Join the 200th Anniversary Celebration

Original Article

A Single Mutation of the Fumarylacetoacetate Hydrolase Gene in French Canadians with Hereditary Tyrosinemia Type I

Markus Grompe, Maryse St.-Louis, Sylvie I. Demers, Muhsen Al-Dhalimy, Barbara Leclerc, and Robert M. Tanguay

N Engl J Med 1994; 331:353-357August 11, 1994

Abstract

Background

Hereditary tyrosinemia type I is an autosomal recessive inborn error of metabolism caused by a deficiency of the enzyme fumarylacetoacetate hydrolase. The disorder clusters in the Saguenay-Lac-St.-Jean area of Quebec. In this region, 1 of 1846 newborns is affected and 1 of every 22 persons is thought to be a carrier. Recently, we identified a splice mutation and two nonsense mutations in the fumarylacetoacetate hydrolase gene in two patients from Quebec with tyrosinemia type I.

Methods

We used allele-specific-oligonucleotide hybridization to examine the frequency of these three candidate mutations in patients with tyrosinemia type I and in the population of Quebec.

Results

The splice mutation was found in 100 percent of patients from the Saguenay-Lac-St.-Jean area and in 28 percent of patients from other regions of the world. Of 25 patients from the Saguenay-Lac-St.-Jean region, 20 (80 percent) were homozygous for this mutation, a guanine-to-adenine change in the splice-donor sequence in intron 12 of the gene, indicating that it causes most cases of tyrosinemia type I in the region. The frequency of carrier status, based on screening of blood spots from newborns, was about 1 per 25 in the Saguenay-Lac-St.-Jean population and about 1 per 66 overall in Quebec.

Conclusions

This study identified the most prevalent mutation causing hereditary tyrosinemia in French Canada; it also showed the feasibility of DNA-based testing for carriers in the population at risk. .

Media in This Article

Figure 1Schematic Representation of the PCR Primers and Allele-Specific Oligonucleotides Used to Detect Mutant Alleles in Patients with Tyrosinemia Type I.
Figure 2Results of Dot Blot Assays for the Intron 12 Splice Mutation of the Fumarylacetoacetate Hydrolase Gene in French Canadian Patients with Tyrosinemia Type I.
Article

Tyrosinemia type I is an autosomal recessive disorder of amino acid metabolism and is caused by a deficiency of fumarylacetoacetate hydrolase, the last enzyme in the catabolic pathway of tyrosine1-4. The accumulation of hepatotoxic metabolites of tyrosine proximal to the enzymatic block causes progressive liver malfunction and cirrhosis in infancy, and hepatocellular carcinoma develops in many patients by mid-childhood5,6. Patients may also have renal tubular damage7 and acute neurologic crises like those of porphyria8. The prognosis is poor, and currently the only effective therapy is liver transplantation,9,10 although a new drug, 2-(2-nitro-4-trifluoro-methylbenzoyl)-1,3-cyclohexanedione (also known as NTBC), may be effective in reducing the accumulation of toxic metabolites11. The complementary DNA of fumarylacetoacetate hydrolase has been cloned, and the gene mapped to chromosome band 15q23-2512,13.

Tyrosinemia type I is a rare condition, but in the Saguenay-Lac-St.-Jean area of Quebec the disorder has been identified in 1 in 1846 newborns in the past 20 years,14 making it one of the most common autosomal recessive diseases in French Canada. The estimated frequency of carrier status ranges from 1 in 16 to 1 in 2214. Although measurement of the hallmark metabolite, succinylacetone, can be used in prenatal testing,15 a reliable and rapid test to identify carriers is not available.

Only a small number of mutant alleles account for several autosomal recessive inherited diseases in this region,16-19 and a founder effect has also been reported for tyrosinemia type I20. If the most prevalent mutation (or mutations) causing the disease could be identified in the French Canadian population, a program of DNA-based, population-wide screening for carriers could become feasible.

Several mutations in the fumarylacetoacetate hydrolase gene have been identified in French Canadian patients. The first was a missense mutation, which so far has been detected in only a single family21. We recently reported four additional mutations in patients with tyrosinemia type I,22 two of whom were from French Canada. A patient from Eastern Quebec was homozygous for a splice mutation consisting of a guanine-to-adenine alteration in the splice-donor consensus sequence of fumarylacetoacetate hydrolase intron 12 (IVS12 +5 G-to-A). A second patient with one parent from Quebec and the other from England had two different nonsense mutations that changed the codon for glutamic acid at positions 357 and 364 of the enzyme to a stop codon (E357X and E364X). Clearly, one or more of these three candidate mutations of the fumarylacetoacetate hydrolase gene might be the common mutation (or mutations) found in patients with tyrosinemia in the Saguenay-Lac-St.-Jean area.

