Original Article
The Ewing Family of Tumors -- A Subgroup of Small-Round-Cell Tumors Defined by Specific Chimeric Transcripts
N Engl J Med 1994; 331:294-299August 4, 1994
- Abstract
Background
Precise diagnosis of small-round-cell tumors is often a challenge to the pathologist and the clinical oncologist. In Ewing's sarcomas and related peripheral primitive neuroectodermal tumors, a t(11;22) translocation or a (21,22) rearrangement is associated with hybrid transcripts of the EWS gene with the FLI1 or ERG gene. To investigate the diagnostic implication of this observation, we searched for these hybrid transcripts in tumors from patients with clinical and radiologic features of Ewing's sarcoma or peripheral primitive neuroectodermal tumors.
Methods
Samples of RNA from 114 tumors were reverse transcribed and subjected to the polymerase chain reaction with primers designed to amplify the relevant chimeric transcripts. All amplified products were sequenced.
Results
In-frame hybrid transcripts were observed in 89 cases. A hybrid transcript was found in 83 of 87 cases (95 percent) of Ewing's sarcoma or peripheral primitive neuroectodermal tumors. Samples of RNA from all of 12 tumors that had been proved to be other than Ewing's sarcoma or neuroectodermal tumors had no hybrid transcript. However, 6 of 15 undifferentiated tumors whose type was ambiguous (nonsecreting, poorly differentiated neuroblastoma or undifferentiated sarcoma) contained a hybrid transcript, suggesting that they might have to be reclassified.
Conclusions
A subgroup of small-round-cell tumors identified as belonging to the Ewing family of tumors can be defined according to a specific molecular genetic lesion that is detectable by a rapid, reliable, and efficient method. This approach can be applied to small specimens obtained by fine-needle biopsies.
Media in This Article
Figure 1
Detection of a Chimeric Transcript by Reverse Transcription Followed by PCR.Figure 2
Gel Electrophoresis of PCR-Amplified RNA from Tumors of 15 Patients with Ewing's Sarcoma or Peripheral Primitive Neuroectodermal Tumor.Article Activity
- Article
Ewing's sarcoma,1 the second most common malignant bone tumor of children and young adults, is an aggressive osteolytic tumor with a marked propensity for dissemination. Accurate and rapid diagnosis is essential for clinical management, but classification of the neoplasm can be difficult because the microscopical appearance of the tumor is not specific. Ewing's sarcoma belongs to the heterogeneous group of small-round-cell tumors2. The tumor cells are uniformly bland and undifferentiated, with a surprisingly low mitotic index given the rapid growth observed clinically. The presence of large amounts of intracellular glycogen is not a specific finding, since up to 35 percent of Ewing's sarcomas do not contain detectable glycogen, whereas many other childhood tumors do contain it3. The MIC2p30-32 antigen, a membrane protein of unknown function, is a promising new marker4-6. However, its presence in several unrelated types of tumors limits its reliability4-7. The balanced t(11;22)(q24;q12) chromosome translocation,8,9 which occurs in 83 percent of cases of Ewing's sarcoma, is a genotypic marker10. However, cytogenetic analysis is technically difficult, and the results are often obtained too late to influence therapy.
Ewing's sarcoma has phenotypic traits, including a high level of expression of the MIC2p30-32 antigen,4-7,11 that overlap those of a diverse group of primitive neuroectodermal tumors occurring outside the central nervous system12-14. These tumors and Ewing's sarcoma have the same t(11;22) chromosomal translocation15. Different terms have been used to designate these tumors, depending on their location and extent of neural differentiation: peripheral neuroepithelioma, Askin tumor, adult neuroblastoma, peripheral neuroblastoma, and primitive neuroectodermal tumor2,15-17. The collective term for these tumors is “peripheral primitive neuroectodermal tumors”18. Together with Ewing's sarcoma, they form the Ewing family of tumors2,18. However, this family is poorly defined, since none of the phenotypic markers can fully discriminate these tumors from other small-round-cell tumors and since the cytogenetically characteristic t(11;22) translocation may be absent from almost 20 percent of cases10,19.
The recent characterization of the EWSR1 and EWSR2 regions of chromosomes 22 and 11, respectively, where translocation breakpoints have been mapped,20 has revealed a molecular abnormality that may be fundamental in Ewing's sarcoma and related tumors. The translocation results in the expression of an aberrant hybrid protein in which the N-terminal part of the EWS protein is linked to the DNA binding domain (Ets domain) of the FLI1 transcription factor21. This hybrid protein may alter the transcriptional regulation of as-yet-unidentified target genes. In a small subgroup of tumors EWS, instead of joining the FLI1 gene, fuses with ERG, a member of the Ets family of transcription factors closely related to FLI122. The chimeric protein resulting from the fusion of EWS with ERG is structurally similar to the typical EWS-FLI1 protein in that the N-terminal portion of EWS is linked to the Ets domain of ERG.
The presence of these fusion genes might be the defining criterion for the Ewing family of tumors.
In this paper we report our search for transcripts of the fused genes in neoplasms belonging to the Ewing family of tumors. For this purpose we amplified complementary DNA from tumor-derived messenger RNA by the polymerase chain reaction (PCR). This method of detecting fusion transcripts has promise as a rapid, specific, and sensitive diagnostic test for the Ewing family of tumors.
Methods
Patients and Tumors
Over a period of 10 years, 114 tumor samples were collected at the time of biopsy from patients whose clinical and radiologic findings supported a diagnosis of either typical or atypical Ewing's sarcoma or peripheral primitive neuroectodermal tumor. The median age at diagnosis was 13 years (range, 1 to 48). Part of each sample was used for histologic and immunohistochemical characterization. Another part was immediately frozen in liquid nitrogen. Permanent cell lines were established for 22 tumors.
Tumors were classified in five groups on the basis of the clinical, radiologic, and pathological data. Group 1 consisted of osseous Ewing's sarcomas: these were osteolytic bone tumors composed of typical bland, periodic-acid-Schiff (PAS)-positive undifferentiated cells with the almost complete absence of intercellular fibers. Group 2 was composed of atypical Ewing's sarcomas (e.g., tumors that lacked one of the features found in the tumors in group 1); it included extraskeletal Ewing's sarcoma and Ewing's sarcoma tumors with atypical morphologic features such as large cells23 or negative PAS staining. Group 3 consisted of peripheral primitive neuroectodermal tumors that had two or more definite features of neural differentiation17. Group 4 contained tumors clearly excluded from the Ewing family of tumors on the basis of their morphologic features or immunophenotypes (or both). Group 5 tumors were small-round-cell tumors for which a definite diagnosis could not be made.
Detection of Hybrid Transcripts
Total RNA was isolated from tumors with the RNAzol extraction kit (Bioprobe Systems, Montreuil-sous-Bois, France). One μg of total RNA was reverse transcribed with oligonucleotide 11A,22 oligonucleotide ErgA (5'TGAGGGGTACTTGTACAGA3'), or oligodeoxythymidine with use of the Gene Amp RNA PCR kit (Cetus, Norwalk, Conn.). The resulting samples of complementary DNA were amplified by PCR with primers 11.11,22 Erg 11 (5'TGTTGGGTTTGCTCTTCCGCTC3'), and 22.822. Thirty cycles were performed; each cycle consisted of denaturation at 94 °C for 30 seconds, annealing at 68 °C for 1 minute, and elongation at 72 °C for 1 minute. As an internal control for amplification, the ubiquitous EWS transcript was sought with primers 22.8 and 22.4 (5'GGGCCGATCTCTGCGCTCCT3') under identical PCR conditions. The products of amplification were analyzed by electrophoresis on 1.2 percent agarose gel. The amplified fragments were purified on Centricon 100 ultrafiltration devices (Amicon, Epernon, France), and direct sequencing was performed with a Taq polymerase kit (Prism, Applied Biosystems, Foster City, Calif.) with fluorescent primers or dideoxynucleotides. Sequencing reactions were analyzed with an Applied Biosystems model 373A automatic sequencer. Northern and Southern blotting was performed according to standard procedures,24 with probes previously described20,22,25.
Results
Types of Fusion Transcripts
From 1984 to 1993, 114 tumor samples were obtained from patients whose clinical and radiologic data were compatible with a diagnosis of Ewing's sarcoma or related tumors. Pathological examination revealed 60 osseous Ewing's sarcomas, 14 atypical Ewing's sarcomas (PAS-negative, 3 cases; extraskeletal, 9 cases; unusual large-cell morphology, 2 cases), 13 peripheral primitive neuroectodermal tumors, 12 tumors subsequently shown not to belong to the Ewing family of tumors, and 15 tumors lacking hallmarks of a specific disease.
RNA was extracted from these samples and analyzed for hybrid transcripts in which EWS was linked to either FLI1 or ERG. The principle of the method is represented in Figure 1Figure 1
Detection of a Chimeric Transcript by Reverse Transcription Followed by PCR.. Samples of complementary DNA obtained by reverse transcription of tumor RNA were amplified by PCR with the primers 22.8 and 11.11, which are homologous to the coding regions of EWS (22.8) and FLI1 (11.11). These primers promote amplification only if their targeted regions are physically linked -- i.e., only if the tumor RNA contains an EWS-FLI1 hybrid transcript. A similar approach was used to detect EWS-ERG hybrid transcripts with primers 22.8 and Erg11. For each tumor RNA sample, a control amplification was performed with primers 22.8 and 22.4; these two primers allow amplification of the consistently expressed normal EWS gene.A hybrid transcript was detected in 89 tumors (Figure 2Figure 2
Gel Electrophoresis of PCR-Amplified RNA from Tumors of 15 Patients with Ewing's Sarcoma or Peripheral Primitive Neuroectodermal Tumor. and Table 1Table 1
Hybrid Transcripts Detected in Tumors with Initial Presentations Compatible with Ewing's Sarcoma or a Peripheral Primitive Neuroectodermal Tumor.). The corresponding amplified products were sequenced, revealing in all cases a junction of EWS and FLI1 coding sequences or EWS and ERG coding sequences. Altogether, 78 tumors contained an EWS-FLI1 fusion transcript and 11 tumors had an EWS-ERG fusion transcript.The most prevalent junctions were of the previously described type 1 and type 2 junctions that result from linkage of EWS exon 7 to FLI1 exon 6 (type 1) or 5 (type 2). Seven other types of junction were found for EWS-FLI122; they corresponded to various combinations that join EWS exons 7 to 10 with FLI1 exons 4 to 8 (Table 1). Four different EWS-ERG junctions were found. In all cases in which neither the EWS-FLI1 transcript nor the EWS-ERG transcript was detected, internal controls were positive, indicating that the lack of amplified product was not due to failure of the technique (Figure 2).
Fusion Transcript in Ewing's Sarcoma and Peripheral Primitive Neuroectodermal Tumors
A fusion transcript was demonstrated in 97 percent of the osseous Ewing's sarcomas (58 of the 60 tumors in group 1) (Table 1). Reexamination of one of the two tumors without a transcript (case 163) revealed unusual features. In contrast to the strong immunostaining for the MIC2 antigen observed in all the tumors of group 1 that had a fusion transcript, there was no MIC2 immunostaining in this tumor. Furthermore, independent pathological reevaluation of this tumor suggested a diagnosis of alveolar rhabdomyosarcoma. Retrospective characterization of the second tumor (case 145) was not possible.
Fusion transcripts were observed in 93 percent (25 of 27 cases) of the cases for which the diagnosis was atypical Ewing's sarcoma or peripheral primitive neuroectodermal tumors (groups 2 and 3). One of the tumors without a fusion transcript (case 74) originated from the gluteal region, had the morphologic features of a small-round-cell tumor, stained positive for PAS and MIC2, and stained negative for several neuroendocrine markers (Table 2Table 2
Tumors Phenotypically Compatible with a Diagnosis of Ewing's Sarcoma or a Peripheral Primitive Neuroectodermal Tumor, with No Fusion Transcript.). Cytogenetic analysis showed the karyotype 48,XY,del(1) (p34),+6,+12 with cytogenetically normal pairs of chromosomes 22, 21, and 11. The other tumor without a fusion transcript (case 122) had developed in an extraskeletal location within the chest of a one-year-old child. It had typical small-round-cell morphologic features but a prominent extracellular matrix. It stained slightly positive for PAS and slightly positive for MIC2. Apart from vimentin, all other tested markers were negative (Table 2). Cytogenetic analysis revealed a t(1;22)(p36;q12) translocation, which led the pathologists to propose a diagnosis of Askin tumor with variant translocation. Southern blot analysis of DNA from two tumors (cases 74 and 122) failed to demonstrate rearranged EWSR1. Furthermore, Northern blot analysis of both tumors did not reveal abnormal transcripts of EWS, FLI1, or ERG, strongly suggesting that in these tumors, none of these genes were affected by structural rearrangements.Fusion Transcripts in Other Tumors
In 12 tumors a diagnosis other than Ewing's sarcoma or peripheral primitive neuroectodermal tumors (group 4) was firmly established. None of the 12 tumors had a detectable fusion transcript (Table 1).
The 15 tumors in the last category (group 5) were difficult to classify. They did not fulfill the criteria for Ewing's sarcoma or peripheral primitive neuroectodermal tumors, and other tests did not indicate a specific diagnosis. The clinical, radiologic, and histopathological data led to a diagnosis of poorly differentiated, catechol-negative, metaiodobenzylguanidine-negative neuroblastomas in 4 cases and of undifferentiated sarcoma in the other 11 cases (Table 1).
All four cases of apparent neuroblastoma were reevaluated at the time of relapse. The reevaluation of two cases did not reveal a fusion transcript. In one of these two cases, in which the tumor was MIC2-negative, the diagnostic impression of neuroblastoma was confirmed. In the other case, the diagnosis was changed to extrarenal rhabdoid tumor; the data on the tumor's status for MIC2 were not available. The other two tumors contained a fusion transcript. Their strong staining for MIC2 reinforced the opinion that the initial diagnosis was incorrect. This impression was strengthened in one case by the cytogenetic demonstration of the presence of a t(14;22)(q32;q12) translocation. As a control measure, 20 typical neuroblastomas (positive for metaiodobenzylguanidine and catechol) obtained independently from patients other than those in this series were analyzed; none of them contained a fusion transcript (data not shown).
