus 6 (HHV6) infection. The Indian Journal of Pediatrics 71:1, 89-96
114
Michael P. Glotzbecker, David F. Carpentieri, John P. Dormans. (2004) Langerhans Cell Histiocytosis: A Primary Viral Infection of Bone?. Journal of Pediatric Orthopaedics 24:1, 123-129
115
Michael P. Glotzbecker, David F. Carpentieri, John P. Dormans. (2004) Langerhans Cell Histiocytosis: A Primary Viral Infection of Bone?. Journal of Pediatric Orthopaedics123-129
116
Samantha S. Soldan, Steven Jacobson. Infection and Multiple Sclerosis. In: Infection and Autoimmunity. Elsevier, 2004:559-582.
117
Suzie Arsenault, Annie Gravel, Jean Gosselin, Louis Flamand. (2003) Generation and characterization of a monoclonal antibody specific for human herpesvirus 6 variant A immediate–early 2 protein. Journal of Clinical Virology 28:3, 284-290
118
M. Gupta, F. Diaz-Mitoma, J. Feber, L. Shaw, C. Forget, G. Filler. (2003) Tissue HHV6 and 7 determination in pediatric solid organ recipients − a pilot study. Pediatric Transplantation 7:6, 458-463
119
Michael Mayne, Steven Jacobson. Role of Human Herpesvirus Type 6 in Neurological Disease. In: Clinical Neurovirology. Informa Healthcare, 2003.
120
Dharam Ablashi, Gerhard Krueger. The Human Herpesviruses HHV-6, HHV-7 and HHV-8. In: Viral Infections and Treatment. CRC Press, 2003:659-705.
121
Marcello Lanari, Irene Papa, Valentina Venturi, Tiziana Lazzarotto, Giacomo Faldella, Liliana Gabrielli, Brunella Guerra, Maria Paola Landini, Gian Paolo Salvioli. (2003) Congenital infection with human herpesvirus 6 variant B associated with neonatal seizures and poor neurological outcome. Journal of Medical Virology 70:4, 628-632
122
Shlomo Shinnar. (2003) Febrile Seizures and Mesial Temporal Sclerosis. Epilepsy Currents 3:4, 115-118
123
Micheline McCarthy. (2003) Newer Viral Encephalitides. The Neurologist 9:4, 189-199
124
Ariel E. Feldstein, Raymund R. Razonable, Thomas G. Boyce, Deborah K. Freese, Mounif El-Youssef, Jean Perrault, Carlos V. Paya, Michael B. Ishitani. (2003) Prevalence and clinical significance of human herpesviruses 6 and 7 active infection in pediatric liver transplant patients. Pediatric Transplantation 7:2, 125-129
125
Delfina C. Dominguez, M. Lorraine Torres, Suresh Antony. (2003) Is Human Herpesvirus 6 Linked to Kikuchi-Fujimoto Disease? The Importance of Consistent Molecular and Serologic Analysis. Southern Medical Journal 96:3, 226-233
126
Duncan A. Clark, Paul D. Griffiths. (2003) Human herpesvirus 6: relevance of infection in the immunocompromised host. British Journal of Haematology 120:3, 384-395
127
Natividad Benito, Asunción Moreno, Tomás Pumarola, M.ª Ángeles Marcos. (2003) Virus del herpes humano tipo 6 y tipo 7 en receptores de trasplantes. Enfermedades Infecciosas y Microbiología Clínica 21:8, 424-432
128
CARRIE L. BYINGTON, DANIELLE M. ZERR, E. WILLIAM TAGGART, LONG NGUY, DAVID R. HILLYARD, KAREN C. CARROLL, LAWRENCE COREY. (2002) Human herpesvirus 6 infection in febrile infants ninety days of age and younger. The Pediatric Infectious Disease Journal 21:11, 996-999
129
Antonio An Tung Chuh, Henry Hin Lee Chan, Susan Shui Seng Chiu, Hoi Yee Ng, Joseph Sriyal Malik Peiris. (2002) A Prospective Case Control Study of the Association of Gianotti-Crosti Syndrome with Human Herpesvirus 6 and Human Herpesvirus 7 Infections. Pediatric Dermatology 19:6, 492-497
130
K.N Ward, X Couto Parada, J Passas, A.D Thiruchelvam. (2002) Evaluation of the specificity and sensitivity of indirect immunofluorescence tests for IgG to human herpesviruses-6 and -7. Journal of Virological Methods 106:1, 107-113
