Original Article
Allelic Loss of Chromosome 18q and Prognosis in Colorectal Cancer
N Engl J Med 1994; 331:213-221July 28, 1994
- Abstract
Background
Colorectal cancer occurs in approximately 150,000 people each year in the United States. Prognostic assessment influences the treatment of patients with colorectal cancer, including decisions about adjuvant therapy. We evaluated chromosome 18q allelic loss, a genetic event associated with tumor progression, as a prognostic marker for this disease.
Methods
We developed procedures to examine the status of chromosome 18q with microsatellite markers and DNA from formalin-fixed, paraffin-embedded tumors. Allelic loss of chromosome 18q was assessed in 145 consecutively resected stage II or III colorectal carcinomas.
Results
Among patients with stage II disease, the five-year survival rate was 93 percent in those whose tumor had no evidence of allelic loss of chromosome 18q and 54 percent in those with allelic loss; among patients with stage III disease, survival was 52 and 38 percent, respectively. The overall estimated hazard ratio for death in patients whose tumor had chromosome 18q allelic loss was 2.83 (P = 0.008) according to univariate analysis. Furthermore, chromosome 18q allelic loss remained a strong predictive factor (hazard ratio for death, 2.46; 95 percent confidence interval, 1.06 to 5.71; P = 0.036) after adjustment for all other evaluated factors, including tumor differentiation, vein invasion, and TNM stage.
Conclusions
The status of chromosome 18q has strong prognostic value in patients with stage II colorectal cancer. The prognosis in patients with stage II cancer and chromosome 18q allelic loss is similar to that in patients with stage III cancer, who are thought to benefit from adjuvant therapy. In contrast, patients with stage II disease who do not have chromosome 18q allelic loss in their tumor have a survival rate similar to that of patients with stage I disease and may not require additional therapy.
Media in This Article
Figure 1
Strategy for Determining the Allelic Status of the Long Arm of Chromosome 18.Figure 2
Chromosome 18q Markers and Their Association with Metastasis in the Pilot Study.Article Activity
- Article
With about 150,000 cases and 60,000 deaths annually, colorectal cancer is one of the commonest causes of death from cancer in the United States1. Currently, determining prognosis and selecting patients for postoperative adjuvant therapy rely mainly on pathological and clinical staging2,3. Patients with TNM stage I cancer (Dukes' stage A: tumor confined within the bowel wall, with no lymph-node metastasis) usually have a normal life span, whereas patients with stage IV disseminated disease have a very poor survival rate. However, predicting outcome in patients with intermediate stages is difficult. Patients with stage II colorectal cancer (Dukes' stage B: tumor extending through the bowel wall, without lymph-node metastasis) have a five-year survival rate of about 70 percent, and those with stage III disease (Dukes' stage C: regional lymph-node metastasis) have a rate of only 40 to 50 percent4. Adjuvant therapy improves the outcome in subgroups of patients, but it leads to substantial morbidity5-9. Better means of formulating the prognosis in patients with colorectal cancer would improve the selection of patients for adjuvant chemotherapy and radiation therapy.
Colorectal cancers result from the accumulation of several distinct genetic alterations involving the K-ras oncogene on chromosome 12 and tumor-suppressor genes on chromosomes 5, 17, and 1810-12. The short arm of chromosome 17 (17p) and the long arm of chromosome 18 (18q) are frequently lost in colorectal tumors. This observation led to the discovery that inactivation of the p53 and DCC genes (located on chromosomes 17p and 18q, respectively) probably contributes to the neoplastic transformation of colorectal epithelial cells13,14. Although studies of the biochemical mechanisms underlying the development of colorectal cancer are just beginning, the genes involved in this process have the potential to serve as markers in diagnosis and prognosis.
We have previously shown that distant metastasis of colorectal cancer is associated with deletions of chromosomes 17p and 18q and more generally with chromosomal losses throughout the genome15,16. Other studies have also indicated that loss of chromosome 17p or chromosome 18q has prognostic value17,18. However, several problems have prevented the application of these findings in a routine clinical setting. The analyses have required fresh-frozen tissues, relatively large quantities of DNA, and special procedures to isolate cancer cells from stromal and inflammatory cells within the tumor mass. In addition, Southern blot analysis depends on the heterozygosity of restriction-fragment-length polymorphisms (RFLPs), which are often absent in the chromosomal region of interest.