Finally, 4 of the 11 tumors diagnosed as undifferentiated sarcomas contained a fusion transcript. All four tumors were reanalyzed for MIC2 expression. Three tumors were strongly positive for MIC2, and one was weakly positive (Table 3Table 3
Characteristics of Undifferentiated Sarcomas.). This last tumor had a complex, although suggestive, t(11;11;22) translocation.Correlation with Karyotype and Tumor Phenotype
Cytogenetic data were available for 40 tumors (Table 4Table 4
Correlation of Molecular Data with Cytogenetic Findings.). As expected, all 23 tumors with typical t(11;22) translocations had EWS-FLI1 transcripts. Of the nine tumors with complex or variant translocations, seven had EWS-FLI1 transcripts and one an EWS-ERG transcript. One tumor (case 122) with a t(1;22)(p36;q12) translocation had no abnormalities of the EWS, FLI1, or ERG gene, thus suggesting that this translocation might have provided an erroneous diagnostic clue. Finally, six of eight tumors with no cytogenetic evidence of structural rearrangement of chromosome 22, 11, or 21 had either an EWS-ERG hybrid transcript (four tumors) or an EWS-FLI1 transcript (two tumors).With respect to the group of tumors with fusion transcripts, we did not observe obvious phenotypic differences that could be related to specific EWS-FLI1 or EWS-ERG transcripts.
Discussion
Almost all tumors in this series that were diagnosed as osseous Ewing's sarcomas, atypical Ewing's sarcomas, or peripheral primitive neuroectodermal tumors contained EWS-FLI1 or EWS-ERG fusion transcripts. Only 4 of 87 tumors could not be shown to have fusion transcripts, but the 3 tumors without transcripts that could be reevaluated had unusual features (Table 2). Thus, to date, no confirmed, fully typical Ewing's sarcoma or peripheral primitive neuroectodermal tumor has been shown to lack an EWS-FLI1 or an EWS-ERG fusion transcript.
The diagnosis of Ewing's sarcoma is often difficult. It is frequently suggested on the basis of clinical and radiologic information. Pathological data, including the strong clue provided by MIC2 staining, corroborate or exclude the diagnosis in the majority of cases2,14,17,18. However, other possible diagnoses may not be conclusively eliminated by these methods. The cytogenetic demonstration of a t(11;22)(q24;q12) translocation in the tumor cells also favors the diagnosis of Ewing's sarcoma or peripheral primitive neuroectodermal tumor. However, technical constraints and variant translocations that can make interpretation unreliable counterbalance the high specificity of this karyotypic anomaly. Furthermore, as shown here, close to 15 percent of the tumors have fusion transcripts despite the presence of apparently normal pairs of chromosomes 11, 21, and 22.
Our results show that reverse transcription followed by PCR can detect the molecular characteristics of a specific genetic alteration in this family of tumors. Therefore, we propose that the Ewing family of tumors should be redefined as the group of tumors that possesses a fusion transcript involving the EWS-FLI1 or EWS-ERG genes. The analysis can be performed on small samples obtained by minimally invasive biopsies, even if the samples are contaminated by stromal cells. Processing the samples is simple, and the result is available in less than 24 hours. The PCR method can thus be highly advantageous as a diagnostic tool. The presence of fusion transcripts should permit accurate and reproducible separation of the Ewing family from phenotypically similar groups of tumors. Indeed, this study demonstrates that the classic diagnostic problem of distinguishing Ewing's sarcoma from neuroblastoma and sarcoma is readily resolved by molecular analysis.
Although these fusion transcripts vary in their exon composition, the deduced encoded protein products have constant features. The N-terminal domain of EWS and either of the nearly identical Ets domains of FLI1 or ERG are always preserved and linked together. This observation, added to the apparent lack of an association between a specific phenotypic trait of the tumor and a particular hybrid transcript, suggests that the various chimeric proteins may possess subtle functional differences, if any. Therefore, the members of the Ewing family of tumors should arise through a similar tumorigenic process.
The variety of tumor-specific genetic alterations among other small-round-cell tumors (rhabdomyosarcoma, neuroblastoma, and lymphoma) raises the possibility of genotypic diagnosis of them as well. The recent identification of a chimeric gene between PAX3 and FKHR in alveolar rhabdomyosarcoma,26 the result of a t(2;13)(q24;q14) chromosome translocation,27 indicates that a comparable approach using reverse transcription followed by PCR is also feasible here. The specific genetic alterations of the short arm of chromosome 1 and the amplification of the N-myc gene in neuroblastomas28 can also be detected by specific genotypic methods, as can the immunoglobulin or T-cell-receptor gene rearrangements and chromosome translocations in lymphomas29. It is thus now possible to distinguish each member of the group of small-round-cell tumors according to genotype. The extreme specificity and sensitivity of the PCR technique may make some of these genetic markers ideal for detecting minimal metastases and residual tumor cells in biologic samples.
Supported by grants from the Ligue Nationale contre le Cancer, the European Community Commissions, the Ministere de la Recherche et de l'Enseignement Superieur, the Association pour la Recherche sur le Cancer, and the Comite Departemental de l'Yonne de la Ligue Nationale contre le Cancer.
We are indebted to the following clinicians and pathologists for providing tumor samples: C. Bailly, C. Biggs, E. Bouffet, A. Brizard, L. Brugieres, J.-M. Coindre, V. Combaret, F. Doz, J. Dubousset, F. Jaubert, A. Jouvet, H. Krichen, J. Landman, J. Lemerle, M. Malone, J. Michon, O. Oberlin, T. Phillip, P. Pouillart, J. Pritchard, E. Quintana, P. Validire, P. Vielh, and A. Zoubek.
Source Information
From the Laboratoire de Genetique des Tumeurs, INSERM Contrat Jeune Formation, Paris 9201 (O.D., J.Z., T.M., A.A., G.T.); Service d'Oncologie Pediatrique (J.-M.Z.) and Service d'Anatomopathologie (X.S.G.), Institut Curie, Paris; the Department of Pathology and Laboratory Medicine, Childrens Hospital, Los Angeles (T.J.T.); the Human Cytogenetics Laboratory, Imperial Cancer Research Fund, London (D.S.); Laboratoire de Cytogenetique Cancerologique, Centre National de la Recherche Scientifique Unite de Recherche Associee 1462, Nice, France (C.T.-C.); the Children's Cancer Research Institute, St. Anna Kinderspital, Vienna, Austria (P.F.A.); and the International Agency for Research on Cancer, Lyon, France (G.M.L.).
Address reprint requests to Dr. Thomas at the Laboratoire de Genetique des Tumeurs, Institut Curie, 26 rue d'Ulm, 75231 Paris CEDEX 05, France.
- References
References
1
Ewing J . Diffuse endothelioma of bone. Proc N Y Pathol Soc 1921;21:17-242
Triche TJ. Pathology of pediatric malignancies. In: Pizzo PA, Poplack DG, eds. Principles and practice of pediatric oncology. 2nd ed. Philadelphia: J.B. Lippincott, 1993:115-52.
3
Kissane JM ,Askin FB ,Foulkes M ,Stratton LB ,Shirley SF . Ewing's sarcoma of bone: clinicopathologic aspects of 303 cases from the Intergroup Ewing's Sarcoma Study. Hum Pathol 1983;14:773-779
CrossRef | Web of Science | Medline4
Ambros IM ,Ambros PF ,Strehl S ,Kovar H ,Gadner H ,Salzer-Kuntschik M . MIC2 is a specific marker for Ewing's sarcoma and peripheral primitive neuroectodermal tumors. Cancer 1991;67:1886-1893
CrossRef | Web of Science | Medline5
Fellinger EJ ,Garin-Chesa P ,Triche TJ ,Huvos AG ,Rettig WJ . Immunohistochemical analysis of Ewing's sarcoma cell surface antigen p30/32MIC2. Am J Pathol 1991;139:317-325
Web of Science | Medline6
Hamilton G ,Fellinger EJ ,Schratter I ,Fritsch A . Characterization of a human endocrine tissue and tumor-associated Ewing's sarcoma antigen. Cancer Res 1988;48:6127-6131
Web of Science | Medline7
Kovar H ,Dworzak M ,Strehl S , et al. Overexpression of the pseudoautosomal gene MIC2 in Ewing's sarcoma and peripheral primitive neuroectodermal tumor. Oncogene 1990;5:1067-1070
Web of Science | Medline8
Aurias A ,Rimbaut C ,Buffe D ,Dubousset J ,Mazabraud A . Chromosomal translocations in Ewing's sarcoma. N Engl J Med 1983;309:496-497
Web of Science9
Turc-Carel C ,Philip I ,Berger M-P ,Philip T ,Lenoir GM . Chromosomal translocations in Ewing's sarcoma. N Engl J Med 1983;309:497-498
Web of Science10
Turc-Carel C ,Aurias A ,Mugneret F , et al. Chromosomes in Ewing's sarcoma. I. An evaluation of 85 cases and remarkable consistency of t(11;22)(q24;q12). Cancer Genet Cytogenet 1988;32:229-238
CrossRef | Web of Science | Medline11
Pappo AS ,Douglass EC ,Meyer WH ,Marina N ,Parham DM . Use of HBA 71 and anti-β2-microglobulin to distinguish peripheral neuroepithelioma from neuroblastoma. Hum Pathol 1993;24:880-885
CrossRef | Web of Science | Medline12
Lipinski M ,Braham K ,Philip I , et al. Neuroectoderm-associated antigens on Ewing's sarcoma cell lines. Cancer Res 1987;47:183-187
Web of Science | Medline13
Noguera R ,Triche TJ ,Navarro S ,Tsokos M ,Lombart-Bosch A . Dynamic model of differentiation in Ewing's sarcoma cells: comparative analysis of morphologic, immunocytochemical, and oncogene expression parameters. Lab Invest 1992;66:143-151
Web of Science | Medline14
Cavazzana AO ,Miser JS ,Jefferson J ,Triche TJ . Experimental evidence for a neural origin of Ewing's sarcoma of bone. Am J Pathol 1987;127:507-518
Web of Science | Medline15
Whang-Peng J ,Triche TJ ,Knutsen T ,Miser J ,Douglass EC ,Israel MA . Chromosome translocation in peripheral neuroepithelioma. N Engl J Med 1984;311:584-585
Full Text | Web of Science | Medline16
Askin FB ,Rosai J ,Sibley RK ,Dehner LP ,McAlister WH . Malignant small cell tumor of the thoracopulmonary region in childhood: a distinctive clinicopathologic entity of uncertain histogenesis. Cancer 1979;43:2438-2451
CrossRef | Web of Science | Medline17
Dehner LP . Primitive neuroectodermal tumor and Ewing's sarcoma. Am J Surg Pathol 1993;17:1-13
CrossRef | Web of Science | Medline18
Horowitz ME, Malawer MM, Delaney TF, Tsokos MG. Ewing's sarcoma family of tumors: Ewing's sarcoma of bone and soft tissue and the peripheral primitive neuroectodermal tumors. In: Pizzo PA, Poplack DG, eds. Principles and practice of pediatric oncology. 2nd ed. Philadelphia: J.B. Lippincott, 1993:795-821.
19
Gorman PA ,Malone M ,Pritchard J ,Sheer D . Cytogenetic analysis of primitive neuroectodermal tumors: absence of the t(11;22) in two of three cases and a review of the literature. Cancer Genet Cytogenet 1991;51:13-22
CrossRef | Web of Science | Medline20
Zucman J ,Delattre O ,Desmaze C , et al. Cloning and characterization of the Ewing's sarcoma and peripheral neuroepithelioma t(11;22) translocation breakpoints. Genes Chromosomes Cancer 1992;5:271-277
CrossRef | Web of Science | Medline21
Delattre O ,Zucman J ,Plougastel B , et al. Gene fusion with an ETS DNA-binding domain caused by chromosome translocation in human tumours. Nature 1992;359:162-165
CrossRef | Web of Science | Medline22
Zucman J ,Melot T ,Desmaze C , et al. Combinatorial generation of variable fusion proteins in the Ewing family of tumors. EMBO J 1993;12:4481-4487
Web of Science | Medline23
Nascimento AG ,Unni KK ,Pritchard DJ ,Cooper KL ,Dahlin DC . A clinicopathologic study of 20 cases of large-cell (atypical) Ewing's sarcoma of bone. Am J Surg Pathol 1980;4:29-36
CrossRef | Web of Science | Medline24
Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory, 1989.
25
Zucman J ,Delattre O ,Desmaze C , et al. EWS and ATF-1 gene fusion induced by t(12;22) translocation in malignant melanoma of soft parts. Nat Genet 1993;4:341-345
CrossRef | Web of Science | Medline26
Galili N ,Davis RJ ,Fredericks WJ , et al. Fusion of a fork head domain gene to PAX3 in the solid tumour alveolar rhabdomyosarcoma. Nat Genet 1993;5:230-235
CrossRef | Web of Science | Medline27
Barr FG ,Biegel JA ,Sellinger B ,Womer RB ,Emanuel BS . Molecular and cytogenetic analysis of chromosomal arms 2q and 13q in alveolar rhabdomyosarcoma. Genes Chromosomes Cancer 1991;3:153-161
CrossRef | Web of Science | Medline28
Fong C-T ,Dracopoli NC ,White PS , et al. Loss of heterozygosity for the short arm of chromosome 1 in human neuroblastomas: correlation with N-myc amplification. Proc Natl Acad Sci U S A 1989;86:3753-3757
CrossRef | Web of Science | Medline29
Gauwerky CE ,Croce CM . Chromosomal translocations in leukaemia. Semin Cancer Biol 1993;4:333-340
Web of Science | Medline
- Citing Articles (293)
Citing Articles
1
T. G. P. Grunewald, A. Ranft, I. Esposito, P. da Silva-Buttkus, M. Aichler, D. Baumhoer, K. L. Schaefer, L. Ottaviano, C. Poremba, G. Jundt, H. Jurgens, U. Dirksen, G. H. S. Richter, S. Burdach. (2012) High STEAP1 expression is associated with improved outcome of Ewing's sarcoma patients. Annals of Oncology
CrossRef2
Jenny Potratz, Heribert Jürgens, Alan Craft, Uta Dirksen. (2012) Ewing Sarcoma: Biology-Based Therapeutic Perspectives. Pediatric Hematology-Oncology 29:1, 12-27
CrossRef3
Jenny Potratz, Uta Dirksen, Heribert Jürgens, Alan Craft. (2012) Ewing Sarcoma: Clinical State-of-the-Art. Pediatric Hematology-Oncology 29:1, 1-11
CrossRef4
Måns Åkerman, Henryk Domanski. 2012. Bone. , 412-427.