131
Eleni Papanikolaou, Vlassis Kouvatsis, Georgios Dimitriadis, Naoki Inoue, Minas Arsenakis. (2002) Identification and characterization of the gene products of open reading frame U86/87 of human herpesvirus 6. Virus Research 89:1, 89-101
132
Simon Turner, Dario DiLuca, Ursula A Gompels. (2002) Characterisation of a human herpesvirus 6 variant A ‘amplicon’ and replication modulation by U94-Rep ‘latency gene’. Journal of Virological Methods 105:2, 331-341
133
K.N. Ward, P. Kalima, K.M. MacLeod, T. Riordan. (2002) Neuroinvasion during delayed primary HHV-7 infection in an immunocompetent adult with encephalitis and flaccid paralysis. Journal of Medical Virology 67:4, 538-541
134
F. G. A. Moore, C. Wolfson. (2002) Human herpes virus 6 and multiple sclerosis. Acta Neurologica Scandinavica 106:2, 63-83
135
Lene Nielsen, Bent Faber Vestergaard. (2002) A μ-capture immunoassay for detection of human herpes virus-6 (HHV-6) IgM antibodies in human serum. Journal of Clinical Virology 25:2, 145-154
136
Mary Anne Jackson, John F. Sommerauer. (2002) Human herpesviruses 6 and 7. The Pediatric Infectious Disease Journal 21:6, 565-566
137
Tomoko Sugimoto, Keiko Tanaka-Taya, Jiro Ono, Hiroko Miyoshi, Shintaro Okada, Koichi Yamanishi. (2002) Human herpesvirus-6 infection in neonates: Not protected by only humoral immunity. Pediatrics International 44:3, 281-285
138
Heather J. MacLean, Andre G. Douen. (2002) Severe amnesia associated with human herpesvirus 6 encephalitis after bone marrow transplantation. Transplantation 73:7, 1086-1089
139
Tetsushi Yoshikawa, Yoshizo Asano, Shiho Akimoto, Takao Ozaki, Takuya Iwasaki, Takeshi Kurata, Fumi Goshima, Yukihiro Nishiyama. (2002) Latent infection of human herpesvirus 6 in astrocytoma cell line and alteration of cytokine synthesis. Journal of Medical Virology 66:4, 497-505
140
J.H. van Zeijl, R.A. Mullaart, J.M.D. Galama. (2002) The pathogenesis of febrile seizures: Is there a role for specific infections?. Reviews in Medical Virology 12:2, 93-106
141
Danielle M. Zerr, Laurence C. Yeung, Rose Mary Obrigewitch, Meei-Li Huang, Lisa M. Frenkel, Lawrence Corey. (2002) Primary human herpesvirus-6 associated with an afebrile seizure in a 3-week-old infant. Journal of Medical Virology 66:3, 384-387
142
D. Rapaport, D. Engelhard, G. Tagger, R. Or, N. Frenkel. (2002) Antiviral prophylaxis may prevent human herpesvirus-6 reactivation in bone marrow transplant recipients. Transplant Infectious Disease 4:1, 10-16
143
Duncan A. Clark. (2002) Human herpesvirus 6 and human herpesvirus 7: Emerging pathogens in transplant patients. International Journal of Hematology 76:S2, 246-252
144
N. Sugaya, T. Yoshikawa, M. Miura, T. Ishizuka, C. Kawakami, Y. Asano. (2002) Influenza Encephalopathy Associated with Infection with Human Herpesvirus 6 and/or Human Herpesvirus 7. Clinical Infectious Diseases 34:4, 461-466
145
Adonis Lorenzana, Hernando Lyons, Hadi Sawaf, Martha Higgins, Donald Carrigan, Peter D. Emanuel. (2002) Human Herpesvirus 6 Infection Mimicking Juvenile Myelomonocytic Leukemia in an Infant. Journal of Pediatric Hematology/Oncology 24:2, 136-141
146
Darrell V. Lewis, Daniel P. Barboriak, James R. MacFall, James M. Provenzale, Teresa V. Mitchell, Kevan E. VanLandingham. Do prolonged febrile seizures produce medial temporal sclerosis? Hypotheses, MR1 evidence and unanswered questions. Elsevier, 2002:263-278.