To develop a practical molecular genetic test for assessing the prognosis of patients with colorectal cancer, we used formalin-fixed paraffin-embedded sections as a source of DNA and highly polymorphic microsatellite markers to determine the status of chromosome 18q. Microsatellite markers are short-tandem-repeat DNA sequences located throughout the genome19. They are readily assayed by polymerase-chain-reaction (PCR) amplification of small amounts of DNA and gel electrophoresis20-22. The two allelic forms of the microsatellites in normal cells, one inherited from each parent, migrate on gel electrophoresis as two bands of nearly equal intensity but different sizes. Chromosomal losses in tumor tissues cause a loss of one of the two PCR products or a change in their relative intensities (Figure 1Figure 1
Strategy for Determining the Allelic Status of the Long Arm of Chromosome 18.). We used this technique to determine whether chromosome 18q loss is a prognostic marker in colorectal cancer.Methods
Patients
One hundred forty-five samples of stage II or III sporadic colorectal carcinoma were obtained for evaluation of the loss of chromosome 18q. They were obtained consecutively from curative surgical resections of primary colorectal tumor performed at the Johns Hopkins Hospital between July 1986 and December 1990. This period was studied because postoperative adjuvant chemotherapy was not administered routinely to patients at this institution until 1991. The tumor stage was based on pathological and clinical evaluation, which included preoperative radiography, computed tomography, and abdominal exploration at laparotomy.
Patients were excluded from the analysis if they had evidence of hereditary non-polyposis colorectal cancer syndrome according to the criteria of the International Collaborative Group,23 had had malignant tumor outside the colon within the previous five years, had synchronous adenocarcinoma of the large bowel, had carcinoma associated with idiopathic inflammatory bowel disease, or had received preoperative radiation or chemotherapy. Follow-up was carried out through the Johns Hopkins Tumor Registry and was based on chart reviews and yearly contacts with the physician or patient. Follow-up findings were confirmed in all patients as of September 1993. The clinical and pathological characteristics of the tumors were determined by a gastrointestinal pathologist without knowledge of the status of chromosome 18q, according to conventional criteria24.
Tissue and DNA Preparation
In the pilot study for development of the method, DNA was prepared from microdissected cryostat sections of frozen tumor tissues as previously described10. For the prospective study, DNA was purified with modified methods for assessing allelic loss with PCR25,26. Tissue sections 6 micrometers thick were obtained from surgical specimens that had been fixed in formalin and embedded in paraffin for routine histopathological examination. The slides were stained with hematoxylin and eosin, dehydrated in graded ethanol, and then dried without a cover glass. Regions containing at least 70 percent neoplastic cells were inked with a black marker (Sharpie, Sanford Corp., Bellwood, Ill.) under a dissection microscope. The black marking ink increased the density of the tissue and kept it at the bottom of the tube after centrifugation. Tissues from 2 to 10 slides, each containing a blackened region of tumor 0.2 to 1 cm2 in area, were scraped off with a razor blade and transferred to a 1.5-ml Microfuge tube. Non-neoplastic tissue from the same slide was then marked and placed in another Microfuge tube. The collected tissue samples were deparaffinized in 400 microliters of xylene for 15 minutes and pelleted by centrifugation at 10,000 × g for 2 minutes. After the xylene was removed by pipette, the tissues were heated at 58 °C for 15 minutes to remove the remaining xylene and incubated overnight at 58 °C in a buffer containing 0.5 M TRIS (pH 8.9), 20 mM EDTA, 10 mM sodium chloride, 0.5 mg of proteinase K per milliliter, and 1 percent sodium dodecyl sulfate. The samples were boiled in a water bath for 10 minutes at 100 °C, cooled to room temperature, and then extracted twice with an equal volume of phenol and chloroform, as previously described27. DNA was precipitated with ethanol and dissolved in 30 microliters of buffer containing 3 mM TRIS (pH 7.5) and 0.3 mM EDTA.
Microsatellite Markers and PCR Amplification
Oligonucleotide primers for microsatellite markers from the long arm of chromosome 18 were designed on the basis of published sequences28. The following dinucleotide-repeat markers and primers were used in the prospective study: D18S55, 5'GGGAAGTCAAATGCAAAATC3' and 5'AGCTTCTGAGTAATCTTATGCTGTG3'; S18S58, 5'GCTCCCGGCTGGTTTT3' and 5'GCAGGAAATCGCAGGAACTT3'; D18S61, 5'ATTTCTAAGAGGACTCCCAAACT3' and 5'ATATTTTGAAACTCAGGAGCAT3'; D18S64, 5'AACTAGAGACAGGCAGAA3' and 5'ATCAGGAAATCGGCACTG3'; and D18S69, 5'CTCTTTCTCTGACTCTGACC3' and 5'GACTTTCTAAGTTCTTGCCAG3'. The sequences of other primers used in the pilot study are available from us on request. It was important to use primers that produced a PCR product less than 180 base pairs in size, because longer fragments did not amplify consistently with DNA purified from paraffin-embedded sections. PCR-based dinucleotide-repeat assays were carried out in 96-well plates for 30 cycles; each cycle was carried out at 95 °C for 30 seconds, 50 °C for 1 minute, and 70 °C for 1 minute, with primers end-labeled with 32P-labeled ATP to a specific activity of more than 108 cpm per μg of DNA and under the PCR conditions previously described29. Two volumes of stop buffer (95 percent formamide, 20 micro M sodium hydroxide, and 0.05 percent bromophenol blue and xylene cyanate) were added at the end of the amplification, and the samples were loaded onto 7 percent polyacrylamide gels containing 32 percent formamide and 5.6 M urea30. The relative positions of the DCC gene and other chromosome 18 markers were determined by typing CEPH (Centre d'Etude du Polymorphisme Humain) reference families 1331, 1332, 1347, 1362, and 1416 for DCC31 and using the Clinik program of the Linkage program package32 to compute the best placement of the gene on a fixed map.