CrossRef5
Ram Nawal Rao, Shalu Sinha, Suresh Babu, Ravi Mehrotra. (2011) Fine-needle aspiration cytology of primitive neuroectodermal tumor of the urinary bladder: A case report. Diagnostic Cytopathology 39:12, 924-926
CrossRef6
R. Eisenhart-Rothe, A. Toepfer, M. Salzmann, J. Schauwecker, H. Gollwitzer, H. Rechl. (2011) Primär maligne Knochentumoren. Der Orthopäde 40:12, 1121-1142
CrossRef7
Melissa M. Kemp, Michel Weïwer, Angela N. Koehler. (2011) Unbiased Binding Assays for Discovering Small-Molecule Probes and Drugs. Bioorganic & Medicinal Chemistry
CrossRef8
Justin L. Seningen, Carrie Y. Inwards. (2011) Small Round Cell Tumors of Bone. Surgical Pathology Clinics
CrossRef9
William E. Osai, Elizabeth G. Demicco, Lance C. Pagliaro. (2011) Malignant Small Round Blue Cell Tumor of the Kidney Without EWSR1 Rearrangement: Report of a Case and Review of the Literature. Clinical Genitourinary Cancer
CrossRef10
Xiao-Hui Duan, Xiao-Hua Ban, Bo Liu, Xiao-Mei Zhong, Ruo-Mi Guo, Fang Zhang, Bi-Ling Liang, Jun Shen. (2011) Intraspinal primitive neuroectodermal tumor: Imaging findings in six cases. European Journal of Radiology 80:2, 426-431
CrossRef11
Barry C. Boyd, Justin Au, Alfredo Aguirre, Timothy J. Votta. (2011) Rapidly enlarging nodular lesion of the anterior maxilla. Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology, and Endodontology 112:5, 626-631
CrossRef12
Séverine Battaglia, Sophie Dumoucel, Julie Chesneau, Marie-Françoise Heymann, Gaëlle Picarda, François Gouin, Nadège Corradini, Dominique Heymann, Françoise Redini. (2011) Impact of oncopediatric dosing regimen of zoledronic acid on bone growth: Preclinical studies and case report of an osteosarcoma pediatric patient. Journal of Bone and Mineral Research 26:10, 2439-2451
CrossRef13
John C. Kucharczuk. (2011) Chest Wall Sarcomas and Induction Therapy. Thoracic Surgery Clinics
CrossRef14
George M. Ibrahim, Aria Fallah, Mehdi Shahideh, Uri Tabori, James T. Rutka. (2011) Primary Ewing’s sarcoma affecting the central nervous system: a review and proposed prognostic considerations. Journal of Clinical Neuroscience
CrossRef15
Khin Thway. (2011) Primitive Round Cell Neoplasms. Surgical Pathology Clinics 4:3, 799-818
CrossRef16
Stryder M. Meadows, Candace T. Myers, Paul A. Krieg. (2011) Regulation of endothelial cell development by ETS transcription factors. Seminars in Cell & Developmental Biology
CrossRef17
D. Heymann, F. Redini. (2011) Bone Sarcomas: Pathogenesis and New Therapeutic Approaches. IBMS BoneKEy 8:9, 402-414
CrossRef18
Yuli Yang, Yong Liu, Zhengqin Yin. (2011) Primary Orbital Ewing Sarcoma. Journal of Pediatric Ophthalmology & Strabismus
CrossRef19
P. J. Grohar, G. M. Woldemichael, L. B. Griffin, A. Mendoza, Q.-R. Chen, C. Yeung, D. G. Currier, S. Davis, C. Khanna, J. Khan, J. B. McMahon, L. J. Helman. (2011) Identification of an Inhibitor of the EWS-FLI1 Oncogenic Transcription Factor by High-Throughput Screening. JNCI Journal of the National Cancer Institute 103:12, 962-978
CrossRef20
C Garofalo, M C Manara, G Nicoletti, M T Marino, P-L Lollini, A Astolfi, G Pandini, J A López-Guerrero, K-L Schaefer, A Belfiore, P Picci, K Scotlandi. (2011) Efficacy of and resistance to anti-IGF-1R therapies in Ewing's sarcoma is dependent on insulin receptor signaling. Oncogene 30:24, 2730-2740
CrossRef21
Gabriella Gamberi, Stefania Cocchi, Stefania Benini, Giovanna Magagnoli, Luca Morandi, Jennifer Kreshak, Marco Gambarotti, Piero Picci, Licciana Zanella, Marco Alberghini. (2011) Molecular Diagnosis in Ewing Family Tumors. The Journal of Molecular Diagnostics 13:3, 313-324
CrossRef22
Jason A. Ellis, Robert J. Rothrock, Gaetan Moise, Paul C. McCormick, Kurenai Tanji, Peter Canoll, Michael G. Kaiser, Paul C. McCormick. (2011) Primitive neuroectodermal tumors of the spine: a comprehensive review with illustrative clinical cases. Neurosurgical FOCUS 30:1, E1
CrossRef23
Steven G. DuBois, Robert Goldsby, Mark Segal, Jonathan Woo, Kirsten Copren, John P. Kane, Clive R. Pullinger, Katherine K. Matthay, John Witte, Stephen L. Lessnick, Leslie L. Robison, Smita Bhatia, Louise C. Strong. (2011) Evaluation of polymorphisms in EWSR1 and risk of Ewing sarcoma: A report from the childhood cancer survivor study. Pediatric Blood & Cancern/a-n/a
CrossRef24
Aijaz A. Sofi, Ashish D. Thekdi, Ali Nawras. (2011) EUS-FNA for the Diagnosis of Retroperitoneal Primitive Neuroectodermal Tumor. Diagnostic and Therapeutic Endoscopy 2011, 1-3
CrossRef25
Takashi Tsujimura, Tomoyuki Haji, Shinichi Satou, Tetsuya Tamura, Kazuyuki Ichimaru, Kazuhiko Minami, Kouichirou Yamada, Toshio Ueda, Sayaka Fuji, Susumu Sakamoto. (2011) A Case of Primitive Neuroectodermal Tumor Arising from the Nasal and Paranasal Cavity. Practica Oto-Rhino-Laryngologica 104:4, 255-260
CrossRef26
Cheryl M. Coffin, Jessica M. Comstock, Jeremy C. Wallentine. 2011. Immunohistology of Pediatric Neoplasms. , 662-689.
CrossRef27
Bryan Corrin, Andrew G. Nicholson. 2011. Pleura and chest wall. , 707-752.
CrossRef28
Pavel Dundr, Daniela Fischerová, Ctibor Povýšil, Adéla Berková, Lenka Bauerová, David Cibula. (2010) Uterine Tumors with Neuroectodermal Differentiation. A Report of 4 Cases. Pathology & Oncology Research 16:4, 601-608
CrossRef29
E J dos Santos Rubio, B S Harhangi, J M Kros, A J P E Vincent, C M F Dirven. (2010) A Primary Extraosseous Ewing Sarcoma in the Cerebellopontine Angle of a Child: Review of Relevant Literature and Case Report. Neurosurgery 67:6, E1852-E1856
CrossRef30
Orit Kaidar-Person, Nissim Haim, Gil Bar-Sela. (2010) Treatment of adult patients with Ewing’s sarcoma: compliance with chemotherapy protocols & toxicity. Medical Oncology
CrossRef31
Matthew D. Dobbs, Stefanie R. Lowas, Marta Hernanz-Schulman, Ginger E. Holt, Chang Yu, J. Herman Kan. (2010) Impact of Abdominopelvic CT on Ewing Sarcoma Management. Academic Radiology 17:10, 1288-1291
CrossRef32
Mónica Enguita-Germán, Paula Schiapparelli, Juan A. Rey, Javier S. Castresana. (2010) CD133+ cells from medulloblastoma and PNET cell lines are more resistant to cyclopamine inhibition of the sonic hedgehog signaling pathway than CD133− cells. Tumor Biology 31:5, 381-390
CrossRef33
Richard Gorlick, Martha Perisoglou, Jeremy Whelan. 2010. Bone Tumors. , 234-257.
CrossRef34
E. Wardelmann, H.- U. Schildhaus, S. Merkelbach-Bruse, W. Hartmann, P. Reichardt, P. Hohenberger, R. Buttner. (2010) Soft tissue sarcoma: from molecular diagnosis to selection of treatment. Pathological diagnosis of soft tissue sarcoma amid molecular biology and targeted therapies. Annals of Oncology 21:Supplement 7, vii265-vii269
CrossRef35
Jane Halliday, Sing Yang Soon, Hannah Monaghan, William S. Walker, Vipin Zamvar. (2010) Extraskeletal Ewing's Sarcoma Presenting as a Mediastinal Mass. The Annals of Thoracic Surgery 90:3, 1016-1017
CrossRef36
I Ilari, M A De Ioris, G M Milano, R Pessolano, C De Lurentis, L De Sio, P Fidani, A Jenkner, R Cozza. (2010) Toxicity of high-dose chemotherapy with etoposide, thiotepa and CY in treating poor-prognosis Ewing's sarcoma family tumors: the experience of the Bambino Gesù Children's Hospital. Bone Marrow Transplantation 45:8, 1274-1280
CrossRef37
Alain Bernheim. (2010) Cytogenomics of cancers: From chromosome to sequence. Molecular Oncology 4:4, 309-322
CrossRef38
Thomas M Ulbright, Eyas M Hattab, Shaobo Zhang, Yaron Ehrlich, Richard S Foster, Lawrence H Einhorn, Liang Cheng. (2010) Primitive neuroectodermal tumors in patients with testicular germ cell tumors usually resemble pediatric-type central nervous system embryonal neoplasms and lack chromosome 22 rearrangements. Modern Pathology 23:7, 972-980
CrossRef39
R. Abir, M. Feinmesser, I. Yaniv, B. Fisch, I. J. Cohen, A. Ben-Haroush, D. Meirow, C. Felz, S. Avigad. (2010) Occasional involvement of the ovary in Ewing sarcoma. Human Reproduction 25:7, 1708-1712
CrossRef40
Won-Jong Bahk, Eun-Deok Chang, Jung Min Bae, Kyung-Ah Chun, An-Hee Lee, Sang-Young Rho, Jin Woo Kim. (2010) Primary cutaneous Ewing’s sarcoma/primitive neuroectodermal tumor manifesting numerous small and huge ulcerated masses: its complete remission by chemotherapy and magnetic resonance imaging findings. Skeletal Radiology 39:6, 595-600
CrossRef41
Syed Nisar Ahmad, Shiekh Aejaz Aziz, Rangreze Imran, Manzoor Ahmad Banday, Gul Mohammad, A. R. Lone, Parveen Reshi, Nisar Ahmad Wani, Shaheena Parveen. (2010) Primitive neuroectodermal tumor of uterus — A rare entity. The Chinese-German Journal of Clinical Oncology 9:6, 365-367
CrossRef42
Man Yu, Yanfang Wan, Qinghua Zou. (2010) Decreased copy number of mitochondrial DNA in Ewing's sarcoma. Clinica Chimica Acta 411:9-10, 679-683
CrossRef43
Julia Haeusler, Andreas Ranft, Tobias Boelling, Georg Gosheger, Gabriele Braun-Munzinger, Volker Vieth, Stefan Burdach, Henk van den Berg, Heribert Juergens, Uta Dirksen. (2010) The value of local treatment in patients with primary, disseminated, multifocal Ewing sarcoma (PDMES). Cancer 116:2, 443-450
CrossRef44
Yuzo MAEDA, Motoki YANO, Satoru MORIYAMA, Yoshitaka FUJII, Satosi TAKAHASI. (2010) A CASE OF PRIMARY PULMONARY PRIMITIVE NEUROECTODERMAL TUMOR. Nihon Rinsho Geka Gakkai Zasshi (Journal of Japan Surgical Association) 71:11, 2846-2850
CrossRef45
Joseph D. Khoury. 2010. Ewing’s Sarcoma Family of Tumors. , 235-242.
CrossRef46
Y.M. Dennis Lo, Ivy H.N. Wong, Nancy B.Y. Tsui, Ching-Wan Lam. 2009. Molecular Biological Analyses and Molecular Pathology in Clinical Chemistry. .