147
Teresa V. Mitchell, Darrell V. Lewis. Do Prolonged Febrile Seizures Injure the Hippocampus? Human MRI Studies. In: Febrile Seizures. Elsevier, 2002:103-125.
148
Shlomo Shinnar. Human Data. In: Febrile Seizures. Elsevier, 2002:317-324.
149
Erik De Clercq, Lieve Naesens, Leen De Bolle, Dominique Schols, Ying Zhang, Johan Neyts. (2001) Antiviral agents active against human herpesviruses HHV-6, HHV-7 and HHV-8. Reviews in Medical Virology 11:6, 381-395
150
Mark S. Wainwright, Paul L. Martin, Richard P. Morse, Mary Lacaze, James M. Provenzale, R. Edward Coleman, Marcello A. Morgan, Christine Hulette, Joanne Kurtzberg, Cheryl Bushnell, Leon Epstein, Darrell V. Lewis. (2001) Human herpesvirus 6 limbic encephalitis after stem cell transplantation. Annals of Neurology 50:5, 612-619
151
Yuko Hirata, Kazuhiro Kondo, Koichi Yamanishi. (2001) Human herpesvirus 6 downregulates major histocompatibility complex class I in dendritic cells. Journal of Medical Virology 65:3, 576-583
152
ANDREW D. DEPIERO, STEPHEN J. TEACH. (2001) Febrile seizures. Pediatric Emergency Care 17:5, 384-387
153
D. M. Zerr, T. A. Gooley, L. Yeung, M.‐L. Huang, P. Carpenter, J. C. Wade, L. Corey, C. Anasetti. (2001) Human Herpesvirus 6 Reactivation and Encephalitis in Allogeneic Bone Marrow Transplant Recipients. Clinical Infectious Diseases 33:6, 763-771
154
Mary T. Caserta, David J. Mock, Stephen Dewhurst. (2001) Human Herpesvirus 6. Clinical Infectious Diseases 33:6, 829-833
155
Jane G. Boggs, Elizabeth J. Waterhouse. (2001) Childhood Status Epilepticus. Epilepsy Currents 1:1, 25-25
156
Jennifer L. Trainor, Louis C. Hampers, Steven E. Krug, Robert Listernick. (2001) Children with First-time Simple Febrile Seizures Are at Low Risk of Serious Bacterial Illness. Academic Emergency Medicine 8:8, 781-787
157
William C. Koch. (2001) Fifth (human parvovirus) and sixth (herpesvirus 6) diseases. Current Opinion in Infectious Diseases 14:3, 343-356
158
Paul K.S. Chan, Ho-Keung Ng, Mamie Hui, Augustine F. Cheng. (2001) Prevalence and distribution of human herpesvirus 6 variants A and B in adult human brain. Journal of Medical Virology 64:1, 42-46
159
Milind D Khare. (2001) Human herpesvirus 6: its impact and influence on infectious diseases and their management. Expert Opinion on Pharmacotherapy 2:2, 213-221
160
Samantha S. Soldan, Steven Jacobson. Role of viruses in etiology and pathogenesis of multiple sclerosis. Elsevier, 2001:517-555.