Here we describe the use of allele-specific-oligonucleotide hybridization to screen patients with tyrosinemia type I from Quebec and also patients from outside French Canada for the presence of these three mutations. In addition, we report the frequency of these alleles in the general population of Saguenay-Lac-St.-Jean and Quebec.

Methods

Study Samples

We studied 61 patients with tyrosinemia type I from around the world. Informed consent was obtained from the parents of each patient, and the studies were approved by the appropriate institutional review committees. Twenty-nine of the patients were from the Canadian province of Quebec; none were related, and 25 were from the Saguenay-Lac-St.-Jean area. The other 32 patients were from outside French Canada: 6 patients were from English Canada, 8 from the United States, 5 from France, 1 from Belgium, 5 from Finland, 2 from Norway, 1 from Hungary, 2 from the former Czechoslovakia, 1 from Mexico, and 1 from Iran. The diagnosis of tyrosinemia type I was based on increased urinary excretion of succinylacetone and was confirmed by the finding of deficient fumarylacetoacetate hydrolase activity in liver specimens or cultured skin fibroblasts. DNA was extracted from peripheral-blood cells or liver tissue obtained at transplantation or at the time of autopsy, as described elsewhere21. In addition, control blood samples from which genomic DNA was isolated were obtained from 24 healthy, unrelated laboratory workers.

In the analysis of the frequency of carrier status in the general population, we analyzed dried blood spots on filter paper. The blood samples had been obtained from 395 anonymous newborn infants born in April 1993, through the neonatal screening program of the Reseau de Medecine Genetique du Quebec. The infants were randomly selected, except for the fact that half of them were from the Saguenay-Lac-St.-Jean area and the other half from other regions of Quebec.

Isolation and Amplification of DNA

Genomic DNA from the patients and control subjects was isolated as previously described,21 and 100 ng was amplified by the polymerase chain reaction (PCR)23. The three abnormal alleles were all contained on the same PCR amplification unit (998 base pairs [bp] long). The primers used were TAN 61 (5'CTGCAGCTGCTCATTCCACCTCGC3'), located in intron 11, and TAN 80 (5'CAAGGAGGAAGACGAGCTGCTGGG3'), located in intron 13. The PCR was carried out at 95 °C for 5 minutes, followed by 35 cycles at 95 °C for 30 seconds, 60 °C for 30 seconds, and 72 °C for 3 minutes. The PCR buffer consisted of 10 mM TRIS hydrochloride (pH 9.0), 50 mM potassium chloride, 1.5 mM magnesium chloride, and 0.1 percent Triton X-100.

For the analysis of the samples from the newborns, DNA was isolated by the Chelex method24 from a 5-mm circle of blood on filter paper. The exon-intron boundary containing the intron 12 splice-donor mutation was then amplified with the primer MG 058, in exon 12, and the primer MG 057, in intron 12: the sequence of MG 058 was 5'GTACATGTACTGGACGATGCTG3', and that of MG 057 was 5'ATCTCTTCTCGAGGCTGAGCTGAG3'. The resulting PCR product was 194 bp long. Five microliters of isolated DNA was used for amplification in a total volume of 30 microliters of Kogan buffer25. The PCR was carried out at 95 °C for 5 minutes, followed by 40 cycles at 90 °C for 30 seconds, 52 °C for 30 seconds, and 72 °C for 1 minute, and then at 72 °C for 2 minutes.

The locations of the mutant alleles and the PCR primers are shown in Figure 1Figure 1Schematic Representation of the PCR Primers and Allele-Specific Oligonucleotides Used to Detect Mutant Alleles in Patients with Tyrosinemia Type I..