CrossRef47
Man Yu, Yanfang Wan, Qinghua Zou, Yanwei Xi. (2009) High frequency of mitochondrial DNA D-loop mutations in Ewing’s sarcoma. Biochemical and Biophysical Research Communications 390:3, 447-450
CrossRef48
Isidro Machado, Rosa Noguera, Antonio Pellin, Jose A. Lopez-Guerrero, Marta Piqueras, Samuel Navarro, Antonio Llombart-Bosch. (2009) Molecular Diagnosis of Ewing Sarcoma Family of Tumors. Diagnostic Molecular Pathology 18:4, 189-199
CrossRef49
Nicolas Sirvent, Martine Trassard, Nathalie Ebran, Rita Attias, Florence Pedeutour. (2009) Fusion of EWSR1 with the DUX4 facioscapulohumeral muscular dystrophy region resulting from t(4;22)(q35;q12) in a case of embryonal rhabdomyosarcoma. Cancer Genetics and Cytogenetics 195:1, 12-18
CrossRef50
Antonio Llombart-Bosch, Isidro Machado, Samuel Navarro, Franco Bertoni, Patrizia Bacchini, Marco Alberghini, Apollon Karzeladze, Nikita Savelov, Semyon Petrov, Isabel Alvarado-Cabrero, Doina Mihaila, Philippe Terrier, Jose Antonio Lopez-Guerrero, Piero Picci. (2009) Histological heterogeneity of Ewing’s sarcoma/PNET: an immunohistochemical analysis of 415 genetically confirmed cases with clinical support. Virchows Archiv 455:5, 397-411
CrossRef51
K. Thway. (2009) Pathology of Soft Tissue Sarcomas. Clinical Oncology 21:9, 695-705
CrossRef52
Andrew S. Moore, Peter G. Wilson, Penny McKelvie, Jamie La Nauze, Lawrence W. Hirst. (2009) Localised peripheral primitive neuroectodermal tumour (PNET) of the conjunctiva. Pediatric Blood & Cancer 53:4, 669-671
CrossRef53
Aiko Suminoe, Akinobu Matsuzaki, Hiroyoshi Hattori, Yuhki Koga, Toshiro Hara. (2009) Immunotherapy with autologous dendritic cells and tumor antigens for children with refractory malignant solid tumors. Pediatric Transplantation 13:6, 746-753
CrossRef54
Antonio Briccoli, Michele Rocca, Mariacristina Salone, Emanuela Palmerini, Alba Balladelli, Cristina Ferrari, Maria Di Fiore, Gaetano Bacci. (2009) Local and systemic control of Ewing's bone sarcoma family tumors of the ribs. Journal of Surgical Oncology 100:3, 222-226
CrossRef55
Paul Klimo, Patrick J. Codd, Holcombe Grier, Liliana C. Goumnerova. (2009) Primary pediatric intraspinal sarcomas. Journal of Neurosurgery: Pediatrics 4:3, 222-229
CrossRef56
Stephen L. Lessnick, A. Paolo Dei Tos, Poul H.B. Sorensen, Palma Dileo, Laurence H. Baker, Stefano Ferrari, Kirsten Sundby Hall. (2009) Small Round Cell Sarcomas. Seminars in Oncology 36:4, 338-346
CrossRef57
Fredrik Mertens, Cristina R. Antonescu, Peter Hohenberger, Marc Ladanyi, Piergiorgio Modena, Maurizio D'Incalci, Paolo G. Casali, Massimo Aglietta, Thor Alvegård. (2009) Translocation-Related Sarcomas. Seminars in Oncology 36:4, 312-323
CrossRef58
R. Weiss, P.H. Walz. (2009) Peripheral Primitive Neuroectodermal Tumour in a Lumbar Vertebra and the Liver of a Dromedary Camel (Camelus dromedarius). Journal of Comparative Pathology 141:2-3, 182-186
CrossRef59
Hayriye V Erkizan, Yali Kong, Melinda Merchant, Silke Schlottmann, Julie S Barber-Rotenberg, Linshan Yuan, Ogan D Abaan, Tsu-hang Chou, Sivanesan Dakshanamurthy, Milton L Brown, Aykut Üren, Jeffrey A Toretsky. (2009) A small molecule blocking oncogenic protein EWS-FLI1 interaction with RNA helicase A inhibits growth of Ewing's sarcoma. Nature Medicine 15:7, 750-756
CrossRef60
Gregory K Friedman, Joseph G Pressey, Alyssa T Reddy, James M Markert, G Yancey Gillespie. (2009) Herpes Simplex Virus Oncolytic Therapy for Pediatric Malignancies. Molecular Therapy 17:7, 1125-1135
CrossRef61
Aaron M. Lipskar, Richard D. Glick, Jianzhong Huang, Jason C. Fisher, James DeVoti, Ray Pica, Morris Edelman, Bettie M. Steinberg, Samuel Z. Soffer. (2009) Cyclooxygenase 2 mediates the antiangiogenic effect of rapamycin in Ewing sarcoma. Journal of Pediatric Surgery 44:6, 1139-1147
CrossRef62
Koji Akeda, Yuichi Kasai, Eiji Kawakita, Masashi Seto, Toshibumi Kono, Atsumasa Uchida. (2009) Primary Ewing Sarcoma of the Spine Mimicking a Psoas Abscess Secondary to Spinal Infection. Spine 34:9, E337-E341
CrossRef63
Shinsuke Sato, Tetsuryu Mitsuyama, Akira Ishii, Makio Kawakami, Takakazu Kawamata. (2009) MULTIPLE PRIMARY CRANIAL EWINGʼS SARCOMA IN ADULTHOOD. Neurosurgery 64:2, E384-E386
CrossRef64
Ruzanna P. Leemann-Zakaryan, Steffen Pahlich, Maria José Sedda, Lilian Quero, Doris Grossenbacher, Heinz Gehring. (2009) Dynamic Subcellular Localization of the Ewing Sarcoma Proto-Oncoprotein and Its Association with and Stabilization of Microtubules. Journal of Molecular Biology 386:1, 1-13
CrossRef65
Jay P. Shah, Jodilyn Jelsema, Christopher S. Bryant, Rouba Ali-Fehmi, John M. Malone. (2009) Carboplatin and paclitaxel adjuvant chemotherapy in primitive neuroectodermal tumor of the uterine corpus. American Journal of Obstetrics and Gynecology 200:2, e6-e9
CrossRef66
Kraiyot KIATSOONTORN, Toshihiro TAKAMI, Tsutomu ICHINOSE, Isao CHOKYU, Naohiro TSUYUGUCHI, Masahiko OHSAWA, Kenji OHATA. (2009) Primary Epidural Peripheral Primitive Neuroectodermal Tumor of the Thoracic Spine. Neurologia medico-chirurgica 49:11, 542-545
CrossRef67
Marie J Terrier-Lacombe, Louis Guillou, Frédéric Chibon, Gabrielle Gallagher, Jean Benhattar, Philippe Terrier, Dominique Ranchère, Jean-Michel Coindre. (2009) Superficial primitive Ewing's sarcoma: a clinicopathologic and molecular cytogenetic analysis of 14 cases. Modern Pathology 22:1, 87-94
CrossRef68
NOEL WEIDNER, GRACE Y. LIN, MICHAEL KYRIAKOS. 2009. Joint and Bone Pathology. , 1784-1840.
CrossRef69
Kei Hosoda, Yoshie Kadota, Masahiko Aoki, Hiromu Kido, Kingen Natsu, Hikaru Tamura, Masao Kojima, Tetsu Amemiya, Koichi Homma. (2009) A Case of Peripheral Primitive Neuroectodermal Tumor arising from Small Intestinal Mesentery. The Japanese Journal of Gastroenterological Surgery 42:6, 674-679
CrossRef70
Juan Carlos Pérez Marín, Rosa María Apolinario Hidalgo, Al Montaser Mohamad Tubío, Zenaida Santos Moyano, Pedro Peña Quintana, José Gómez Díaz. (2008) Varón de 25 años de edad con un tumor pancreático, diplopía y lesiones óseas. Gastroenterología y Hepatología 31:9, 626-628
CrossRef71
Yusuke Saito, Akinobu Matsuzaki, Aiko Suminoe, Yuhki Koga, Hiroaki Kurata, Yoshinao Oda, Masazumi Tsuneyoshi, Toshiro Hara. (2008) Congenital Ewing sarcoma in retroperitoneum with multiple metastases. Pediatric Blood & Cancer 51:5, 698-701
CrossRef72
Wenyin Shi, Daniel J. Indelicato, Sameer R. Keole, Christopher G. Morris, Mark T. Scarborough, Parker C. Gibbs, Robert A. Zlotecki. (2008) Radiation Treatment for Ewing Family of Tumors in Adults: The University of Florida Experience. International Journal of Radiation Oncology*Biology*Physics 72:4, 1140-1145
CrossRef73
José Luis Ordóñez, Ana Sofia Martins, Daniel Osuna, Juan Madoz–Gúrpide, Enrique de Alava. (2008) Targeting sarcomas: therapeutic targets and their rational. Seminars in Diagnostic Pathology 25:4, 304-316
CrossRef74
Dirk H.J. Verhoeven, Alfons S.K. de Hooge, Esther C.K. Mooiman, Susy Justo Santos, Monique M. ten Dam, Hans Gelderblom, Cornelis J.M. Melief, Pancras C.W. Hogendoorn, R. Maarten Egeler, Maarten J.D. van Tol, Marco W. Schilham, Arjan C. Lankester. (2008) NK cells recognize and lyse Ewing sarcoma cells through NKG2D and DNAM-1 receptor dependent pathways. Molecular Immunology 45:15, 3917-3925
CrossRef75
Shuichiro Uehara, Takaharu Oue, Akihiro Yoneda, Yoshiko Hashii, Hideaki Ohta, Masahiro Fukuzawa. (2008) Dumbbell-shaped Ewing’s sarcoma family of tumor of thoracic spine in a child. Pediatric Surgery International 24:8, 953-955
CrossRef76
Joseph A Ludwig. (2008) Ewing sarcoma: historical perspectives, current state-of-the-art, and opportunities for targeted therapy in the future. Current Opinion in Oncology 20:4, 412-418
CrossRef77
Anthony P Conley, Jonathan Trent, Wei Zhang. (2008) Recent progress in the genomics of soft tissue sarcomas. Current Opinion in Oncology 20:4, 395-399
CrossRef78
Aslan Güzel, Mehmet Tatli, Uygur Er, Fahri Yilmaz, Murad Bavbek. (2008) Multifocal Ewing’s sarcoma of the brain, calvarium, leptomeninges, spine and other bones in a child. Journal of Clinical Neuroscience 15:7, 813-817
CrossRef79
Pranshu Mohindra, Bhooshan Zade, Ayan Basu, Nikhilesh Patil, Seethalakshmi Viswanathan, Ashish Bakshi, Mary Ann Muckaden, Siddhartha Laskar. (2008) Primary PNET of Maxilla. Journal of Pediatric Hematology/Oncology 30:6, 474-477
CrossRef80
Julie M. Wu, Elizabeth Montgomery. (2008) Classification and Pathology. Surgical Clinics of North America 88:3, 483-520
CrossRef81
Patrick J Leavey, Anderson B Collier. (2008) Ewing sarcoma: prognostic criteria, outcomes and future treatment. Expert Review of Anticancer Therapy 8:4, 617-624
CrossRef82
Özgür Akbayır, Kemal Güngördük, Gülseren Rafioğlu, Ahmet Gülkılık, Ekrem Yavuz, Ali İsmet Tekirdağ, Engin Odabaş. (2008) Primary primitive neuroectodermal tumor of the uterus: a case report. Archives of Gynecology and Obstetrics 277:4, 345-348
CrossRef83
Paul Roberts, Susan A. Burchill, Samantha Brownhill, Catherine J. Cullinane, Colin Johnston, Mike J. Griffiths, Dom J. McMullan, Nick P. Bown, Stephen P. Morris, Ian J. Lewis. (2008) Ploidy and karyotype complexity are powerful prognostic indicators in the Ewing's sarcoma family of tumors: A study by the United Kingdom Cancer Cytogenetics and the Children's Cancer and Leukaemia Group. Genes, Chromosomes and Cancer 47:3, 207-220
CrossRef84
Ana C. Donadio, Carolina Lobo, Marta Tosina, Vanessa de la Rosa, Mercedes Martín-Rufián, José A. Campos-Sandoval, José M. Matés, Javier Márquez, Francisco J. Alonso, Juan A. Segura. (2008) Antisense glutaminase inhibition modifies the O-GlcNAc pattern and flux through the hexosamine pathway in breast cancer cells. Journal of Cellular Biochemistry 103:3, 800-811
CrossRef85
S S Myatt, S A Burchill. (2008) The sensitivity of the Ewing's sarcoma family of tumours to fenretinide-induced cell death is increased by EWS-Fli1-dependent modulation of p38MAPK activity. Oncogene 27:7, 985-996
CrossRef86
Elizabeth D. Euscher, Michael T. Deavers, Dolores Lopez-Terrada, Alexander J. Lazar, Elvio G. Silva, Anais Malpica. (2008) Uterine Tumors With Neuroectodermal Differentiation. The American Journal of Surgical Pathology 32:2, 219-228
CrossRef87
Nobuaki Ishii, Hiroaki Hiraga, Yutaka Sawamura, Yumiko Shinohe, Kazuo Nagashima. (2008) Alternative EWS-FLI1 fusion gene and MIC2 expression in peripheral and central primitive neuroectodermal tumors. Neuropathology 21:1, 40
CrossRef88
Winnie A. Mar, Mihra S. Taljanovic, Rochelle Bagatell, Anna R. Graham, Donald P. Speer, Tim B. Hunter, Lee F. Rogers. (2008) Update on Imaging and Treatment of Ewing Sarcoma Family Tumors. Journal of Computer Assisted Tomography 32:1, 108-118
CrossRef89
Misa Hirukawa, Seiichi Nobuyama, Junko Saji, Masahiro Hoshikawa, Masayuki Takagi, Masashi Andou, Teruomi Miyazawa, Kenzo Hiroshima. (2008) A Case of Primitive Neuroectodermal Tumor Detected by Chest X-ray. Haigan 48:4, 341-342
CrossRef90
Beatrice M Seddon, Jeremy S Whelan. (2008) Emerging Chemotherapeutic Strategies and the Role of Treatment Stratification in Ewing Sarcoma. Pediatric Drugs 10:2, 93-105
CrossRef91
Joseph D Khoury. (2008) Ewing sarcoma family of tumors: a model for the new era of integrated laboratory diagnostics. Expert Review of Molecular Diagnostics 8:1, 97-105
CrossRef92
Kanya Honoki, Elizabeth Stojanovski, Mark McEvoy, Hiromasa Fujii, Toshifumi Tsujiuchi, Akira Kido, Yoshinori Takakura, John Attia. (2007) Prognostic significance ofp16INK4a alteration for Ewing sarcoma. Cancer 110:6, 1351-1360
CrossRef93
Lu Wang, Rohit Bhargava, Tao Zheng, Leonard Wexler, Margaret H. Collins, Diane Roulston, Marc Ladanyi. (2007) Undifferentiated Small Round Cell Sarcomas with Rare EWS Gene Fusions. The Journal of Molecular Diagnostics 9:4, 498-509
CrossRef94
I. Alldinger, K. L. Schaefer, D. Goedde, L. Ottaviano, U. Dirksen, A. Ranft, H. Juergens, H. E. Gabbert, W. T. Knoefel, C. Poremba. (2007) Microsatellite instability in Ewing tumor is not associated with loss of mismatch repair protein expression. Journal of Cancer Research and Clinical Oncology 133:10, 749-759
CrossRef95
J. Ross, I. R. Whittle, S. Fleming, K. M. Kurian. (2007) Cerebral metastasis of peripheral primitive neuroectodermal tumour (pPNET) ? use of cytogenetic abnormalities in diagnosis. Neuropathology and Applied Neurobiology 33:4, 471-474
CrossRef96
Jennifer Milspaw Blattner, Preston Gable, Michael M. Quigley, Michael T. McHale. (2007) Primitive neuroectodermal tumor of the uterus. Gynecologic Oncology 106:2, 419-422
CrossRef97
Michael S. Waugh, Rajesh C. Dash, Kristi C. Turner, Leslie G. Dodd. (2007) Desmoplastic small round cell tumor: Using FISH as an ancillary technique to support cytologic diagnosis in an unusual case. Diagnostic Cytopathology 35:8, 516-520
CrossRef98
S C Brownhill, C Taylor, S A Burchill. (2007) Chromosome 9p21 gene copy number and prognostic significance of p16 in ESFT. British Journal of Cancer 96:12, 1914-1923
CrossRef99
Sven Perner, Juan-Miguel Mosquera, Francesca Demichelis, Matthias D. Hofer, Pamela L. Paris, Jeff Simko, Colin Collins, Tarek A. Bismar, Arul M. Chinnaiyan, Angelo M. De Marzo, Mark A. Rubin. (2007) TMPRSS2-ERG Fusion Prostate Cancer: An Early Molecular Event Associated With Invasion. The American Journal of Surgical Pathology 31:6, 882-888
CrossRef100
Torsten Ehrig, Steven D. Billings, Julie C. Fanburg-Smith. (2007) Superficial primitive neuroectodermal tumor/Ewing sarcoma (PN/ES): same tumor as deep PN/ES or new entity?. Annals of Diagnostic Pathology 11:3, 153-159
CrossRef101
Syed Ali Jaffar Kazmi, Arie Perry, Joseph G. Pressey, John C. Wellons, Yuki Hammers, Cheryl Ann Palmer. (2007) Primary Ewing Sarcoma of the Brain. Diagnostic Molecular Pathology 16:2, 108-111
CrossRef102
Franck Maisonnette, Étienne Roux, Thiare Abita, Stéphanie Martin, Isabelle Pommepuy, Sylvaine Durand-Fontanier, Denis Valleix, Bernard Descottes, Bernard Pillegand. (2007) À propos d’un sarcome d’Ewing du mésocôlon. Gastroentérologie Clinique et Biologique 31:5, 552-554
CrossRef103
I Yaniv, J Stein, D Luria, I J Cohen, E Liberzon, S Manor, A Grunshpan, Y Sverdlov, Y Kodman, J Issakov, M Feinmesser, R Zaizov, S Avigad. (2007) Ewing Sarcoma tumor cells express CD34: implications for autologous stem cell transplantation. Bone Marrow Transplantation 39:10, 589-594
CrossRef104
Frank Baliko, Tamara Bright, Raymond Poon, Brenda Cohen, Sean E. Egan, Benjamin A. Alman. (2007) Inhibition of Notch Signaling Induces Neural Differentiation in Ewing Sarcoma. The American Journal of Pathology 170:5, 1686-1694
CrossRef105
K Yamada, M Takahashi, M Ogura, Y Kagami, H Taji, Y Kamiya, H Sugiura, Y Morishima. (2007) High-dose chemotherapy and autologous peripheral blood stem cell transfusion for adult and adolescent patients with small round cell sarcomas. Bone Marrow Transplantation 39:8, 471-476
CrossRef106
Heidrun Holland, Ronald Koschny, Wolfgang Krupp, Jürgen Meixensberger, Manfred Bauer, Holger Kirsten, Peter Ahnert. (2007) Comprehensive cytogenetic characterization of an esthesioneuroblastoma. Cancer Genetics and Cytogenetics 173:2, 89-96
CrossRef107
F. Chibon, A. Aurias. (2007) Biologie moléculaire des sarcomes des tissus mous. Oncologie 9:2, 88-96
CrossRef108
Christiane Franzius, Marc Hotfilder, Christopher Poremba, Sven Hermann, Klaus Schäfers, Helmut Erich Gabbert, Heribert Jürgens, Otmar Schober, Michael Schäfers, Josef Vormoor. (2006) Successful high-resolution animal positron emission tomography of human Ewing tumours and their metastases in a murine xenograft model. European Journal of Nuclear Medicine and Molecular Imaging 33:12, 1432-1441
CrossRef109
J Vermeulen, S Ballet, O Oberlin, M Peter, G Pierron, E Longavenne, V Laurence, J Kanold, P Chastagner, O Lejars, J-Y Blay, P Marec-Berard, J Michon, O Delattre, G Schleiermacher. (2006) Incidence and prognostic value of tumour cells detected by RT–PCR in peripheral blood stem cell collections from patients with Ewing tumour. British Journal of Cancer 95:10, 1326-1333
CrossRef110
Hiroyuki Shimada, Atsuko Nakagawa. (2006) Pathology of the Peripheral Neuroblastic Tumors. Laboratory Medicine 37:11, 684-689
CrossRef111
Julie Mathieu, Françoise Besançon. (2006) Clinically tolerable concentrations of arsenic trioxide induce p53-independent cell death and repress NF-κB activation in Ewing sarcoma cells. International Journal of Cancer 119:7, 1723-1727
CrossRef112
Smadar Avigad, Isaac Yaniv. (2006) Novel approaches for the management of patients with Ewing sarcoma. Future Oncology 2:5, 659-665
CrossRef113
Fernando A. Ferrer, Michael Isakoff, Martin A. Koyle. (2006) Bladder/Prostate Rhabdomyosarcoma: Past, Present and Future. The Journal of Urology 176:4, 1283-1291
CrossRef114
Mark A Rubin, Arul M Chinnaiyan. (2006) Bioinformatics approach leads to the discovery of the TMPRSS2:ETS gene fusion in prostate cancer. Laboratory Investigation
CrossRef115
Y.M. Dennis Lo, Ching-Wan Lam, Ivy H.N. Wong. 2006. Molecular Biological Analyses and Molecular Pathology in Clinical Chemistry. .