161
Konstance K. Knox, Joseph H. Brewer, James M. Henry, Daniel J. Harrington, Donald R. Carrigan. (2000) Human Herpesvirus 6 and Multiple Sclerosis: Systemic Active Infections in Patients with Early Disease. Clinical Infectious Diseases 31:4, 894-903
162
Duncan A. Clark, Paul D. Griffiths, Vincent C. Emery. (2000) Newer human herpesviruses in transplantation. Current Opinion in Organ Transplantation 5:3, 203-209
163
Joyce D. Fingeroth. (2000) HERPESVIRUS INFECTION OF THE LIVER. Infectious Disease Clinics of North America 14:3, 689-719
164
Tetsushi Yoshikawa, Yoshizo Asano. (2000) Central nervous system complications in human herpesvirus-6 infection. Brain and Development 22:5, 307-314
165
Heikki Rantala, Laura Mannonen, Satu Ahtiluoto, Kimmo Linnavuori, Riitta Herva, Antti Vaheri, Marjaleena Koskiniemi. (2000) Human herpesvirus-6 associated encephalitis with subsequent infantile spasms and cerebellar astrocytoma. Developmental Medicine & Child Neurology 42:6, 418-421
166
Charles T. Leach. (2000) Human herpesvirus-6 and -7 infections in children: agents of roseola and other syndromes. Current Opinion in Pediatrics 12:3, 269-274
167
Duncan A. Clark. (2000) Human herpesvirus 6. Reviews in Medical Virology 10:3, 155-173
168
Benjamin M Blumberg, David J Mock, James M Powers, Masumi Ito, Jose G Assouline, Jeffrey V Baker, Bojun Chen, Andrew D Goodman. (2000) The HHV6 paradox: ubiquitous commensal or insidious pathogen? A two-step in situ PCR approach. Journal of Clinical Virology 16:3, 159-178
169
Haruhiko Kosuge. (2000) HHV-6, 7 and their related diseases. Journal of Dermatological Science 22:3, 205-212
170
Keiko Tanaka-Taya, Toshio Kondo, Naoko Nakagawa, Reiko Inagi, Hiroko Miyoshi, Tomimasa Sunagawa, Shintaro Okada, Koichi Yamanishi. (2000) Reactivation of human herpesvirus 6 by infection of human herpesvirus 7. Journal of Medical Virology 60:3, 284-289
171
Samantha S. Soldan, Thomas P. Leist, K. Newton Juhng, Henry F. McFarland, Steven Jacobson. (2000) Increased lymphoproliferative response to human herpesvirus type 6A variant in multiple sclerosis patients. Annals of Neurology 47:3, 306-313
172
Mark Young Stoeckle. (2000) The Spectrum of Human Herpesvirus 6 Infection: From Roseola Infantum to Adult Disease. Annual Review of Medicine 51:1, 423-430
173
Herpesvirus Type 6 (HHV-6). In: Pathology and Pathogenesis of Human Viral Disease. Elsevier, 2000:167-169.
174
M Peiris. (1999) Human herpesvirus-6 (HHV-6) and HHV-7 infections in bone marrow transplant recipients. Critical Reviews in Oncology/Hematology 32:3, 187-196
175
Paul D. Griffiths, Mounir Ait-Khaled, Charlotte P. Bearcroft, Duncan A. Clark, Alberto Quaglia, Susan E. Davies, Andrew K. Burroughs, Keith Rolles, I. Michael Kidd, Sophia N. Knight, Shanita M. Noibi, Alethea V. Cope, Andrew N. Phillips, Vincent C. Emery. (1999) Human herpesviruses 6 and 7 as potential pathogens after liver transplant: Prospective comparison with the effect of cytomegalovirus. Journal of Medical Virology 59:4, 496-501
176
Stephen J Teach, Howard L Wallace, Mary Jo Evans, Patricia K Duffner, John Hay, Howard S Faden. (1999) Human herpesviruses types 6 and 7 and febrile seizures. Pediatric Neurology 21:4, 699-703
177