In the pilot study, the status of chromosome 17p was analyzed in the same way as that of chromosome 18q, with the microsatellite markers D17S804, D17S786, and D17S79628 and a marker in the p53 gene33.
Determination of Chromosome 18q Status
We defined chromosome 18q loss as the complete or partial loss of the long arm of chromosome 18. Loss of a chromosome 18q allele in a tumor was considered to be present when the PCR assay of adjacent non-neoplastic tissue showed heterozygosity of the microsatellite markers on the long arm of chromosome 18, and the relative intensity of the two alleles in the tumor DNA differed from the relative intensity in the non-neoplastic tissue DNA by a factor of at least 1.534. When the loss of the allele was not obvious on visual inspection, the intensities of the bands were quantitated with a PhosphorImager (Molecular Dynamics, Sunnyvale, Calif.). Some tumors (6 of 43 in the pilot study and 18 of 137 in the prospective study) yielded PCR products of abnormal sizes with two or more microsatellite markers. These tumors were considered to be in the previously described replication error (RER) subclass35-38. It is difficult to ascertain allelic loss of chromosome 18q with microsatellite markers in RER-positive tumors because of the instability of the repeats. However, such tumors infrequently lose any chromosomes, including chromosome 18q37. In the pilot study reported here, Southern blot analysis showed that none of the RER-positive tumors had lost chromosome 18q39. Therefore, tumors of the RER type were included among the tumors with no loss of chromosome 18q in the survival and other statistical analyses.
In the prospective study, two dinucleotide-repeat markers from chromosome 18q (D18S61 and D18S58) were sufficient to determine the status of the chromosome in 110 of the 135 paraffin-embedded tumor specimens (81 percent). Additional markers (D18S69, D18S64, and D18S55) were required only when no heterozygosity in either D18S61 or D18S58 was present in the non-neoplastic tissue, or when atypical bands indicating a potential RER phenotype were observed in either marker.
Statistical Analysis
The primary statistical outcome in this study was overall survival measured from the date of surgery. Event-time distributions were estimated with the product-limit method40. Differences between prognostic factors were tested for statistical significance with the log-rank statistic41. More generally, we estimated the hazard (risk) ratio per unit of change in each level of a potential prognostic factor relative to a specific base-line level. For example, the risk of death among patients with chromosome 18q loss was compared with the risk among patients with no loss, for all follow-up time and all patients. For prognostic factors that were continuous variables (e.g., tumor size), the risk ratio was expressed per unit of change (e.g., per centimeter of increase in size). Hazard ratios and associated 95 percent confidence intervals were estimated with the proportional-hazards model42. All reported P values are two-sided.
The simultaneous effects of more than one prognostic factor were estimated by multiple regression in the proportional-hazards model42. In this analysis, all factors that were potentially prognostic when considered alone (i.e., the P value was less than 0.15) were entered into a multiple regression model from which hazard ratios and significance levels were estimated. A factor that was not statistically significant or that had an estimated hazard ratio near 1.0 was removed from the model. Hazard ratios and significance levels were then estimated again to derive a more parsimonious model. This step-down procedure was continued until all remaining factors were significant. In some cases, we retained factors that were not significant solely to illustrate their lack of effect in the presence of other factors. In addition, the effects of prognostic factors were controlled by stratified proportional-hazards regression (e.g., rectal vs. colonic tumors) to avoid the assumption of proportional hazards.
Results
Microsatellite Markers for Chromosome 18q Allelic Loss
To establish the reliability of dinucleotide-repeat ((CA)n) markers for determining chromosomal loss, we tested 43 pairs of tumor and non-neoplastic DNA samples from fresh-frozen tissues in a pilot study. The chromosomal status of 36 of these tumors had been analyzed in detail by hybridizing Southern blots with DNA probes capable of detecting RFLPs of chromosome 18q39. Ten dinucleotide-repeat markers spanning the entire length of chromosome 18q were used to assess the loss of genetic material in this chromosomal region of the tumors. The results obtained with the dinucleotide-repeat assays corresponded perfectly to the available data on RFLPs. Twenty-seven tumors in which Southern blot analysis showed total or partial loss of chromosome 18q had similar losses according to the (CA)n-repeat assay, and nine tumors that showed no loss of RFLP markers on Southern blot analyses also retained all informative (CA)n markers. The status of chromosome 18q in the remaining seven tumors (16 percent) was determined with use of (CA)n markers (four of the tumors had loss of chromosome 18q, and three had no loss), but no comparison with Southern blot data was possible because of the lack of informative RFLP markers in these tumors.