CrossRef116
Minoru Hamazaki, Hajime Okita, Jun-ichi Hata, Shin-ichi Shimizu, Hiroshi Kobayashi, Katsuhiko Aoki, Taemi Nara. (2006) Desmoplastic small cell tumor of soft tissue: Molecular variant of EWS-WT1 chimeric fusion. Pathology International 56:9, 543-548
CrossRef117
Tim H. Lee, Marcela F. Bolontrade, Laura L. Worth, Hui Guan, Lee M. Ellis, Eugenie S. Kleinerman. (2006) Production of VEGF165 by Ewing's sarcoma cells induces vasculogenesis and the incorporation of CD34+ stem cells into the expanding tumor vasculature. International Journal of Cancer 119:4, 839-846
CrossRef118
Jörg Ellinger, Patrick J. Bastian, Stefan Hauser, Katharina Biermann, Stefan C. Müller. (2006) Primitive neuroectodermal tumor: Rare, highly aggressive differential diagnosis in urologic malignancies. Urology 68:2, 257-262
CrossRef119
Annikka Weissferdt, Kim Neuling, Martin English, Suren Arul, Dominic McMullan, Alison Ely, Marie-Anne Bründler, Rachel Brown. (2006) Peripheral Primitive Neuroectodermal Tumor with Postchemotherapy Neuroblastoma-like Differentiation. Pediatric and Developmental Pathology 9:3, 229-233
CrossRef120
Najmedden A. Attabib, Michael West, Roy H. Rhodes. (2006) Peripheral Primitive Neuroectodermal Tumor of the Cavernous Sinus: Case Report. Neurosurgery 58:5, E992
CrossRef121
Giuseppe Maria Milano, Raffaele Cozza, Ilaria Ilari, Luigi De Sio, Renata Boldrini, Alessandro Jenkner, Maretta De Ioris, Alessandro Inserra, Carlo Dominici, Alberto Donfrancesco. (2006) High histologic and overall response to dose intensification of ifosfamide, carboplatin, and etoposide with cyclophosphamide, doxorubicin, and vincristine in patients with high-risk ewing sarcoma family tumors. Cancer 106:8, 1838-1845
CrossRef122
Gino R. Somers, Abha A. Gupta, Andrea S. Doria, Michael Ho, Carlos Pereira, Mary Shago, Paul S. Thorner, Maria Zielenska. (2006) Pediatric Undifferentiated Sarcoma of the Soft Tissues: A Clinicopathologic Study. Pediatric and Developmental Pathology 9:2, 132-142
CrossRef123
D C Mangham, A Williams, D J McMullan, J McClure, V P Sumathi, R J Grimer, A M Davies. (2006) Ewing's sarcoma of bone: the detection of specific transcripts in a large, consecutive series of formalin-fixed, decalcified, paraffin-embedded tissue samples using the reverse transcriptase-polymerase chain reaction. Histopathology 48:4, 363-376
CrossRef124
Eugene TH Ek, Peter FM Choong. (2006) The role of high-dose therapy and autologous stem cell transplantation for pediatric bone and soft tissue sarcomas. Expert Review of Anticancer Therapy 6:2, 225-237
CrossRef125
J. Potratz, A. Zoubek, S. Bielack. (2006) Maligne Knochentumoren bei Kindern und Jugendlichen. Monatsschrift Kinderheilkunde 154:1, 10-19
CrossRef126
David R Shaffer, Pier Paolo Pandolfi. (2006) Breaking the rules of cancer. Nature Medicine 12:1, 14-15
CrossRef127
Kenji Yamada, Hideshi Sugiura, Mitsuru Takahashi. (2006) Single center experience of treatment of Ewing's family of tumors in Japan. Journal of Orthopaedic Science 11:1, 34-41
CrossRef128
Shuji Isefuku, Masahiro Seki, Takahiro Tajino, Michiyuki Hakozaki, Shigeyuki Asano, Hiroshi Hojo, Masahito Hatori. (2006) Ewing's Sarcoma in the Spinal Nerve Root: A Case Report and Review of the Literature. The Tohoku Journal of Experimental Medicine 209:4, 369-377
CrossRef129
Mark C. Gebhardt, John A. Abraham. 2006. Pediatric Musculoskeletal Tumors About the Knee. , 487-500.
CrossRef130
Robert S Bridge, Veena Rajaram, Louis P Dehner, John D Pfeifer, Arie Perry. (2006) Molecular diagnosis of Ewing sarcoma/primitive neuroectodermal tumor in routinely processed tissue: a comparison of two FISH strategies and RT-PCR in malignant round cell tumors. Modern Pathology 19:1, 1-8
CrossRef131
Tam??s Gy??rke, Thomas Zajic, Alexander Lange, Oliver Sch??fer, Ernst Moser, Ern?? Mak??, Ingo Brink. (2006) Impact of FDG PET for staging of Ewing sarcomas and primitive neuroectodermal tumours. Nuclear Medicine Communications 27:1, 17-24
CrossRef132
Gino R Somers, Sandra Viero, Paul C Nathan, Ikuko Teshima, Carlos Pereira, Maria Zielenska. (2005) Association of the t(12;22)(q13;q12) EWS/ATF1 Rearrangement With Polyphenotypic Round Cell Sarcoma of Bone. The American Journal of Surgical Pathology 29:12, 1673-1679
CrossRef133
Eva Bandr??s, Raquel Malumbres, Alvaro Escalada, Elena Cubedo, Iranzu Gonz??lez, Beatriz Honorato, Ruth Zarate, Jesus Garc??a-Foncillas, Enrique de Alava. (2005) Gene Expression Profile of Ewing Sarcoma Cell Lines Differing in Their EWS-FLI1 Fusion Type. Journal of Pediatric Hematology/Oncology 27:10, 537-542
CrossRef134
U. Dirksen, C. Poremba, A. Schuck. (2005) Knochentumoren des Kindes- und Jugendalters. Der Onkologe 11:10, 1034-1046
CrossRef135
Joseph D Khoury. (2005) Ewing Sarcoma Family of Tumors. Advances in Anatomic Pathology 12:4, 212-220
CrossRef136
María Jesús Antuña García. (2005) Ewing’s sarcoma family of tumors. Clinical and Translational Oncology 7:6, 262-269
CrossRef137
Oskar A. Haas. (2005) Genetische Diagnostik in der pädiatrischen Onkologie Genetic diagnosis in pediatric oncology. LaboratoriumsMedizin 29:3, 162-175
CrossRef138
Richard Carvajal, Paul Meyers. (2005) Ewing's Sarcoma and Primitive Neuroectodermal Family of Tumors. Hematology/Oncology Clinics of North America 19:3, 501-525
CrossRef139
Val??rie Laurence, Jean-Yves Pierga, Sophie Barthier, Antoine Babinet, Claire Alapetite, Thao Palangi??, Gonzagues de Pinieux, Philippe Anract, Pierre Pouillart. (2005) Long-Term Follow Up of High-Dose Chemotherapy With Autologous Stem Cell Rescue in Adults With Ewing Tumor. American Journal of Clinical Oncology 28:3, 301-309
CrossRef140
T. Parija, S. Shirley, S. Uma, K. R. Rajalekshmy, S. Ayyappan, T. Rajkumar. (2005) Type 1 (11; 22)(q24: q12) translocation is common in Ewing’s sarcoma/ peripheral neuroectodermal tumour in south Indian patients. Journal of Biosciences 30:3, 371-376
CrossRef141
Christine Siligan, Jozef Ban, Radostina Bachmaier, Laura Spahn, Michael Kreppel, Karl-Ludwig Schaefer, Christopher Poremba, Dave N T Aryee, Heinrich Kovar. (2005) EWS-FLI1 target genes recovered from Ewing's sarcoma chromatin. Oncogene 24:15, 2512-2524
CrossRef142
Cynthia E Herzog. (2005) Overview of Sarcomas in the Adolescent and Young Adult Population. Journal of Pediatric Hematology/Oncology 27:4, 215-218
CrossRef143
Seong-Ho Yoo, Jungho Han, Tae Jin Kim, Doo Hyun Chung. (2005) Expression of CD99 in Pleomorphic Carcinomas of the Lung. Journal of Korean Medical Science 20:1, 50
CrossRef144
Mi Seon Kang, Hye Kyoung Yoon, Jung Bae Choi, Jae Wook Eum. (2005) Extraskeletal Ewing's Sarcoma of the Hard Palate. Journal of Korean Medical Science 20:4, 687
CrossRef145
Ralph Czekalla, Martin Fuchs, Angela St??lzle, Andreas Nerlich, Christopher Poremba, Karl-Ludwig Schaefer, Gregor Weirich, Heinz H??fler, Folker Schneller, Christian Peschel, J??rg R??diger Siewert, Wolfgang Schepp. (2004) Peripheral primitive neuroectodermal tumor of the stomach in a 14-year-old boy. European Journal of Gastroenterology & Hepatology 16:12, 1391-1400
CrossRef146
Gino R. Somers, Mary Shago, Maria Zielenska, Helen S.L. Chan, Bo Y. Ngan. (2004) Primary Subcutaneous Primitive Neuroectodermal Tumor with Aggressive Behavior and an Unusual Karyotype: Case Report. Pediartic and Development Pathology 7:5, 538-545
CrossRef147
Giin Kara. (2004) Spinal cord Ewing’s sarcoma metastasis: presentation of one case. Annals of Nuclear Medicine 18:7, 623-626
CrossRef148
Frederic G Barr. (2004) Diagnostic applications of chromosomal translocations in bone and soft tissue sarcomas. Expert Review of Molecular Diagnostics 4:5, 579-582
CrossRef149
Fabio Bozzi, Roberto Luksch, Paola Collini, Felicita Gambirasio, Elena Barzanò, Daniela Polastri, Marta Podda, Bruno Brando, Franca Fossati-Bellani. (2004) Molecular Detection of Dopamine Decarboxylase Expression by Means of Reverse Transcriptase and Polymerase Chain Reaction in Bone Marrow and Peripheral Blood. Diagnostic Molecular Pathology 13:3, 135-143
CrossRef150
Carlos Rodriguez-Galindo. (2004) Pharmacological management of Ewing sarcoma family of tumours. Expert Opinion on Pharmacotherapy 5:6, 1257-1270
CrossRef151
Tarek A Bismar, Olca Basturk, William L Gerald, Karl Schwarz, N Volkan Adsay. (2004) Desmoplastic Small Cell Tumor in the Pancreas. The American Journal of Surgical Pathology 28:6, 808-812
CrossRef152
I. Yaniv, I.J. Cohen, J. Stein, J. Zilberstein, E. Liberzon, O. Atlas, A. Grunshpan, Y. Sverdlov, S. Ash, R. Zaizov, S. Avigad. (2004) Tumor cells are present in stem cell harvests of Ewings sarcoma patients and their persistence following transplantation is associated with relapse. Pediatric Blood & Cancer 42:5, 404-409
CrossRef153
Ulrike Bockmühl, Xuejun You, Manuela Pacyna-Gengelbach, Hartmut Arps, Wolfgang Draf, Iver Petersen. (2004) CGH Pattern of Esthesioneuroblastoma and their Metastases. Brain Pathology 14:2, 158-163
CrossRef154
Bielack, Stefan S., Paulussen, Michael, , Köhler, Gabriele, . (2004) A Patient with Two Ewing's Sarcomas with Distinct EWS Fusion Transcripts. New England Journal of Medicine 350:13, 1364-1365
Full Text155
K.-J. Kim, B.-W. Jang, S.-K. Lee, B.-K. Kim, S.-L. Nam. (2004) A case of peripheral primitive neuroectodermal tumor of the ovary. International Journal of Gynecological Cancer 14:2, 370-372
CrossRef156
Smadar Avigad, Ian J. Cohen, Julia Zilberstein, Ella Liberzon, Yacov Goshen, Shifra Ash, Isaac Meller, Yehuda Kollender, Josephine Issakov, Rina Zaizov, Isaac Yaniv. (2004) The predictive potential of molecular detection in the nonmetastatic Ewing family of tumors. Cancer 100:5, 1053-1058
CrossRef157
Kunle Odunsi, Moshood Olatinwo, Yvonne Collins, Matthew Withiam-Leitch, Shashikant Lele, Gregory W Spiegel. (2004) Primary primitive neuroectodermal tumor of the uterus: a report of two cases and review of the literature. Gynecologic Oncology 92:2, 689-696
CrossRef158
Stefania Benini, Maria Cristina Manara, Vanessa Cerisano, Stefania Perdichizzi, Rosaria Strammiello, Massimo Serra, Piero Picci, Katia Scotlandi. (2004) Contribution of MEK/MAPK and PI3-K signaling pathway to the malignant behavior of Ewing's sarcoma cells: Therapeutic prospects. International Journal of Cancer 108:3, 358-366
CrossRef159
Yoko TAKAGI-TAKAHASHI, Noriharu SHIJUBO, Gen YAMADA, Eri SAITOH, Kaku SAWADA, Tetsuro OHNISHI, Takayuki ITOH, Toyohiro SAIKAI, Tatsuru IKEDA, Sachiko KIMURA, Hiroki TAKAHASHI, Shosaku ABE. (2004) Peripheral Primitive Neuroectodermal Tumor of the Chest Wall of a 69-year-old Man. Internal Medicine 43:7, 578-581
CrossRef160
Bhaskar N. Rao, Carlos Rodriguez-Galindo. (2003) Local control in childhood extremity sarcomas: Salvaging limbs and sparing function. Medical and Pediatric Oncology 41:6, 584-587