Allele-Specific-Oligonucleotide Hybridization

Oligonucleotides (15 bp long)26 homologous to the wild-type and mutant sequences were designed. The wild-type and mutant sequences for the intron 12 splice-donor mutation were 5'CCGGTGAGTATCTGG3' and 5'CCGGTGAATATCTGG3', respectively; the sequences for the codon 357 nonsense mutation were 5'GGAGCCAGAAAACTT3' and 5'GGAGCCATAAAACTT3'; and the sequences for the codon 364 nonsense mutation were 5'CATGTTGGAACTGTC3' and 5'CATGTTGTAACTGTC3'. Ten percent of each PCR product described above was denatured in 100 microliters of 0.4 M sodium hydroxide and 25 mM EDTA and spotted onto a Hybond-N+ membrane (Amersham) in a dot blot apparatus (Schleicher and Schuell). Five picomoles of each oligonucleotide was end-labeled with T4 polynucleotide kinase and [32P]gamma adenosine triphosphate27. The kinase was heat-inactivated, and 50 pmol of the opposing, unlabeled oligonucleotide was added. This mixture was hybridized overnight to the dot blots at 31 °C in 5x SSPE (150 mM sodium chloride, 10 mM sodium phosphate, and 1 mM EDTA), 1 percent sodium dodecyl sulfate, and 5x Denhardt's solution. The blots then were washed for 10 minutes in 2x SSC (150 mM sodium chloride and 15 mM sodium citrate) and 0.5 percent sodium dodecyl sulfate at 46 °C for all wild-type allele-specific oligonucleotides and at 41 °C for all mutant allele-specific oligonucleotides.

Results

We initially screened 10 patients with tyrosinemia type I from Quebec by allele-specific-oligonucleotide hybridization (Figure 2Figure 2Results of Dot Blot Assays for the Intron 12 Splice Mutation of the Fumarylacetoacetate Hydrolase Gene in French Canadian Patients with Tyrosinemia Type I.). Six patients were homozygous and three were heterozygous for the intron 12 splice-donor mutation, indicating a high prevalence of this allele in the French Canadian population. The two nonsense mutations previously found in one patient from French Canada22 were not found in these initial studies. Subsequently, DNA samples from 29 French Canadian patients (including 25 patients from the Saguenay-Lac-St.-Jean area) and 32 other patients were analyzed. The results are summarized in Table 1Table 1Prevalence of Three Mutant Alleles among Patients with Tyrosinemia Type I, According to Geographic Region.. All 25 patients from the Saguenay-Lac-St.-Jean area were positive for the intron 12 splice-donor mutation, 20 being homozygous for this mutation and 5 being heterozygous. The four French Canadian patients from outside of the Saguenay-Lac-St.-Jean region did not have the splice allele. Thus, 25 of 29 patients (86 percent) from Quebec carried the splice-donor allele on at least one chromosome, with 20 (69 percent) of them being homozygous for the mutation (all 20 were from the Saguenay-Lac-St.-Jean area). In contrast, the splice mutation was less frequent among the 32 patients from outside Quebec, 9 (28 percent) of whom had this mutation. The one homozygous patient was from Iran (this patient has been previously described22), and the heterozygous patients were from Norway (two pa-tients), Finland (one patient), English Canada (three patients), and the United States (two patients).

Neither of the two nonsense mutations was found frequently in any of the groups of patients (Table 1). Each of these mutations was found in only two patients (one of whom has been previously described22). These two changes, therefore, can be ruled out as common mutant alleles in tyrosinemia type I. Overall, 84 percent of mutations were detectable with the use of all three assays for allele-specific-oligonucleotide hybridization in the Quebec population.

To determine the frequency of carriers of the intron 12 splice mutation in the general population, we obtained blood-spot samples from the Quebec neonatal screening program. Testing these samples is a valid method of estimating the frequency of an allele, since the samples are obtained at random and in a blinded fashion. The results of the assays are shown in Figure 3Figure 3Identification of Carriers of the Intron 12 Splice Mutation in the Saguenay-Lac-St.-Jean Population, by Dot Blot Assay.. In the Saguenay-Lac-St.-Jean region, 8 of 198 infants (4 percent; 95 percent confidence interval, 1.3 to 6.7 percent)28 were carriers, as compared with 3 of 197 infants (1.5 percent; 95 percent confidence interval, 0 to 3.2 percent) from the rest of the province of Quebec.

Discussion

The results of this study demonstrate that the intron 12 splice-site mutation22 is responsible for most cases of hereditary tyrosinemia type I in the northeastern region of Quebec, where a high prevalence of the disease has been reported. All 25 patients from this region who were tested were positive for the mutation, and only 4 of the 29 patients from Quebec did not carry this allele on at least one chromosome. The other two candidate alleles, E357X and E364X, are rare.