We then examined the association between the region of chromosome 18q that was lost and the presence of metastasis in the 43 patients, all of whom had been followed at least five years (Figure 2Figure 2
Chromosome 18q Markers and Their Association with Metastasis in the Pilot Study.). Metastases were found in 19 of the 25 patients whose tumors had lost all the markers studied and all 5 patients with loss of the six most distal markers but not markers more proximal. In contrast, the 1 patient whose tumor had lost only the most distal marker (D18S70) and 11 of 12 patients whose tumor had not lost any marker were free of metastasis. Thus, the dinucleotide markers D18S69, D18S64, D18S55, D18S61, and D18S58 (Figure 2) were most closely associated with the presence of metastatic disease. The markers were found to be highly polymorphic and produced robust signals in the PCR-based dinucleotide-repeat assay.In this pilot study we also assessed the loss of chromosome 17p with four microsatellite markers. There was a strong concordance between chromosome 17p and chromosome 18q allelic losses (35 of 43 tumors), as in our previous study,15,16 but chromosome 18q allelic loss was more closely associated with metastasis in patients whose tumor had either chromosome 17p or chromosome 18q allelic loss. All three patients whose tumor had chromosome 18q allelic loss but not chromosome 17p allelic loss had metastatic disease, whereas only one of five patients with chromosome 17p allelic loss but not chromosome 18q allelic loss had metastases. Therefore, the chromosome 18q markers were chosen for the subsequent prospective study. Figure 2 shows the relative chromosomal position and genetic distance of these 10 dinucleotide-repeat markers.
Using five chromosome 18q markers, we tested the applicability of the dinucleotide-repeat assay to DNA from formalin-fixed paraffin-embedded tumor specimens in the pilot study (Figure 3Figure 3
Chromosome 18q Allelic Loss in DNA from Formalin-Fixed Paraffin-Embedded Tumor Sections.). The results of the assays with 17 paraffin-embedded tumor sections coincided precisely with the results obtained with DNA from cryostat sections of the same frozen tumors (data not shown).Clinical Characteristics Associated with Chromosome 18q Allelic Loss
We used this dinucleotide-repeat assay to evaluate consecutively resected tumors from a cohort of 145 patients. We were able to determine the status of chromosome 18q in 135 of the 145 tumor specimens (93 percent); 6 specimens were not analyzed because of insufficient amounts of tumor or non-neoplastic tissue, and 4 specimens could not be analyzed because of failed PCR amplifications. Table 1Table 1
Clinical Characteristics of All Patients with Colorectal Cancer and Patients Whose Tumors Were Evaluated for Chromosome 18q Status. lists relevant clinical characteristics of all 145 patients and the 135 patients whose tumors were analyzed for chromosome 18q allelic loss. Of the 135 tumors we studied, 90 (67 percent) had either complete or partial loss of chromosome 18q (examples are shown in Figure 3). Fewer patients with stage II disease had chromosome 18q allelic loss in their tumor than the patients with stage III disease (P = 0.007). More than two thirds of the tumors with chromosome 18q allelic loss were in the patient's left colon (i.e., distal to the splenic flexure), whereas two thirds of the tumors without chromosome 18q allelic loss were on the right (P<0.001). The frequency of 18q allelic loss among patients with colon cancers was not significantly different from the frequency among those with rectal cancers (P = 0.12). Patients receiving adjuvant therapy were more common in the group with chromosome 18q allelic loss (P = 0.026) because adjuvant therapy was given more frequently for stage III cancer than for stage II cancer (28 of 76 patients and 6 of 69 patients, respectively). At the close of this study, 83 percent of the patients without chromosome 18q allelic loss and 58 percent of the patients with chromosome 18q allelic loss were still alive at the time of the last follow-up evaluation (P = 0.005). The mean follow-up time was 33 months in the patients with chromosome 18q allelic loss and 38 months in those without such loss.Status of Chromosome 18q and Survival
Clinical stage was a significant prognostic factor for survival (Figure 4AFigure 4
Overall Survival of Patients with Colorectal Cancer, According to TNM Stage Alone (Panel A) and Both TNM Stage and Chromosome 18q Allelic Loss (Panel B).). In this cohort of patients the overall five-year survival rate was 74 percent in those with stage II disease and 42 percent in those with stage III disease. However, when the status of chromosome 18q was considered, the five-year survival rate was 93 percent in patients with stage II disease whose tumor had no chromosome 18q allelic loss and 54 percent in patients in the same stage whose tumor had chromosome 18q allelic loss (Figure 4B). The survival rate in the latter group of patients did not differ significantly from the survival rate among patients with stage III tumors. The survival rate among patients with stage III colorectal cancer was independent of their status for chromosome 18q. Similar results were obtained when disease-free survival was the end point and when colonic and rectal tumors were analyzed independently. Adjuvant therapy had no significant effect on the outcome in this study (Table 2Table 2
Estimated Hazard Ratios for Selected Individual Prognostic Factors in All 145 Patients Studied.).Chromosome 18q Allelic Loss and Other Prognostic Factors
Besides chromosome 18q allelic loss, other factors were associated with a higher or lower risk of death when these factors were considered individually. Chromosome 18q allelic loss, advanced tumor stage, extramural vein invasion, perineural invasion, and poor tumor differentiation were all associated with a significantly poorer prognosis, whereas white race and female sex were associated with a better prognosis (Table 2). However, as is frequently the case in such analyses, there were correlations among the various prognostic factors we analyzed. As examples, patients in an advanced stage of disease had a higher frequency of poorly differentiated tumors, and poorly differentiated tumors were more likely to involve veins and nerves. In such situations, individual factors are only partially independent with respect to their ability to predict survival.