CrossRef161
Katsumi Harimaya, Yoshinao Oda, Shuichi Matsuda, Kazuhiro Tanaka, Hirokazu Chuman, Yukihide Iwamoto. (2003) Primitive Neuroectodermal Tumor and Extraskeletal Ewing Sarcoma Arising Primarily Around the Spinal Column. Spine 28:19, E408-E412
CrossRef162
Paola Collini, Alessandra Mezzelani, Piergiorgio Modena, Paolo Dagrada, Elena Tamborini, Roberto Luksch, Alessandro Gronchi, Pierina Navarria, Gabriella Sozzi, Silvana Pilotti. (2003) Evidence of Neural Differentiation in a Case of Post-therapy Primitive Neuroectodermal Tumor/Ewing Sarcoma of Bone. The American Journal of Surgical Pathology 27:8, 1161-1166
CrossRef163
J M Coindre. (2003) Immunohistochemistry in the diagnosis of soft tissue tumours. Histopathology 43:1, 1-16
CrossRef164
Carlos Rodriguez-Galindo, Sheri L. Spunt, Alberto S. Pappo. (2003) Treatment of Ewing sarcoma family of tumors: Current status and outlook for the future. Medical and Pediatric Oncology 40:5, 276-287
CrossRef165
Goichi Watanabe, Hiroyuki Nishimori, Hideto Irifune, Yasushi Sasaki, Setsuko Ishida, Hitoshi Zembutsu, Toshihiro Tanaka, Satoshi Kawaguchi, Takuro Wada, Jun-ichi Hata, Moriaki Kusakabe, Koichi Yoshida, Yusuke Nakamura, Takashi Tokino. (2003) Induction of tenascin-C by tumor-specificEWS-ETS fusion genes. Genes, Chromosomes and Cancer 36:3, 224-232
CrossRef166
M. J. Levine, J. S. Meyer, B. R. Pawel, J. P. Dormans. (2002) Ankle Pain in an 8-Year-Old Boy. Clinical Orthopaedics and Related Research 405, 306-310, 320-325
CrossRef167
Mei Hu, Garth L. Nicolson, Jonathan C. Trent, Dihua Yu, Lianglin Zhang, Aiqing Lang, Ann Killary, Lee M. Ellis, Corazon D. Bucana, Raphael E. Pollock. (2002) Characterization of 11 human sarcoma cell strains. Cancer 95:7, 1569-1576
CrossRef168
T. Ozaki. (2002) Population-based genetic alterations in Ewing's tumors from Japanese and European Caucasian patients. Annals of Oncology 13:10, 1656-1664
CrossRef169
Douglas S. Hawkins, Judy Felgenhauer, Julie Park, Susan Kreissman, Blythe Thomson, James Douglas, Scott D. Rowley, Ted Gooley, Jean E. Sanders, Thomas W. Pendergrass. (2002) Peripheral blood stem cell support reduces the toxicity of intensive chemotherapy for children and adolescents with metastatic sarcomas. Cancer 95:6, 1354-1365
CrossRef170
D. Ashley Hill, Maureen J. O'Sullivan, Xiaopei Zhu, Robin T. Vollmer, Peter A. Humphrey, Louis P. Dehner, John D. Pfeifer. (2002) Practical Application of Molecular Genetic Testing as an Aid to the Surgical Pathologic Diagnosis of Sarcomas. The American Journal of Surgical Pathology 26:8, 965-977
CrossRef171
Marick E. Lae, Patrick C. Roche, Long Jin, Ricardo V. Lloyd, Antonio G. Nascimento. (2002) Desmoplastic Small Round Cell Tumor. The American Journal of Surgical Pathology 26:7, 823-835
CrossRef172
Timothy B. Rapp, Liu Yang, Ernest U. Conrad, Nils Mandahl, Howard A. Chansky. (2002) RNA splicing mediated by YB-1 is inhibited by TLS/CHOP in human myxoid liposarcoma cells. Journal of Orthopaedic Research 20:4, 723-729
CrossRef173
C M Hattinger, U Pötschger, M Tarkkanen, J Squire, M Zielenska, S Kiuru-Kuhlefelt, L Kager, P Thorner, S Knuutila, F K Niggli, P F Ambros, H Gadner, D R Betts. (2002) Prognostic impact of chromosomal aberrations in Ewing tumours. British Journal of Cancer 86:11, 1763-1769
CrossRef174
M Colecchia, G P Dagrada, P L Poliani, S Pilotti. (2002) Immunophenotypic and genotypic analysis of a case of primary peripheral primitive neuroectodermal tumour (pPNET) of the urinary bladder. Histopathology 40:1, 108-109
CrossRef175
Timothy J. Triche. 2002. Ewing's Sarcoma (Ewing's Family Tumors). , 197-207.
CrossRef176
F Milanezi, E M Pereira, F V Ferreira, D Leitao, F C Schmitt. (2001) CD99/MIC-2 surface protein expression in breast carcinomas. Histopathology 39:6, 578-583
CrossRef177
Brian P. Rubin, Jonathan A. Fletcher. (2001) Molecular alterations in sarcomas. Current Opinion in Orthopaedics 12:6, 519-525
CrossRef178
F.A Scappaticci, N Marina. (2001) New molecular targets and biological therapies in sarcomas. Cancer Treatment Reviews 27:6, 317-326
CrossRef179
Tony W.H. Shek, Godfrey C.F. Chan, P. L. Khong, L. P. Chung, Annie N.Y. Cheung. (2001) Ewing Sarcoma of the Small Intestine. Journal of Pediatric Hematology/Oncology 23:8, 530-532
CrossRef180
Robert J. Weil, Zhengping Zhuang, Svetlana Pack, Shimareet Kumar, Lee Helman, Brian G. Fuller, Crystall L. Mackall, Edward H. Oldfield. (2001) Intramedullary Ewing sarcoma of the spinal cord: consequences of molecular diagnostics. Journal of Neurosurgery: Spine 95:2, 270-275
CrossRef181
Toshifumi Ozaki, Michael Paulussen, Christopher Poremba, Christian Brinkschmidt, Julio Rerin, Susanne Ahrens, Christiane Hoffmann, Axel Hillmann, Daniel Wai, Karl-Ludwig Schaefer, Werner Boecker, Heribert Juergens, Winfried Winkelmann, Barbara Dockhorn-Dworniczak. (2001) Genetic imbalances revealed by comparative genomic hybridization in Ewing tumors. Genes, Chromosomes and Cancer 32:2, 164-171
CrossRef182
Keisuke Kato, Yoshikazu Kato, Rieko Ijiri, Kazuaki Misugi, Ikuko Nanba, Jun-Ichi Nagai, Noriyuki Nagahara, Hisato Kigasawa, Yasunori Toyoda, Toshiji Nishi, Yukichi Tanaka. (2001) Ewing's sarcoma family of tumor arising in the adrenal gland-Possible diagnostic pitfall in pediatric pathology: Histologic, immunohistochemical, ultrastructural, and molecular study. Human Pathology 32:9, 1012-1016
CrossRef183
Antonio Llombart-Bosch, Samuel Navarro. (2001) Applied Immunohistochemistry 9:3, 255-260
CrossRef184
E. Hauben, L. C. J. M. van den Broek, E. Van Marck, P. C. W. Hogendoorn. (2001) Adamantinoma-like Ewing's sarcoma and Ewing's-like adamantinoma. The t(11; 22), t(21; 22) status. The Journal of Pathology 195:2, 218-221
CrossRef185
P Mukhopadhyay, M Gairola, MC Sharma, S Thulkar, PK Julka, GK Rath. (2001) Primary spinal epidural extraosseous Ewing's sarcoma: Report of five cases and literature review. Australasian Radiology 45:3, 372-379
CrossRef186
Lakshmi Venkateswaran, Carlos Rodriguez-Galindo, Thomas E. Merchant, Catherine A. Poquette, Bhaskar N. Rao, Alberto S. Pappo. (2001) Primary Ewing tumor of the vertebrae: Clinical characteristics, prognostic factors, and outcome. Medical and Pediatric Oncology 37:1, 30-35
CrossRef187
C Pinkerton. (2001) Treatment strategies for metastatic Ewing's sarcoma. European Journal of Cancer 37:11, 1338-1344
CrossRef188
Frank Willeke, Joerg W. Sturm. (2001) Minimal residual disease in soft-tissue sarcomas. Seminars in Surgical Oncology 20:4, 294-303
CrossRef189
Nicolas Sirvent, Anita L. Hawkins, Daniel Moeglin, Jean-Michel Coindre, Jean-Yves Kurzenne, Jean-Fran
ois Michiels, Gis
CrossRef190
Ramzi Dagher, Thu Anh Pham, Lynn Sorbara, Shimareet Kumar, Lauren Long, Donna Bernstein, Crystal Mackall, Mark Raffeld, Maria Tsokos, Lee Helman. (2001) Molecular Confirmation of Ewing Sarcoma. Journal of Pediatric Hematology/Oncology 23:4, 221-224
CrossRef191
JOSEF VORMOOR, GUDRUN BAERSCH, STEPHAN DECKER, MARC HOTFILDER, KARL-LUDWIG SCH??FER, LUTZ PELKEN, CRISTIAN R??BE, FRANS VAN VALEN, HERIBERT J??RGENS, BARBARA DOCKHORN-DWORNICZAK. (2001) Establishment of an In Vivo Model for Pediatric Ewing Tumors by Transplantation into NOD/ scid Mice. Pediatric Research 49:3, 332-341
CrossRef192
Nobuaki Ishii, Hiroaki Hiraga, Yutaka Sawamura, Yumiko Shinohe, Kazuo Nagashima. (2001) Alternative EWS-FLI1 fusion gene and MIC2 expression in peripheral and central primitive neuroectodermal tumors. Neuropathology 21:1, 40-44
CrossRef193
Rosa Noguera, Antonio Pell??n, Samuel Navarro, Carmen Carda, Antonio Llombart???Bosch. (2001) Translocation (10;11;22)(p14;q24;q12) Characterized by Fluorescence in Situ Hybridization in a Case of Ewing's Tumor. Diagnostic Molecular Pathology 10:1, 2-8
CrossRef194
Uma H. Athale, Sheila A. Shurtleff, Jesse J. Jenkins, Catherine A. Poquette, Ming Tan, James R. Downing, Alberto S. Pappo. (2001) Use of Reverse Transcriptase Polymerase Chain Reaction for Diagnosis and Staging of Alveolar Rhabdomyosarcoma, Ewing Sarcoma Family of Tumors, and Desmoplastic Small Round Cell Tumor. Journal of Pediatric Hematology/Oncology 23:2, 99-104
CrossRef195
Michael Paulussen, Birgit Fr??hlich, Herbert J??rgens. (2001) Ewing Tumour. Paediatric Drugs 3:12, 899-913
CrossRef196
William J. Fredericks, Kasirajan Ayyanathan, Frank J. Rauscher. (2001) Regulating the neoplastic phenotype using engineered transcriptional repressors. Cancer Letters 162, S23-S32
CrossRef197
Gregory Lambert, Jean Rémi Bertrand, Elias Fattal, Frédéric Subra, Huguette Pinto-Alphandary, Claude Malvy, Christian Auclair, Patrick Couvreur. (2000) EWS Fli-1 Antisense Nanocapsules Inhibits Ewing Sarcoma-Related Tumor in Mice. Biochemical and Biophysical Research Communications 279:2, 401-406
CrossRef198
Makoto Kuroda, Makoto Urano, Masato Abe, Yoshikazu Mizoguchi, Yoshimune Horibe, Masamoto Murakami, Kazuhiro Tashiro, Masao Kasahara. (2000) Primary primitive neuroectodermal tumor of the kidney. Pathology International 50:12, 967-972
CrossRef199
Brian P. Rubin, Michael R. Pins, G. Petur Nielsen, Seymour Rosen, Bae-Li Hsi, Jonathan A. Fletcher, Andrew A. Renshaw. (2000) Isochromosome 7q in Adult Wilms' Tumors: Diagnostic and Pathogenetic Implications. The American Journal of Surgical Pathology 24:12, 1663-1669
CrossRef200
Katia Scotlandi, Stefania Benini, Maria Cristina Manara, Massimo Serra, Patrizia Nanni, Pier-Luigi Lollini, Giordano Nicoletti, Lorena Landuzzi, Tokuhiro Chano, Piero Picci, Nicola Baldini. (2000) Murine model for skeletal metastases of Ewing's sarcoma. Journal of Orthopaedic Research 18:6, 959-966
CrossRef201
Antonio Llombart-Bosch, Antonio Pellín, Carmen Carda, Rosa Noguera, Samuel Navarro, Amando Peydró-Olaya. (2000) Soft Tissue Ewing Sarcoma–Peripheral Primitive Neuroectodermal Tumor With Atypical Clear Cell Pattern Shows a New Type of EWS-FEV Fusion Transcript. Diagnostic Molecular Pathology 9:3, 137-144
CrossRef202
Enrique de Alava, Cristina R. Antonescu, Angel Panizo, Denis Leung, Paul A. Meyers, Andrew G. Huvos, F. Javier Pardo-Mind
CrossRef203
Guo Wei, Cristina R. Antonescu, Enrique de Alava, Denis Leung, Andrew G. Huvos, Paul A. Meyers, John H. Healey, Marc Ladanyi. (2000) Prognostic impact of INK4A deletion in Ewing sarcoma. Cancer 89:4, 793-799
CrossRef204
Katia Scotlandi, Tokuhiro Chano, Stefania Benini, Massimo Serra, Maria Cristina Manara, Vanessa Cerisano, Piero Picci, Nicola Baldini. (2000) Identification of EWS/FLI-1 transcripts in giant-cell tumor of bone. International Journal of Cancer 87:3, 328-335
CrossRef205
Daniel C. West. (2000) Ewing sarcoma family of tumors. Current Opinion in Oncology 12:4, 323-329
CrossRef206