A founder effect has been proposed as the cause of the clustering of cases of tyrosinemia type I and other autosomal recessive diseases in Quebec20. The results of our study support the hypothesis that the intron 12 splice mutation was carried by one or several ancestors of the Saguenay-Lac-St.-Jean population. Data obtained by haplotype analysis using restriction-fragment-length polymorphisms in patients with tyrosinemia type I and in the French Canadian population also support this founder-effect hypothesis29. The frequency of a single fumarylacetoacetate hydrolase haplotype (haplotype 6), estimated to be 18 percent in the population of the Saguenay-Lac-St.-Jean region, was 96 percent in the group of patients from this area.

Although 69 percent of patients with tyrosinemia type I from Quebec were homozygous for the splice mutation, 86 percent were homozygous for haplotype 6. Thus, there are other mutations on haplotype 6, three of which were recently identified21,30,31. It remains to be seen whether additional disease alleles, not yet described, are related to this haplotype.

Interestingly, not only is the intron 12 splice mutation prevalent among French Canadians, but it has also been found in about 28 percent of patients with tyrosinemia type I from around the world. Indeed, one of the patients previously described by us was Iranian and was homozygous for the splice allele on a haplotype 6 background, like the Saguenay-Lac-St.-Jean patients. This finding probably indicates that this is an ancient mutation.

The results of the analysis of blood spots from newborn infants confirm at a molecular level the high carrier rate, about 1 in 25 among residents of the Saguenay-Lac-St.-Jean area and 1 in 66 in the population of Quebec. The frequency of carrier status corresponds well to the observed incidence of affected newborns in the Saguenay-Lac-St.-Jean area (1 in 1846) and Quebec (1 in 16,000)14. This correlation again indicates that the splice-site mutation accounts for the majority of cases of tyrosinemia type I in the Saguenay-Lac-St.-Jean region.

Our findings have important implications for medical care in the Saguenay-Lac-St.-Jean region specifically and in the province of Quebec in general. Ninety percent of the alleles responsible for tyrosinemia type I in this region are due to the intron 12 splice-site mutation, and therefore about 81 percent of couples at risk for having an affected child could be identified by screening both prospective parents. In addition, the frequency of carriers of the splice mutation is high. The assay described here is a simple test that could be used in population-based screening for carriers in Quebec. The high rate of carrier status, the devastating nature of the condition, and the high cost of current treatment make such testing a realistic possibility. Since the techniques are available, considerations of ethics, the cost-benefit ratio, and the public health will determine whether the test will be used.

Supported by a grant (MT-11081, to Dr. Tanguay) from the Medical Research Council of Canada, by a grant (HD-28585-01) from the National Institute of Child Health and Human Development, and by a Basil O'Connor Award (to Dr. Grompe) by the March of Dimes Foundation. Ms. Demers was the recipient of a studentship from the Medical Research Council of Canada.

We are indebted to Drs. C. Laberge and A. Grenier (Reseau de Medecine Genetique du Quebec) for providing the blood-spot samples from the newborn infants; to Dr. J. Larochelle and C. Prevost for the samples from the patients in the Saguenay-Lac-St.-Jean area; and to the numerous physicians who kindly provided blood or tissue specimens from their patients with tyrosinemia type I: Drs. R. Laframboise and R. Gagne (Ste.-Foy); Drs. G.A. Mitchell and M. Lambert and the transplantation staff (Montreal); Dr. C.R. Scriver (Montreal); Drs. J. Laine, C. Holmberg, and M.K. Salo (Tampere, Finland); Dr. M.T. Zabot (Lyon, France); Dr. E.A. Kvittingen (Oslo, Norway); Dr. L. Kovak (Prague, Czech Republic); and others.

Source Information

From the Department of Molecular and Medical Genetics and the Department of Pediatrics, Oregon Health Sciences University, Portland (M.G., M.A.-D.); and the Laboratoire de genetique cellulaire et moleculaire, Medicine Genetique et Moleculaire, Centre de recherche du Centre Hospitalier de l'Universite Laval, Ste.-Foy, Quebec (M.S.-L., S.I.D., B.L., R.M.T.).

Address reprint requests to Dr. Grompe at the Department of Molecular and Medical Genetics, Mail Code L103, Oregon Health Sciences University, 3181 S.W. Sam Jackson Park Rd., Portland, OR 97201-3098.