To study the independent effects of the prognostic factors in the presence of correlations, we used a multiple regression proportional-hazards model. Table 3Table 3
Hazard Ratios for Prognostic Factors in Multiple Regression Models Including All 145 Patients. shows three representations of multiple regression models. The first model illustrates the fit of a roughly optimal set of prognostic factors in the cohort of patients -- that is, the addition of any other recorded variable did not yield prognostic information independent of the information produced by the factors listed. It is noteworthy that in patients whose tumor had chromosome 18q allelic loss, the risk of death was more than doubled, even after adjustment for vein involvement, grade of tumor differentiation, and race (Table 3, model 1). When the TNM stage was added to this set of predictors, this factor seemed to be redundant (i.e., it did not provide additional prognostic information) in the group studied, which consisted of patients with stage II and stage III disease only (Table 3, model 2). The factors that were redundant with TNM stage were not easily identifiable, but when vein invasion was removed from the regression model, the estimated hazard ratio for TNM stage increased (Table 3, model 3); retention of either tumor differentiation or vein involvement decreased the estimated prognostic effect of TNM stage. In contrast, the significance of chromosome 18q allelic loss as a prognostic factor remained nearly the same despite the inclusion of other factors in the regression analysis. Furthermore, when those models were stratified according to tumor site (colon vs. rectum), the estimated hazard ratios, P values, and confidence intervals were essentially unchanged.Discussion
Our study demonstrates that chromosome 18q allelic loss is an important prognostic marker in patients with stage II colorectal cancer. The subgroup of all patients with stage II disease whose tumor had retained both alleles of chromosome 18q (45 percent of all these patients) had an excellent outcome (five-year survival of 93 percent), whereas survival in patients with stage II disease whose tumor had lost one allele of chromosome 18q was similar to that in patients with stage III disease (five-year survival of 54 percent) (Figure 4B). Although the majority of the patients we studied had colon cancer, our results suggest that the prognostic value of allelic loss of chromosome 18q also pertains to rectal cancer. Our study suggests that adjuvant therapy with levamisole and fluorouracil, which reportedly benefits patients with stage III disease,8 may also be appropriate for patients with stage II disease whose colonic tumors have lost chromosome 18q.
Patients with stage III disease had a significantly higher frequency of chromosome 18q allelic loss than did those with stage II disease (77 percent vs. 55 percent) (Table 1), but chromosome 18q allelic loss had no significant prognostic value in patients with stage III disease. This finding may relate to the complexity of the metastatic process; allelic loss of chromosome 18q is clearly not a prerequisite for metastasis in colorectal cancer. It is thus possible that some stage III tumors have a worse prognosis through pathways that do not involve chromosome 18q.
In addition to the status of chromosome 18q, several conventional factors also had prognostic value in our study. These included invasion of extramural veins by tumor cells, perineural invasion, and poor tumor differentiation. These factors, however, can vary considerably within the same tumor and can be perceived differently from observer to observer.
Rapid advances in the molecular genetics of colorectal cancer have stimulated attempts to use molecular markers for assessing prognosis in patients with this disease. Altered total DNA content (aneuploidy), assessed by flow cytometry, can correlate with advanced tumor stage, poor tumor differentiation, and relatively poor survival,43 but the technical difficulties of flow cytometry have led to conflicting results44,45. Fractional allelic loss, assayed by Southern blot analysis, has been used as a measure of chromosomal loss throughout the genome15,16,39. High fractional allelic loss is associated with poor survival, but the large number of chromosomal sites needed for analysis renders the method impractical for routine use.