Jonathan J. Dutton, John G. Rose, Christopher M. DeBacker, Gregg Gayre. (2000) Orbital Ewing???s Sarcoma of the Orbit. Ophthalmic Plastic and Reconstructive Surgery 16:4, 292-300
CrossRef207
Anselm C.W. Lee, Yiu-Chung Wong, Shing-Hoi Fung, Ngai-Shan Kwong, King-Yiu Tsui, Alan D. Ramsay. (2000) Congenital sacrococcygeal primitive neuroectodermal tumor. Medical and Pediatric Oncology 34:6, 448-450
CrossRef208
Paul A. Meyers, Adam S. Levy. (2000) Ewing’s sarcoma. Current Treatment Options in Oncology 1:3, 247-257
CrossRef209
Philip M. Rosoff, Sandra Hatcher, Daniel C. West. (2000) Biphenotypic sarcoma with characteristics of both a Ewing sarcoma and a desmoplastic small round cell tumor. Medical and Pediatric Oncology 34:6, 407-412
CrossRef210
Prasanna Sinkre, Jorge Albores-Saavedra, David S. Miller, Larry J. Copeland, Arif Hameed. (2000) Endometrial Endometrioid Carcinomas Associated with Ewing Sarcoma/Peripheral Primitive Neuroectodermal Tumor. International Journal of Gynecological Pathology 19:2, 127-132
CrossRef211
José Miguel Herrera, Alfred Krebs, Paul Harris, Francisco Barriga. (2000) CHILDHOOD TUMORS. Surgical Clinics of North America 80:2, 747-760
CrossRef212
Enrique de Alava, Angel Panizo, Cristina R. Antonescu, Andrew G. Huvos, F. Javier Pardo-Mindán, Frederic G. Barr, Marc Ladanyi. (2000) Association of EWS-FLI1 Type 1 Fusion with Lower Proliferative Rate in Ewing's Sarcoma. The American Journal of Pathology 156:3, 849-855
CrossRef213
Fumio Imamura, Toshiki Funakoshi, Shin-ichiro Nakamura, Masao Mano, Ken Kodama, Takeshi Horai. (2000) Primary primitive neuroectodermal tumor of the lung: report of two cases. Lung Cancer 27:1, 55-60
CrossRef214
Susan A. Burchill, Peter J. Selby. (2000) Molecular detection of low-level disease in patients with cancer. The Journal of Pathology 190:1, 6-14
CrossRef215
J.F. Graadt van Roggen, MB ChB, J.V.M.G. Bovée, H.J. van der Woude, P.C.W. Hogendoorn. (2000) An update of diagnostic strategies using molecular genetic and magnetic resonance imaging techniques for musculoskeletal tumors. Current Opinion in Rheumatology 12:1, 77-83
CrossRef216
Susana C. Raimondi. (2000) Fluorescence in Situ Hybridization: Molecular Probes for Diagnosis of Pediatric Neoplastic Diseases. Cancer Investigation 18:2, 135-147
CrossRef217
S Kumar, E Perlman, S Pack, M Davis, H Zhang, P Meltzer, M Tsokos. (1999) Absence of EWSFL11 fusion in olfactory neuroblastomas indicates these tumors do not belong to the Ewing's sarcoma family. Human Pathology 30:11, 1356-1360
CrossRef218
Mark L. Bernstein, Sylvain Baruchel, Susan Devine, Nektaria Markoglou, Irving W. Wainer, Marion Williams, Susan Blaney, Albert Moghrabi, Naomi Winick, Teresa Vietti. (1999) Phase I and Pharmacokinetic Study of CI-980 in Recurrent Pediatric Solid Tumor Cases. Journal of Pediatric Hematology/Oncology 21:6, 494-500
CrossRef219
Heinrich Kovar, Dragana Jugovic, Thomas Melot, Andreas Zoubek, Gilbert Lenoir, Franz-Martin Fink, Irene Philip, Claude Turc-Carel, Gilles Thomas, Jessica Zucman-Rossi. (1999) Cryptic Exons as a Source of Increased Diversity of Ewing Tumor-Associated EWS–FLI1 Chimeric Products. Genomics 60:3, 371-374
CrossRef220
Gabriele Amann, Andreas Zoubek, Mechthild Salzer-Kuntschik, Reinhard Windhager, Heinrich Kovar. (1999) Relation of neuroglial marker expression and EWS gene fusion types in MIC2/CD99-positive tumors of the Ewing family. Human Pathology 30:9, 1058-1064
CrossRef221
Ohran Sezer, Dragana Jugovic, Jens U. Blohmer, Andreas Turzynski, Gundula Thiel, Corinna Langelotz, Kurt Possinger, Heinrich Kovar. (1999) CD99 Positivity and EWS-FLII Gene Rearrangement Identify a Breast Tumor in a 60-Year-Old Patient With Attributes of the Ewing Family of Neoplasms. Diagnostic Molecular Pathology 8:3, 120-124
CrossRef222
Joseph S. Palumbo, Theodore Zwerdling. (1999) Soft tissue sarcomas of infancy. Seminars in Perinatology 23:4, 299-309
CrossRef223
Arndt, Carola A.S., Crist, William M., . (1999) Common Musculoskeletal Tumors of Childhood and Adolescence. New England Journal of Medicine 341:5, 342-352
Full Text224
Elizabeth H. Baldini, George D. Demetri, Christopher D. M. Fletcher, James Foran, Karen C. Marcus, Samuel Singer. (1999) Adults With Ewing’s Sarcoma/Primitive Neuroectodermal Tumor. Annals of Surgery 230:1, 79
CrossRef225
Jayne Gilbert, Michelle Haber, Sharon B. Bordow, Glenn M. Marshall, Murray D. Norris. (1999) Use of Tumor-Specific Gene Expression for the Differential Diagnosis of Neuroblastoma from Other Pediatric Small Round-Cell Malignancies. The American Journal of Pathology 155:1, 17-21
CrossRef226
Samuel Singer. (1999) New diagnostic modalities in soft tissue sarcoma. Seminars in Surgical Oncology 17:1, 11-22
CrossRef227
Susan L. Cohn. (1999) Diagnosis and Classification of the Small Round-Cell Tumors of Childhood. The American Journal of Pathology 155:1, 11-15
CrossRef228
Jason S. Felsch, William S. Lane, Ernest G. Peralta. (1999) Tyrosine kinase Pyk2 mediates G-protein-coupled receptor regulation of the Ewing sarcoma RNA-binding protein EWS. Current Biology 9:9, 485-490
CrossRef229
Keiko Obata, Hiroaki Hiraga, Takayuki Nojima, Michihiro C. Yoshida, Syuiti Abe. (1999) Molecular characterization of the genomic breakpoint junction in a t(11;22) translocation in Ewing sarcoma. Genes, Chromosomes and Cancer 25:1, 6-15
CrossRef230
Allan J. Yates, Teresa K. Franklin, Paula McKinney, Raymond Collins, Theodore Comas, Carl P. Boesel, Dennis K. Pearl. (1999) Gangliosides and neutral glycolipids in ependymal, neuronal and primitive neuroectodermal tumors. Journal of Molecular Neuroscience 12:2, 111-121
CrossRef231
N. de Saint Aubain Somerhausen, C.D.M. Fletcher. (1999) Soft-tissue sarcomas: an update. European Journal of Surgical Oncology (EJSO) 25:2, 215-220
CrossRef232
MASANORI HISAOKA, SEIJI TSUJI, YOSUKE MORIMITSU, HIROSHI HASHIMOTO, SHOHEI SHIMAJIRI, SETSURO KOMIYA, MASAHIRO USHIJIMA. (1999) Molecular detection of EWS-FLI1 chimeric transcripts in Ewing family tumors by nested reverse transcription-polymerase chain reaction: application to archival paraffin-embedded tumor tissues. APMIS 107:1-6, 577-584
CrossRef233
Kenneth M. Yaw. (1999) Pediatric bone tumors. Seminars in Surgical Oncology 16:2, 173-183
CrossRef234
Hector Monforte-Muñoz, Dolores Lopez-Terrada, Hanna Affendie, Jon M. Rowland, Timothy J. Triche. (1999) Documentation of EWS Gene Rearrangements by Fluorescence In-Situ Hybridization (FISH) in Frozen Sections of Ewing's Sarcoma-Peripheral Primitive Neuroectodermal Tumor. The American Journal of Surgical Pathology 23:3, 309-315
CrossRef235
Julia A. Bridge, Mary E. Fidler, James R. Neff, Joanne Degenhardt, Mei Wang, Craig Walker, Howard D. Dorfman, K. Scott Baker, Thomas A. Seemayer. (1999) Adamantinoma-like Ewing's Sarcoma: Genomic Confirmation, Phenotypic Drift. The American Journal of Surgical Pathology 23:2, 159-165
CrossRef236
Dan Jones, Christopher D. M. Fletcher. (1999) How shall we apply the new biology to diagnostics in surgical pathology?. The Journal of Pathology 187:1, 147-154
CrossRef237
Fabiola Minoletti, Gabriella Sozzi, Silvana Tornielli, Silvana Pilotti, Alberto Azzarelli, Marco A. Pierotti, Paolo Radice. (1998) A novel EWS-ERG rearrangement generating two hybrid mRNAs in a peripheral primitive neuroectodermal tumour (pPNET) with a t(15;22) translocation. The Journal of Pathology 186:4, 434-437
CrossRef238
Brian P. Rubin, Chang-Jie Chen, Thomas W. Morgan, Sheng Xiao, Holcombe E. Grier, Harry P. Kozakewich, Antonio R. Perez-Atayde, Jonathan A. Fletcher. (1998) Congenital Mesoblastic Nephroma t(12;15) Is Associated withETV6-NTRK3 Gene Fusion. The American Journal of Pathology 153:5, 1451-1458
CrossRef239
Shigeto Kawauchi, Toshiro Fukuda, Shingo Miyamoto, Jun-Ichi Yoshioka, Syuya Shirahama, Toshiaki Saito, Naoki Tsukamoto. (1998) Peripheral Primitive Neuroectodermal Tumor of the Ovary Confirmed by CD99 Immunostaining, Karyotypic Analysis, and RT-PCR for EWS/FLI-1 Chimeric mRNA. The American Journal of Surgical Pathology 22:11, 1417-1422
CrossRef240
Hans Peter Wagner. (1998) Cell cycle control and cancer. The Indian Journal of Pediatrics 65:6, 805-814
CrossRef241
Jon M. Davison, Thomas W. Morgan, Bae-Li Hsi, Sheng Xiao, Jonathan A. Fletcher. (1998) Subtracted, Unique-Sequence, In Situ Hybridization. The American Journal of Pathology 153:5, 1401-1409
CrossRef242
S. Abe, P. Park, S. Higaki, A. Tateishi, T. Imamura, T. Ohno. (1998) Neural characteristics of Ewing's sarcoma and related tumors: Ultrastructural study with immunohistochemical analysis. International Journal Of Clinical Oncology 3:5, 291-298
CrossRef243
Mauro Papotti, Giancarlo Abbona, Alberto Pagani, Guido Monga, Gianni Bussolati. (1998) Primitive neuroectodermal tumor of the meninges: An histological, immunohistochemical, ultrastructural, and cytogenetic study. Endocrine Pathology 9:3, 275-280
CrossRef244
Jaume Ordi, Enrique de Alava, Aureli Torné, Begoña Mellado, Javier Pardo-Mindan, Xavier Iglesias, Antonio Cardesa. (1998) Intraabdominal Desmoplastic Small Round Cell Tumor With EWS/ERG Fusion Transcript. The American Journal of Surgical Pathology 22:8, 1026-1032
CrossRef245
Fumihiko Urano, Akihiro Umezawa, Hiroki Yabe, Wei Hong, Koichi Yoshida, Kei Fujinaga, Jun-ichi Hata. (1998) Molecular Analysis of Ewing's Sarcoma: Another Fusion Gene, EWS-E1AF, Available for Diagnosis. Cancer Science 89:7, 703-711
CrossRef246
Enrique de Alava, María D. Lozano, Ana Patiño, Luis Sierrasesúmaga, F. Javier Pardo-Mindán. (1998) Ewing Family Tumors. Diagnostic Molecular Pathology 7:3, 152-157
CrossRef247
Hisashi Horiguchi, Miwa Matsui, Rieko Ohtsubo, Takesaburo Ogata, Michio Kaneko, Masachika Fujiwara, Hiroshi Kamma. (1998) Establishment and characterization of a typical primitive neuroectodermal tumor cell line. In Vitro Cellular & Developmental Biology - Animal 34:6, 439-442
CrossRef248
Lynn M. Smith, Roberta H. Adams, Arthur R. Brothman, Sheryll L. Vanderhooft, Cheryl M. Coffin. (1998) Peripheral primitive neuroectodermal tumor presenting with diffuse cutaneous involvement and 7;22 translocation. Medical and Pediatric Oncology 30:6, 357-363
CrossRef249
Carlos Rodriguez-Galindo, Neyssa M. Marina, David M. Parham, William H. Meyer. (1998) Author reply. Cancer 82:7, 1415-1416
CrossRef250
Susan L. Hasegawa, Jon M. Davison, Arno Rutten, Jonathan A. Fletcher, Christopher D.M. Fletcher. (1998) Primary Cutaneous Ewing's Sarcoma. The American Journal of Surgical Pathology 22:3, 310-318
CrossRef251
Stevan R Knezevich, Glenda Hendson, Joan A Mathers, Blair Carpenter, Dolores Lopez-Terrada, Ken L Brown, Poul H.B Sorensen. (1998) Absence of detectable EWS/FLI1 expression after therapy-induced neural differentiation in ewing sarcoma. Human Pathology 29:3, 289-294