References

References

  1. 1

    Lindblad B, Lindstedt S, Steen G. On the enzymic defects in hereditary tyrosinemia. Proc Natl Acad Sci U S A 1977;74:4641-4645
    CrossRef | Web of Science | Medline

  2. 2

    Kvittingen EA, Halvorsen S, Jellum E. Deficient fumarylacetoacetate fumarylhydrolase activity in lymphocytes and fibroblasts from patients with hereditary tyrosinemia. Pediatr Res 1983;17:541-544
    CrossRef | Web of Science | Medline

  3. 3

    Tanguay RM, Laberge C, Lescault A, Valet JP, Duband JL, Quenneville Y. Molecular basis of hereditary tyrosinemias: proof of the primary defect by western blot. In: Scott WA, Ahmad F, Black S, Schultz J, Whelan WJ, eds. Advances in gene technology: human genetic disorders. Cambridge, U.K.: Cambridge University Press, 1984:250-1.

  4. 4

    Tanguay RM, Valet JP, Lescault A, et al. Different molecular basis for fumarylacetoacetate hydrolase deficiency in the two clinical forms of hereditary tyrosinemia (type I). Am J Hum Genet 1990;47:308-316
    Web of Science | Medline

  5. 5

    Kvittingen E. Hereditary tyrosinemia type I -- an overview. Scand J Clin Lab Invest Suppl 1986;184:27-34
    Medline

  6. 6

    Mitchell GA, Lambert M, Tanguay RM. Hypertyrosinemia. In: Scriver CR, Beaudet AL, Sly WS, Valle D, eds. The metabolic basis of inherited disease. 7th ed. Vol. 1. New York: McGraw-Hill (in press).

  7. 7

    Goldsmith LA, Laberge C. Tyrosinemia and related disorders. In: Scriver CR, Beaudet AL, Sly WS, Valle D, eds. The metabolic basis of inherited disease. 6th ed. Vol. 1. New York: McGraw-Hill, 1989:547-62.

  8. 8

    Mitchell G, Larochell J, Lambert M, et al. Neurologic crises in hereditary tyrosinemia. N Engl J Med 1990;322:432-437
    Full Text | Web of Science | Medline

  9. 9

    Paradis K, Weber A, Seidman EG, et al. Liver transplantation for hereditary tyrosinemia: the Quebec experience. Am J Hum Genet 1990;47:338-342
    Web of Science | Medline

  10. 10

    Salt A, Barnes ND, Rolles K, Calne RY, Clayton PT, Leonard JV. Liver transplantation in tyrosinaemia type 1: the dilemma of timing the operation. Acta Paediatr 1992;81:449-452
    CrossRef | Web of Science | Medline

  11. 11

    Lindstedt S, Holme E, Lock EA, Hjalmarson O, Strandvik B. Treatment of hereditary tyrosinaemia type I by inhibition of 4-hydroxyphenylpyruvate dioxygenase. Lancet 1992;340:813-817
    CrossRef | Web of Science | Medline

  12. 12

    Agsteribbe E, van Faassen H, Hartog MV, et al. Nucleotide sequence of cDNA encoding human fumarylacetoacetase. Nucleic Acids Res 1990;18:1887-1887
    CrossRef | Web of Science | Medline

  13. 13

    Phaneuf D, Labelle Y, Berube D, et al. Cloning and expression of the cDNA encoding human fumarylacetoacetate hydrolase, the enzyme deficient in hereditary tyrosinemia: assignment of the gene to chromosome 15. Am J Hum Genet 1991;48:525-535
    Web of Science | Medline

  14. 14

    De Braekeleer M, Larochelle J. Genetic epidemiology of hereditary tyrosinemia in Quebec and in Saguenay-Lac-St.-Jean. Am J Hum Genet 1990;47:302-307
    Web of Science | Medline

  15. 15

    Laberge C, Lescault A, Grenier A, et al. Oral loading of homogentisic acid in controls and in obligate heterozygotes for hereditary tyrosinemia type I. Am J Hum Genet 1990;47:329-337
    Web of Science | Medline

  16. 16

    Hobbs HH, Brown MS, Russell DW, Davignon J, Goldstein JL. Deletion in the gene for the low-density-lipoprotein receptor in a majority of French Canadians with familial hypercholesterolemia. N Engl J Med 1987;317:734-737
    Full Text | Web of Science | Medline