HARLEY A. ROTBART, GEORGE H. MCCRACKEN, RICHARD J. WHITLEY, JOHN F. MODLIN, MARIANNE CASCINO, SONA SHAH, DEBORAH BLUM. (1999) Clinical significance of enteroviruses in serious summer febrile illnesses of children. The Pediatric Infectious Disease Journal 18:10, 869-874
178
Jodi B. Black, Philip E. Pellett. (1999) Human herpesvirus 7. Reviews in Medical Virology 9:4, 245-262
179
Donald R. Carrigan, Konstance K. Knox. (1999) Pathogenic role of human herpesvirus 6 in transplantation. Current Opinion in Organ Transplantation 4:3, 285-291
180
Junko H. Ohyashiki, Kenji Abe, Tomoko Ojima, Ping Wang, Chang Fang Zhou, Akitaka Suzuki, Kazuma Ohyashiki, Kohtaro Yamamoto. (1999) Quantification of human herpesvirus 6 in healthy volunteers and patients with lymphoproliferative disorders by PCR-ELISA. Leukemia Research 23:7, 625-630
181
Hiromi Miyagawa, Koichi Yamanishi. (1999) The epidemiology and pathogenesis of infections caused by the high numbered human herpesviruses in children: HHV-6, HHV-7 and HHV-8. Current Opinion in Infectious Diseases 12:3, 251-255
182
L.F. Kastrukoff, E.E. Thomas. (1999) Human herpesvirus 6 (hhv-6): Could it play a role in the etiopathogenesis of multiple sclerosis (ms)?. Clinical Immunology Newsletter 19:6-7, 79-82
183
Christine Morris, Mario Luppi, Margaret McDonald, Patrizia Barozzi, Giuseppe Torelli. (1999) Fine mapping of an apparently targeted latent human herpesvirus type 6 integration site in chromosome band 17p13.3. Journal of Medical Virology 58:1, 69-75
184
Jessica L. Severson, Stephen K. Tyring. (1999) Viral disease update. Current Problems in Dermatology 11:2, 37-70
185
Fu-Zhang Wang, Helena Dahl, Per Ljungman, Annika Linde. (1999) Lymphoproliferative responses to human herpesvirus-6 variant A and variant B in healthy adults. Journal of Medical Virology 57:2, 134-139
186
D H Dockrell, T F Smith, C V Paya. (1999) Human herpesvirus 6.. Mayo Clinic Proceedings 74:2, 163-170
187
Christopher D. Hillyer, Krista V. Lankford, John D. Roback, Theresa W. Gillespie, Leslie E. Silberstein. (1999) Transfusion of the HIV-seropositive patient: Immunomodulation, viral reactivation, and limiting exposure to EBV (HHV-4), CMV (HHV-5), and HHV-6, 7, and 8. Transfusion Medicine Reviews 13:1, 1-17
188
Mark K. Williams, Paolo Lusso. Human Herpesvirus 6. In: HIV and the New Viruses. Elsevier, 1999:329-357.
189
BRUCE P. LANPHEAR, CAROLINE B. HALL, JODI BLACK, PEGGY AUINGER. (1998) Risk factors for the early acquisition of human herpesvirus 6 and human herpesvirus 7 infections in children. The Pediatric Infectious Disease Journal 17:9, 792-795
190
Michael Mayne, Jay Krishnan, Luanne Metz, Avindra Nath, Anthony Auty, Beni M. Sahai, Christopher Power. (1998) Infrequent detection of human herpesvirus 6 DNA in peripheral blood mononuclear cells from multiple sclerosis patients. Annals of Neurology 44:3, 391-394
191
Mary T. Caserta, Caroline Breese Hall, Kenneth Schnabel, Christine E. Long, Nicole D’Heron. (1998) Primary human herpesvirus 7 infection: A comparison of human herpesvirus 7 and human herpesvirus 6 infections in children. The Journal of Pediatrics 133:3, 386-389
192
S Kugler. (1998) Genetics of the febrile seizure susceptibility trait. Brain and Development 20:5, 265-274
193