CrossRef252
Sharon Castellino, Thomas Traweek, Philip M. Rosoff. (1998) Ewingʼs Tumor and Papillary Adenocarcinoma of the Thyroid in a 14-Year-Old Girl. Journal of Pediatric Hematology/Oncology 20:2, 177-180
CrossRef253
A. Zoubek, R. Ladenstein, R. Windhager, G. Amann, G. Fischmeister, L. Kager, D. Jugovic, P. F. Ambros, H. Gadner, H. Kovar. (1998) Predictive potential of testing for bone marrow involvement in Ewing tumor patients by RT-PCR: A preliminary evaluation. International Journal of Cancer 79:1, 56-60
CrossRef254
A. Pagani, L. Macrí, A. Rosolen, L. Toffolatti, A. Stella, G. Bussolati. (1998) Neuroendocrine Differentiation in Ewingʼs Sarcomas and Primitive Neuroectodermal Tumors Revealed by Reverse Transcriptase-Polymerase Chain Reaction of Chromogranin mRNA. Diagnostic Molecular Pathology 7:1, 36-43
CrossRef255
Verena S. Meier, Thomas Kühne, Gernot Jundt, Fred Gudat. (1998) Molecular Diagnosis of Ewing Tumors. Diagnostic Molecular Pathology 7:1, 29-35
CrossRef256
Sartelet, Lantuejoul, Armari-Alla, Pin, Delattre, Brambilla. (1998) Solid alveolar rhabdomyosarcoma of the thorax in a child. Histopathology 32:2, 165-171
CrossRef257
R. Barnoud, O. Delattre, M. Péoc'h, D. Pasquier, D. Plantaz, D. Leroux, B. Pasquier. (1998) Desmoplastic Small Round Cell Tumor: RT-PCR Analysis and Immunohistochemical Detection of the Wilm's Tumor Gene WT1. Pathology - Research and Practice 194:10, 693-700
CrossRef258
Gregory J. Tsongalis, William B. Coleman. (1998) Molecular Oncology: Diagnostic and Prognostic Assessment of Human Cancers in the Clinical Laboratory. Cancer Investigation 16:7, 485-502
CrossRef259
Toshio Takeuchi, Hiroshi Iwasaki, Yuko Ohjimi, Koichi Ohshima, Yasuhiko Kaneko, Masako Ishiguro, Yoshiharu Hiratsuka, Kimitaka Sakamoto, Masahiro Kikuchi. (1997) Renal Primitive Neuroectodermal Tumor. Diagnostic Molecular Pathology 6:6, 309-317
CrossRef260
Ian J Cohen, Josephine Issakov, Smadar Avigad, Batya Stark, Isaac Meller, Rina Zaizov, Irit Bar-Am. (1997) Synovial sarcoma of bone delineated by spectral karyotyping. The Lancet 350:9092, 1679-1680
CrossRef261
THOMAS MELOT, NADÈGE GRUEL, ALEXANDRE DOUBEIKOVSKI, NICOLAS SEVENET, JEAN-LUC TEILLAUD, OLIVIER DELATTRE. (1997) Production and Characterization of Mouse Monoclonal Antibodies to Wild-Type and Oncogenic FLI-1 Proteins. Hybridoma 16:5, 457-464
CrossRef262
Nicolas Thiounn, François Saporta, Thierry A. Flam, Franck Pages, Marc Zerbib, Annick Vieillefond, Emmanuel Martin, Bernard Debré, Sylvie Chevillard. (1997) Positive prostate-specific antigen circulating cells detected by reverse transcriptasepolymerase chain reaction does not imply the presence of prostatic micrometastase s. Urology 50:2, 245-250
CrossRef263
Martha Quezado, Denis R Benjamin, Maria Tsokos. (1997) EWS/FLI-1 fusion transcripts in three peripheral primitive neuroectodermal tumors of the kidney. Human Pathology 28:7, 767-771
CrossRef264
Carlos Rodriguez-Galindo, Neyssa M. Marina, Barry D. Fletcher, David M. Parham, Sara M. Bodner, William H. Meyer. (1997) Is primitive neuroectodermal tumor of the kidney a distinct entity?. Cancer 79:11, 2243-2250
CrossRef265
Haruhlko Yoshlda, Katsuhtto Nagao, Hlsao Ito, Kichizo Yamamoto, Shinlchiro Ushigome. (1997) Chromosomal translocations in human soft tissue sarcomas by interphase fluorescence in situ hybridization. Pathology International 47:4, 222-229
CrossRef266
Michael Sheaff, Aidan McManus, Irene Scheimberg, Andrew Paris, Janet Shipley, Suhail Baithun. (1997) Primitive Neuroectodermal Tumor of the Kidney Confirmed by Fluorescence In Situ Hybridization. The American Journal of Surgical Pathology 21:4, 461-468
CrossRef267
Satoshi Abe. (1997) Ultrastructural and immunohistochemical study of Ewing's sarcoma and related tumors: Morphological neural markers suggesting neural histogenesis in 32 small round-cell sarcomas. Journal of Orthopaedic Science 2:2, 75-83
CrossRef268
Jun Liu, Marion M. Nau, Jessica Zucman-Rossi, John I. Powell, Carmen J. Allegra, John J. Wright. (1997) LINE-I element insertion at the t(11;22) translocation breakpoint of a desmoplastic small round cell tumor. Genes, Chromosomes and Cancer 18:3, 232-239
CrossRef269
Yasuhiko Kaneko, Hirofumi Kobayashi, Masafumi Handa, Noriko Satake, Nobuo Maseki. (1997) EWS-ERG fusion transcript produced by chromosomal insertion in a Ewing sarcoma. Genes, Chromosomes and Cancer 18:3, 228-231
CrossRef270
Evgenios S. Gussetis, Dirk Schwabe, Valentin Gerein, Bernhard Kornhuber. (1997) Differential Diagnosis Based on Immunological Phenotyping in Suspected Malignant Bone Marrow Involvement in Childhood. Pediatric Hematology-Oncology 14:1, 29-41
CrossRef271
Ashok P. Kakadekar, George G.S. Sandor, Christopher Fryer, Ka Wah Chan, Paul C. Rogers, Sheila Pritchard, Ruby Popov. (1997) Differences in dose scheduling as a factor in the etiology of anthracycline-induced cardiotoxicity in Ewing sarcoma patients. Medical and Pediatric Oncology 28:1, 22-26
CrossRef272
Tetsuro Sugimoto, Akihiro Umezawa, Jun-ichi Hata. (1997) Neurogenic potential of Ewing's sarcoma cells. Virchows Archiv 430:1, 41-46
CrossRef273
Carol W. Sexton, Wain L. White. (1996) Primary Cutaneous Ewing's Family Sarcoma. The American Journal of Dermatopathology 18:6, 601-605
CrossRef274
Steven A. Narod. (1996) Genetic epidemiology of childhood cancer. Biochimica et Biophysica Acta (BBA) - Reviews on Cancer 1288:3, F141-F150
CrossRef275
Laura E. Benjamin, William J. Fredericks, Frederic G. Barr, Frank J. Rauscher. (1996) Fusion of theEWS1 andWT1 genes as a result of the t(11;22)(p13;q12) translocation in desmoplastic small round cell tumors. Medical and Pediatric Oncology 27:5, 434-439
CrossRef276
Joan Maurel, Rafael Rosell, Juan Carlos Lorenzo. (1996) Poor prognosis Ewing's sarcoma and peripheral primitive neuroectodermal tumours (PNET). Cancer Treatment Reviews 22:6, 425-436
CrossRef277
Cynthia S. Kretschmar, Christine Colbach, Ina Bhan, Timothy M. Crombleholme. (1996) Desmoplastic Small Cell Tumor. Journal of Pediatric Hematology/Oncology 18:3, 293-298
CrossRef278
Martine Peter, Francine Mugneret, Alain Aurias, Gilles Thomas, Henri Magdelenat, Olivier Delattre. (1996) AnEWS/ERG fusion with a truncated N-terminal domain ofEWS in a Ewing's tumor. International Journal of Cancer 67:3, 339-342
CrossRef279
V. Adams, M. A. Hany, M. Schmid, S. Hassam, J. Briner, F. K. Niggli. (1996) Detection of t(11;22)(q24;ql2) Translocation Breakpoint in Paraffin-embedded Tissue of the Ewingʼs Sarcoma Family by Nested Reverse Transcription-Polymerase Chain Reaction. Diagnostic Molecular Pathology 5:2, 107-113
CrossRef280
A. Zoubek, H. Kovar, M. Kronberger, G. Amann, R. Windhager, B. Gruber, H. Gadner. (1996) Mobilization of tumour cells during biopsy in an infant with Ewing sarcoma. European Journal of Pediatrics 155:5, 373-376
CrossRef281
Larry H. Argatoff, John X. O'Connell, Joan A. Mathers, C. Blake Gilks, Poul H.B. Sorensen. (1996) Detection of the EWS/WT1 Gene Fusion by Reverse Transcriptase-Polymerase Chain Reaction in the Diagnosis of Intra-abdominal Desmoplastic Small Round Cell Tumor. The American Journal of Surgical Pathology 20:4, 406-412
CrossRef282
AIDAN P. McMANUS, MARIE-ANNE J. O'REILLY, KATHRYN PRITCHARD JONES, BARRY A. GUSTERSON, CHRISTOPHER D. MITCHELL, C. ROSS PINKERTON, JANET M. SHIPLEY. (1996) INTERPHASE FLUORESCENCEIN SITU HYBRIDIZATION DETECTION OF t(2;13)(q35;q14) IN ALVEOLAR RHABDOMYOSARCOMA—A DIAGNOSTIC TOOL IN MINIMALLY INVASIVE BIOPSIES. The Journal of Pathology 178:4, 410-414
CrossRef283
Katia Scotlandi, Massimo Serra, Maria Cristina Manara, Stefania Benini, Manuela Sarti, Daniela Maurici, Pier-Luigi Lollini, Piero Picci, Franco Bertoni, Nicola Baldini. (1996) Immunostaining of the p30/32MIC2 antigen and molecular detection of EWS rearrangements for the diagnosis of Ewing's sarcoma and peripheral neuroectodermal tumor. Human Pathology 27:4, 408-416
CrossRef284
Yasuhiko Kaneko, Koichi Yoshida, Masafumi Handa, Yasunori Toyoda, Hirokazu Nishihira, Yukichi Tanaka, Yoshiroh Sasaki, Setsuko Ishida, Fumihiro Higashino, Kei Fujinaga. (1996) Fusion of anETS-family gene,EIAF, toEWS by t(17;22)(q12;q12) chromosome translocation in an undifferentiated sarcoma of infancy. Genes, Chromosomes and Cancer 15:2, 115-121
CrossRef285
AIDAN P. McMANUS, BARRY A. GUSTERSON, C. ROSS PINKERTON, JANET M. SHIPLEY. (1996) REVIEW ARTICLE. THE MOLECULAR PATHOLOGY OF SMALL ROUND-CELL TUMOURS—RELEVANCE TO DIAGNOSIS, PROGNOSIS, AND CLASSIFICATION. The Journal of Pathology 178:2, 116-121
CrossRef286
Steven G Brodie, Sandra J Stocker, James C Wardlaw, Marilyn H Duncan, Thomas S Mcconnell, Richard M Feddersen, Thomas M Williams. (1995) EWS and WT-1 gene fusion in desmoplastic small round cell tumor of the abdomen. Human Pathology 26:12, 1370-1374
CrossRef287
Erick Gamelin, Sylvie Francois, Serge Guyetant, Marie Christine Rousselet, Pierre Pabot Chatelard, Jean Michel Coindre, Norbert Ifrah. (1995) Peripheral primitive neuroectodermal tumour after allogeneic bone marrow transplantation. British Journal of Haematology 91:4, 935-937
CrossRef288
Kohmei Ida, Shigetoshi Kobayashi, Tomohiko Taki, Ryoji Hanada, Fumio Bessho, Shunji Yamamori, Tohru Sugimoto, Misao Ohki, Yasuhide Hayashi. (1995) EWS-FLI-1 andEWS-ERG chimeric mRNAs in Ewing's sarcoma and primitive neuroectodermal tumor. International Journal of Cancer 63:4, 500-504
CrossRef289
Thounaojam Bhagirath, Syuiti Abe, Takayuki Nojirna, Michihiro C. Yoshida. (1995) Molecular analysis of a t(II;22) translocation junction in a case of Ewing's sarcoma. Genes, Chromosomes and Cancer 13:2, 126-132
CrossRef290
Aidan P. McManus, Barry A. Gusterson, C. Ross Pinkerton, Janet M. Shipley. (1995) Diagnosis of Ewing's sarcoma and related tumours by detection of chromosome 22q12 translocations using fluorescencein situ hybridization on tumour touch imprints. The Journal of Pathology 176:2, 137-142
CrossRef291
Dave N. T. Aryee, Thomas Ströbel, Karin Kos, Mechthild Salzer-Kuntschik, Andreas Zoubek, Michel Veron, Inge M. Ambros, Francois Traincart, Helmut Gadner, Heinrich Kovar. (1995) Highnm23-h1/ndpk-a expression in ewing tumors: Paradoxical immunohistochemical reactivity and lack of prognostic significance. International Journal of Cancer 64:2, 104-111
CrossRef292
Christa Pfleiderer, Andreas Zoubek, Bernadette Gruber, Martina Kronberger, Peter F. Ambros, Thomas Lion, Franz-Martin Fink, Helmut Gadner, Heinrich Kovar. (1995) Detection of tumour cells in peripheral blood and bone marrow from ewing tumour patients by rt-pcr. International Journal of Cancer 64:2, 135-139
CrossRef293
Kretschmar, Cynthia S., . (1994) Ewing's Sarcoma and the ”Peanut” Tumors. New England Journal of Medicine 331:5, 325-327
Full Text