  17. 17

    Hechtman P, Kaplan F, Bayleran J, et al. More than one mutant allele causes infantile Tay-Sachs disease in French-Canadians. Am J Hum Genet 1990;47:815-822
    Web of Science | Medline

  18. 18

    John SWM, Rozen R, Laframboise R, Laberge C, Scriver CR. Five mutations at the PAH locus account for almost 90% of PKU mutations in French-Canadians from eastern Quebec. Hum Mutat 1992;1:72-74
    CrossRef | Medline

  19. 19

    Rozen R, De Braekeleer M, Daigneault J, et al. Cystic fibrosis mutations in French Canadians: three CFTR mutations are relatively frequent in a Quebec population with an elevated incidence of cystic fibrosis. Am J Med Genet 1992;42:360-364
    CrossRef | Web of Science | Medline

  20. 20

    Laberge C. Hereditary tyrosinemia in a French Canadian isolate. Am J Hum Genet 1969;21:36-45
    Web of Science | Medline

  21. 21

    Phaneuf D, Lambert M, Laframboise R, Mitchell G, Lettre F, Tanguay RM. Type 1 hereditary tyrosinemia: evidence for molecular heterogeneity and identification of a causal mutation in a French Canadian patient. J Clin Invest 1992;90:1185-1192
    CrossRef | Web of Science | Medline

  22. 22

    Grompe M, al-Dhalimy M. Mutations of the fumarylacetoacetate hydrolase gene in four patients with tyrosinemia, type I. Hum Mutat 1993;2:85-93
    CrossRef | Web of Science | Medline

  23. 23

    Mullis KB, Faloona FA. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol 1987;155:335-350
    CrossRef | Web of Science | Medline

  24. 24

    Walsh PS, Metzger DA, Higuchi R. Chelex 100 as a medium for simplex extraction of DNA for PCR-based typing from forensic material. Biotechniques 1991;10:506-513
    Web of Science | Medline

  25. 25

    Kogan SC, Doherty M, Gitschier J. An improved method for prenatal diagnosis of genetic diseases by analysis of amplified DNA sequences: application to hemophilia A. N Engl J Med 1987;317:985-990
    Full Text | Web of Science | Medline

  26. 26

    Wu DY, Nozari G, Schold M, Conner BJ, Wallace RB. Direct analysis of single nucleotide variation in human DNA and RNA using in situ dot hybridization. DNA 1989;8:135-142
    CrossRef | Medline

  27. 27

    Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory, 1989.

  28. 28

    Hartl DL. A primer of population genetics. 2nd ed. Sunderland, Mass.: Sinauer Associates, 1988:7-10.

  29. 29

    Demers SI, Phaneuf D, Tanguay RM. Hereditary tyrosinemia type I: strong association with haplotype 6 in French-Canadians permits simple carrier detection and prenatal diagnosis. Am J Hum Genet 1994;55:327-333
    Web of Science | Medline

  30. 30

    Labelle Y, Phaneuf D, Leclerc B, Tanguay RM. Characterization of the human fumarylacetoacetate hydrolase gene and identification of a missense mutation abolishing enzymatic activity. Hum Mol Genet 1993;2:941-946
    CrossRef | Web of Science | Medline

  31. 31

    St-Louis M, Leclerc B, Laine J, Salo MK, Holmberg C, Tanguay RM. Identification of a stop mutation in five Finnish patients suffering from hereditary tyrosinemia type I. Hum Mol Genet 1994;3:69-72
    CrossRef | Web of Science | Medline

Citing Articles (31)

Citing Articles

  1. 1

    Richard J. Thompson, Bernard C. Portmann, Eve A. Roberts. 2012. Genetic and metabolic liver disease. , 157-259.
    CrossRef

  2. 2

    Fayez K. Ghishan. 2012. Inborn Errors of Metabolism that Lead to Permanent Liver Injury. , 1155-1201.
    CrossRef

  3. 3

    T. Paus, M. Bernard, M. M. Chakravarty, G. Davey Smith, J. Gillis, A. Lourdusamy, M. G. Melka, G. Leonard, P. Pavlidis, M. Perron, G. B. Pike, L. Richer, G. Schumann, N. Timpson, R. Toro, S. Veillette, Z. Pausova. (2011) KCTD8 Gene and Brain Growth in Adverse Intrauterine Environment: A Genome-wide Association Study. Cerebral Cortex
    CrossRef