Ignatia B. Van den Veyver, Jiyuan Ni, Neil Bowles, Robert J. Carpenter, Carl P. Weiner, Jerome Yankowitz, Kenneth J. Moise, Janice Henderson, Jeffrey A. Towbin. (1998) Detection of Intrauterine Viral Infection Using the Polymerase Chain Reaction. Molecular Genetics and Metabolism 63:2, 85-95
194
TUULA LEHTINEN, MATTI LEHTINEN. (1998) Common and emerging infectious causes of hematological malignancies in the young. APMIS 106:1-6, 585-597
195
SANDRA H. JEE, CHRISTINE E. LONG, KENNETH C. SCHNABEL, NEERU SEHGAL, LEON G. EPSTEIN, CAROLINE BREESE HALL. (1998) Risk of recurrent seizures after a primary human herpesvirus 6-induced febrile seizure. The Pediatric Infectious Disease Journal 17:1, 43-48
196
DAVID W. KIMBERLIN. (1998) Human herpesviruses 6 and 7. The Pediatric Infectious Disease Journal 17:1, 59-68
197
I.Michael Kidd, Duncan A Clark, John A.G Bremner, Deenan Pillay, Paul D Griffiths, Vincent C Emery. (1998) A multiplex PCR assay for the simultaneous detection of human herpesvirus 6 and human herpesvirus 7, with typing of HHV-6 by enzyme cleavage of PCR products. Journal of Virological Methods 70:1, 29-36
198
TARO MAEDA, TOSHIOMI OKUNO, KOZABURO HAYASHI, MITSUO NAGATA, MASAMI UEDA, KAZUHIRO TERASHIMA, TADAHISA KAWASHIMA, HAJIME MIYAMOTO, TOSHIYUKI MORI, YOSHIYASU YAMADA. (1997) Outcomes of infants whose mothers are positive for human herpesvirus-6 DNA within the genital tract in early gestation. Pediatrics International 39:6, 653-657
199
Kathleen A. McGann. (1997) Herpesvirus infections in the fetus and neonate: Epidemiology and clinical manifestations. Seminars in Pediatric Infectious Diseases 8:3, 136-150
200
Jay A Levy. (1997) Three new human herpesviruses (HHV6, 7, and 8). The Lancet 349:9051, 558-563
201
Anne-Marie Fillet, Isabelle Reux, Cathy Joberty, Jean-Guy Fournier, Jean-Jacques Hauw, Phuc Le Hoang, François Bricaire, Jean-Marie Huraux, Henri Agut. (1996) Detection of human herpes virus 6 in AIDS-associated retinitis by means of in situ hybridization, polymerase chain reaction and immunohistochemistry. Journal of Medical Virology 49:4, 289-295
202
E. G. HERMIONE LYALL. (1996) Human herpesvirus 6: primary infection and the central nervous system. The Pediatric Infectious Disease Journal 15:8, 693-696
203
Paolo Lusso. (1996) Human herpesvirus 6 (HHV-6). Antiviral Research 31:1-2, 1-21
204
J.C. Hierholzer, R.A. Killington. Virus isolation and quantitation. In: Virology Methods Manual. Elsevier, 1996:25-46.
205
C. Roldan, J. Gutierrez, C. Maroto, G. Piedrola. (1995) Seroepidemiology of human herpesvirus 6 infection in normal children and adults in Spain. Serodiagnosis and Immunotherapy in Infectious Disease 7:4, 157-160
206
Farley R. Cleghorn, K.Aletha Maybank, Noreen Jack, Ernest Pate, Julius Mingle, Paul H. Levine, Angela Manns. (1995) Comparison of HHV-6 antibody titers in West Africa and the Caribbean. Annals of Epidemiology 5:6, 497-500
207
Stephen R. Barone, Mark H. Kaplan, Leonard R. Krilov. (1995) Human herpesvirus-6 infection in children with first febrile seizures. The Journal of Pediatrics 127:1, 95-97
208
Sadao Suga, Takehiko Yazaki, Yqji Kajita, Takao Ozaki, Yoshizo Asano. (1995) Detection of human herpesvirus 6 DNAs in samples from several body sites of patients with exanthem subitum and their mothers by polymerase chain reaction assay. Journal of Medical Virology 46:1, 52-55