Microsatellite instability, a manifestation of the RER phenotype, has been described in sporadic colorectal carcinomas24,35,36 and hereditary non-polyposis colorectal cancer37,38. In our study, the five-year survival rate of the 18 patients with RER-positive tumors was indistinguishable from that of the 28 patients whose tumors had retained chromosome 18q and were RER-negative. These results agree with other reports that RER-positive tumors have a lower tendency to metastasize than RER-negative tumors and that patients with RER-positive tumors have relatively good survival35-37. Our pilot study showed that RER-positive tumors do not often lose any allele of chromosome 18q. It is possible that the better outcome in patients with RER-positive tumors is a result of retention of both alleles of chromosome 18q.
Certain specific genetic alterations have also been studied as potential prognostic markers. Activating mutations of ras proto-oncogenes and loss of the nm23 gene have been reported to have prognostic importance46-48. One of the most commonly affected genes in human cancers is p5349,50. Mutational inactivation of the p53 gene often accompanies the loss of chromosome 17p, and accumulation of the mutated protein occurs frequently in colorectal cancers13,49. Such mutation or loss of p53 has made it potentially useful for diagnosis and prognosis15-18,50-53. In our pilot study, chromosome 17p allelic loss was less closely associated with metastasis than chromosome 18q allelic loss. In our prospective study, overexpression of p53, as assessed by immunohistochemical analysis, was not useful for determining prognosis (data not shown).
Study of the commonly deleted regions on chromosome 18q led to the identification of the candidate tumor-suppressor gene, DCC (deleted in colorectal cancer)14. The DCC protein has structural features in common with certain types of cell-adhesion molecules and may participate with other proteins in cell-cell and cell-matrix interactions14,54-56. The loss of chromosome 18q could thus lead to impaired contacts between cells, thereby contributing to tumor growth and invasion. Linkage analysis indicates that the DCC gene lies immediately adjacent to the region of chromosome 18q that we evaluated in our prospective study (between D18S69 and D18S65) (Figure 2). Interestingly, expression of the DCC gene was recently shown to be absent in most colorectal cancers that were metastatic to the liver, but it was lost only in a minority of nonmetastatic cancers57. This finding supports the idea that the DCC gene is the biologic basis of the association of chromosome 18q with prognosis. However, an additional gene (or genes) on chromosome 18 and elsewhere in the genome may also play a part, and further biochemical and genetic studies are required to resolve this issue.
The prognostic evaluation afforded by the chromosome 18q assay is clinically meaningful but imperfect. Although retention of chromosome 18q is a favorable finding, the outcome in patients whose tumor has chromosome 18q allelic loss is unpredictable, and the prognosis of patients with stage III disease is unchanged by knowledge of the status of chromosome 18q. In the future, tests for the status of chromosome 18q may be combined with other genetic and biochemical assays to improve prognostic evaluation in patients with colorectal cancer.
Supported by the Clayton Fund and by grants (CA-35494, CA-09243, CA-47527, and CA-62924) from the National Cancer Institute.
We are indebted to Ms. A. Kammer of the Johns Hopkins Tumor Registry for assistance, to Dr. L. Grochow for helpful comments, and to Mrs. T. Gwiazda for help in preparing the manuscript.
Source Information
From the Departments of Oncology (J.J., S.P., K.W.K., B.V., S.R.H.), Pathology (H.K., S.R.H.), and Anesthesiology and Critical Care Medicine (Z.-F.L., R.C.L.), Johns Hopkins University School of Medicine, Baltimore; and the Finnish Red Cross Blood Transfusion Service, Helsinki, Finland (P.S.).
Address reprint requests to Dr. Hamilton at the Department of Pathology, Ross Bldg., Rm. 632, Johns Hopkins University School of Medicine, 720 Rutland Ave., Baltimore, MD 21205-2196
- References
References
1
Cancer facts & figures -- 1993. Atlanta: American Cancer Society, 1993.
2
Adjuvant therapy for patients with colon and rectal cancerJAMA 1990;264:1444-1450
CrossRef | Web of Science3
Deans GT ,Parks TG ,Rowlands BJ ,Spence RAJ . Prognostic factors in colorectal cancer. Br J Surg 1992;79:608-613
CrossRef | Web of Science | Medline4
Crissman JD, Barwick KW. Pathologic staging of colon and rectal adenocarcinoma. In: Wanebo HJ, ed. Colorectal cancer. St. Louis: Mosby-Year Book, 1993:57-74.