  4. 4

    H. Hesham A-Kader, Fayez K. Ghishan. 2011. Abnormalities of Hepatic Protein Metabolism. , 786-794.
    CrossRef

  5. 5

    Angshumoy Roy, Milton J. Finegold. (2010) Hepatic Neoplasia and Metabolic Diseases in Children. Clinics in Liver Disease 14:4, 731-746
    CrossRef

  6. 6

    Elke Eggenhofer, Axel Doenecke, Philipp Renner, Przemyslaw Slowik, Pompiliu Piso, Edward K. Geissler, Hans J. Schlitt, Marc H. Dahlke, Felix C. Popp. (2010) High volume naked DNA tail-vein injection restores liver function in Fah-knock out mice. Journal of Gastroenterology and Hepatology 25:5, 1002-1008
    CrossRef

  7. 7

    Hyung-Doo Park, Dong Hwan Lee, Tae-Youn Choi, You Kyoung Lee, Jong-Won Kim, Chang-Seok Ki, Yong-Wha Lee. (2009) Clinical, biochemical, and genetic analysis of a Korean neonate with hereditary tyrosinemia type 1. Clinical Chemistry and Laboratory Medicine 47:8, 930-933
    CrossRef

  8. 8

    Chantale Langlois, Rossana Jorquera, Diana Orejuela, Anne Bergeron, Milton J. Finegold, William J. Rhead, Robert M. Tanguay. (2008) Rescue from neonatal death in the murine model of hereditary tyrosinemia by glutathione monoethylester and vitamin C treatment. Molecular Genetics and Metabolism 93:3, 306-313
    CrossRef

  9. 9

    Zdenka Pausova, Tomás˘ Paus, Michal Abrahamowicz, Jason Almerigi, Nadine Arbour, Manon Bernard, Daniel Gaudet, Petr Hanzalek, Pavel Hamet, Alan C. Evans, Michael Kramer, Luc Laberge, Susan M. Leal, Gabriel Leonard, Jackie Lerner, Richard M. Lerner, Jean Mathieu, Michel Perron, Bruce Pike, Alain Pitiot, Louis Richer, Jean R. Séguin, Catriona Syme, Roberto Toro, Richard E. Tremblay, Suzanne Veillette, Kate Watkins. (2007) Genes, maternal smoking, and the offspring brain and body during adolescence: Design of the Saguenay Youth Study. Human Brain Mapping 28:6, 502-518
    CrossRef

  10. 10

    C. Ronald Scott. (2006) The genetic tyrosinemias. American Journal of Medical Genetics Part C: Seminars in Medical Genetics 142C:2, 121-126
    CrossRef

  11. 11

    Merja Ashorn, Sari Pitk??nen, Matti K Salo, Markku Heikinheimo. (2006) Current Strategies for the Treatment of Hereditary Tyrosinemia Type I. Pediatric Drugs 8:1, 47-54
    CrossRef

  12. 12

    Anne Bergeron, Francine Lettre, Pierre Russo, Jean Morissette, Robert M. Tanguay. (2004) No evidence of maternal cell colonization in reverted liver nodules of tyrosinemia type I patients. Gastroenterology 127:5, 1381-1385
    CrossRef

  13. 13

    Sylvie I Demers, Pierre Russo, Francine Lettre, Robert M Tanguay. (2003) Frequent mutation reversion inversely correlates with clinical severity in a genetic liver disease, hereditary tyrosinemia. Human Pathology 34:12, 1313-1320
    CrossRef

  14. 14

    J.A. Arranz, F. Piol, L. Kozak, C. Prez-Cerd, B. Cormand, M. Ugarte, E. Riudor. (2002) Splicing mutations, mainly IVS6-1(G>T), account for 70% of fumarylacetoacetate hydrolase (FAH) gene alterations, including 7 novel mutations, in a survey of 29 tyrosinemia type I patients. Human Mutation 20:3, 180-188
    CrossRef

  15. 15

    Robert M. Tanguay. 2002. Fumarylacetoacetate Hydrolase. .
    CrossRef

  16. 16

    Charles R. Scriver. (2001) H UMAN G ENETICS : Lessons from Quebec Populations 1. Annual Review of Genomics and Human Genetics 2:1, 69-101
    CrossRef