5
Gastrointestinal Tumor Study Group
Full Text | Web of Science | Medline6
Douglass HO Jr ,Moertel CG ,Mayer RJ , et al. Survival after postoperative combination treatment of rectal cancer. N Engl J Med 1986;315:1294-1295
Full Text | Web of Science | Medline7
Laurie JA ,Moertel CG ,Fleming TR , et al. Surgical adjuvant therapy of large-bowel carcinoma: an evaluation of levamisole and the combination of levamisole and fluorouracil: the North Central Cancer Treatment Group and the Mayo Clinic. J Clin Oncol 1989;7:1447-1456
Web of Science | Medline8
Moertel CG ,Fleming TR ,Macdonald JS , et al. Levamisole and fluorouracil for adjuvant therapy of resected colon carcinoma. N Engl J Med 1990;322:352-358
Full Text | Web of Science | Medline9
Krook JE ,Moertel CG ,Gunderson LL , et al. Effective surgical adjuvant therapy for high-risk rectal carcinoma. N Engl J Med 1991;324:709-715
Full Text | Web of Science | Medline10
Vogelstein B ,Fearon ER ,Hamilton SR , et al. Genetic alterations during colorectal-tumor development. N Engl J Med 1988;319:525-532
Full Text | Web of Science | Medline11
Fearon ER ,Vogelstein B . A genetic model for colorectal tumorigenesis. Cell 1990;61:759-767
CrossRef | Web of Science | Medline12
Hamilton SR . The molecular genetics of colorectal neoplasia. Gastroenterology 1993;105:3-7
Web of Science | Medline13
Baker SJ ,Fearon ER ,Nigro JM , et al. Chromosome 17 deletions and p53 gene mutations in colorectal carcinomas. Science 1989;244:217-221
CrossRef | Web of Science | Medline14
Fearon ER ,Cho KR ,Nigro JM , et al. Identification of a chromosome 18q gene that is altered in colorectal cancers. Science 1990;247:49-56
CrossRef | Web of Science | Medline15
Kern SE ,Fearon ER ,Tersmette KWF , et al. Clinical and pathological associations with allelic loss in colorectal carcinoma. JAMA 1989;261:3099-3103[Erratum, JAMA 1989;262:1952.]
CrossRef | Web of Science | Medline16
Offerhaus GJA ,De Feyter EP ,Cornelisse CJ , et al. The relationship of DNA aneuploidy to molecular genetic alterations in colorectal carcinoma. Gastroenterology 1992;102:1612-1619
Web of Science | Medline17
Laurent-Puig P ,Olschwang S ,Delattre O , et al. Survival and acquired genetic alterations in colorectal cancer. Gastroenterology 1992;102:1136-1141
Web of Science | Medline18
O'Connell MJ ,Schaid DJ ,Ganju V ,Cunningham J ,Kovach JS ,Thibodeau SN . Current status of adjuvant chemotherapy for colorectal cancer: can molecular markers play a role in predicting prognosis? Cancer 1992;70:Suppl:1732-1739
CrossRef | Web of Science | Medline19
Beckman JS ,Weber JL . Survey of human and rat microsatellites. Genomics 1992;12:627-631
CrossRef | Web of Science | Medline20
Saiki RK ,Gelfand DH ,Stoffel S , et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 1988;239:487-491
CrossRef | Web of Science | Medline21
Louis DN ,von Deimling A ,Seizinger BR . A (CA)n dinucleotide repeat assay for evaluating loss of allelic heterozygosity in small and archival human brain tumor specimens. Am J Pathol 1992;141:777-782
Web of Science | Medline22
NIH/CEPH Collaborative Mapping Group
CrossRef | Web of Science23
Vasen HFA ,Mecklin J-P ,Kahn PM ,Lynch HT . Hereditary non-polyposis colorectal cancer. Lancet 1991;338:877-877
CrossRef | Web of Science24
Kim H ,Jen J ,Vogelstein B ,Hamilton SR . Clinical and pathological characteristics of sporadic colorectal carcinomas with DNA replication errors in microsatellite sequences. Am J Pathol 1994;145:148-156
Web of Science | Medline25
Meltzer SJ ,Yin J ,Huang Y , et al. Reduction to homozygosity involving p53 in esophageal cancers demonstrated by the polymerase chain reaction. Proc Natl Acad Sci U S A 1991;88:4976-4980
CrossRef | Web of Science | Medline26
Shibata D ,Hawes D ,Li Z-H ,Hernandez AM ,Spruck CH ,Nichols PW . Specific genetic analysis of microscopic tissue after selective ultraviolet radiation fractionation and the polymerase chain reaction. Am J Pathol 1992;141:539-543
Web of Science | Medline27
Goelz SE ,Hamilton SR ,Vogelstein B . Purification of DNA from formaldehyde fixed and paraffin embedded human tissue. Biochem Biophys Res Commun 1985;130:118-126
CrossRef | Web of Science | Medline28
Weissenbach J ,Gyapay G ,Dib C , et al. A second-generation linkage map of the human genome. Nature 1992;359:794-801