  17. 17

    Nana Lee, Mark J. Daly, Terrye Delmonte, Eric S. Lander, Fenghao Xu, Thomas J. Hudson, Grant A. Mitchell, Charles C. Morin, Brian H. Robinson, John D. Rioux. (2001) A Genomewide Linkage-Disequilibrium Scan Localizes the Saguenay–Lac-Saint-Jean Cytochrome Oxidase Deficiency to 2p16. The American Journal of Human Genetics 68:2, 397-409
    CrossRef

  18. 18

    Sari T Pitkänen, Matti K Salo, Markku Heikinheimo. (2000) Hereditary tyrosinaemia type I: from basics to progress in treatment. Annals of Medicine 32:8, 530-538
    CrossRef

  19. 19

    Jacques Poudrier, Francine Lettre, Maryse St-Louis, Robert M. Tanguay. (1999) Genotyping of a case of tyrosinaemia type I with normal level of succinylacetone in amniotic fluid. Prenatal Diagnosis 19:1, 61-63
    CrossRef

  20. 20

    K Sankaranarayanan. (1998) Ionizing radiation and genetic risks. Mutation Research/Reviews in Mutation Research 411:2, 129-178
    CrossRef

  21. 21

    Jacques Poudrier, Francine Lettre, Charles R. Scriver, Jean Larochelle, Robert M. Tanguay. (1998) Different Clinical Forms of Hereditary Tyrosinemia (Type I) in Patients with Identical Genotypes. Molecular Genetics and Metabolism 64:2, 119-125
    CrossRef

  22. 22

    AJIW Bergman, IET van den Berg, W Brink, BT Poll-The, JK Ploos van Amstel, R Berger. (1998) Spectrum of mutations in the fumarylacetoacetate hydrolase gene of tyrosinemia type 1 patients in northwestern Europe and Mediterranean countries. Human Mutation 12:1, 19-26
    CrossRef

  23. 23

    Maryse St-Louis, Robert M. Tanguay. (1997) Mutations in the fumarylacetoacetate hydrolase gene causing hereditary tyrosinemia type I: Overview. Human Mutation 9:4, 291-299
    CrossRef

  24. 24

    A. GRENIER, S. CEDERBAUM, C. LABERGE, R. GAGNÉ, C. JAKOBS, R. M. TANGUAY. (1996) A CASE OF TYROSINAEMIA TYPE I WITH NORMAL LEVEL OF SUCCINYLACETONE IN THE AMNIOTIC FLUID. Prenatal Diagnosis 16:3, 239-242
    CrossRef

  25. 25

    Helge Rootwelt, Kari Høie, Ruud Berger, Eli Anne Kvittingen. (1996) Fumarylacetoacetase mutations in tyrosinaemia type I. Human Mutation 7:3, 239-243
    CrossRef

  26. 26

    Maryse St-Louis, Jacques Poudrier, Robert M. Tanguay. (1996) Simple detection of a (Finnish) hereditary tyrosinemia type 1 mutation. Human Mutation 7:4, 379-380
    CrossRef

  27. 27

    JACQUES POUDRIER, MARYSE ST-LOUIS, FRANCINE LETTRE, KARINE GIBSON, CLAUDE PRÉVOST, JEAN LAROCHELLE, ROBERT M. TANGUAY. (1996) FREQUENCY OF THE IVS12+5G→A SPLICE MUTATION OF THE FUMARYLACETOACETATE HYDROLASE GENE IN CARRIERS OF HEREDITARY TYROSINAEMIA IN THE FRENCH CANADIAN POPULATION OF SAGUENAY-LAC-ST-JEAN. Prenatal Diagnosis 16:1, 59-64
    CrossRef

  28. 28

    Cynthia Timmers, Markus Grompe. (1996) Six novel mutations in the fumarylacetoacetate hydrolase gene of patients with hereditary tyrosinemia type I. Human Mutation 7:4, 367-369
    CrossRef

  29. 29

    René Romero, Joel E. Lavine. (1995) Walking the ethical highwire: Genetic screening and hereditary tyrosinemia. Hepatology 21:4, 1193-1195
    CrossRef

  30. 30

    Jeffrey Teckman, David H. Perlmutter. (1995) Conceptual advances in the pathogenesis and treatment of childhood metabolic liver disease. Gastroenterology 108:4, 1263-1279
    CrossRef

  31. 31

    Markus Grompe, Muhsen Al-Dhalimy. (1995) Rapid nonradioactive assay for the detection of the common French Canadian tyrosinemia type I mutation. Human Mutation 5:1, 105-105
    CrossRef