CrossRef | Web of Science | Medline29
Sidransky D ,Tokino T ,Hamilton SR , et al. Identification of ras oncogene mutations in the stool of patients with curable colorectal tumors. Science 1992;256:102-105
CrossRef | Web of Science | Medline30
Litt M ,Hauge X ,Sharma V . Shadow bands seen when typing polymorphic dinucleotide repeats: some causes and cures. Biotechniques 1993;15:280-284
Web of Science | Medline31
Risinger JI ,Boyd J . Dinucleotide repeat polymorphism in the human DCC gene at chromosome 18q21. Hum Mol Genet 1992;1:657-657
CrossRef | Web of Science | Medline32
Lathrop GM ,Lalouel JM ,Julier C ,Ott J . Strategies for multilocus linkage analysis in humans. Proc Natl Acad Sci U S A 1984;81:3443-3446
CrossRef | Web of Science | Medline33
Hahn M ,Serth J ,Fislage R , et al. Polymerase chain reaction detection of a highly polymorphic VNTR segment in intron 1 of the human p53 gene. Clin Chem 1993;39:549-550
Web of Science | Medline34
Gruis NA ,Abeln ECA ,Bardoel AFJ ,Devilee P ,Frants RR ,Cornelisse CJ . PCR-based microsatellite polymorphisms in the detection of loss of heterozygosity in fresh and archival tumour tissue. Br J Cancer 1993;68:308-313
CrossRef | Web of Science | Medline35
Ionov Y ,Peinado MA ,Malkhosyan S ,Shibata D ,Perucho M . Ubiquitous somatic mutations in simple repeated sequences reveal a new mechanism for colonic carcinogenesis. Nature 1993;363:558-561
CrossRef | Web of Science | Medline36
Thibodeau SN ,Bren G ,Schaid D . Microsatellite instability in cancer of the proximal colon. Science 1993;260:816-819
CrossRef | Web of Science | Medline37
Aaltonen LA ,Peltomaki P ,Leach FS , et al. Clues to the pathogenesis of familial colorectal cancer. Science 1993;260:812-816
CrossRef | Web of Science | Medline38
Peltomaki P ,Lothe RA ,Aaltonen LA , et al. Microsatellite instability is associated with tumors that characterize the hereditary non-polyposis colorectal carcinoma syndrome. Cancer Res 1993;53:5853-5855
Web of Science | Medline39
Vogelstein B ,Fearon ER ,Kern SE , et al. Allelotype of colorectal carcinomas. Science 1989;244:207-211
CrossRef | Web of Science | Medline40
Kaplan EL ,Meier P . Nonparametric estimation from incomplete observations. J Am Stat Assoc 1958;53:457-481
CrossRef | Web of Science41
Mantel N ,Haenszel W . Statistical aspects of the analysis of data from retrospective studies of disease. J Natl Cancer Inst 1959;22:719-748
Web of Science | Medline42
Cox DR . Regression models and life-tables. J R Stat Soc [B] 1972;34:187-22043
Jass JR ,Mukawa K ,Goh HS ,Love SB ,Capellaro D . Clinical importance of DNA content in rectal cancer measured by flow cytometry. J Clin Pathol 1989;42:254-259
CrossRef | Web of Science | Medline44
Ensley JF ,Maciorowski Z ,Hassan M ,Pietraszkiewicz H ,Sakr W ,Heilbrun LK . Variations in DNA aneuploid cell content during tumor dissociation in human colon and head and neck cancers analyzed by flow cytometry. Cytometry 1993;14:550-558
CrossRef | Medline45
Crissman JD ,Zarbo RJ ,Ma CK ,Visscher DW . Histopathologic parameters and DNA analysis in colorectal adenocarcinomas. Pathol Annu 1989;24:103-147
Web of Science | Medline46
Finkelstein SD ,Sayegh R ,Bakker A ,Swalsky P . Determination of tumor aggressiveness in colorectal cancer by K-ras-2 analysis. Arch Surg 1993;128:526-532
Web of Science | Medline47
Cohn KH ,Wang F ,DeSoto-LaPaix F , et al. Association of nm23-H1 allelic deletions with distant metastases in colorectal carcinoma. Lancet 1991;338:722-724
CrossRef | Web of Science | Medline48
Bell SM ,Scott N ,Cross D , et al. Prognostic value of p53 overexpression and c-Ki-ras gene mutations in colorectal cancer. Gastroenterology 1993;104:57-64
Web of Science | Medline49
Nigro JM ,Baker SJ ,Preisinger AC , et al. Mutations in the p53 gene occur in diverse human tumour types. Nature 1989;342:705-708
CrossRef | Web of Science | Medline50
Harris CC ,Hollstein M . Clinical implications of the p53 tumor-suppressor gene. N Engl J Med 1993;329:1318-1327
Full Text | Web of Science | Medline51
Baas IO ,Mulder J-WR ,Offerhaus GJA ,Vogelstein B ,Hamilton SR . An evaluation of six antibodies for immunohistochemistry of mutant p53 gene product in archival colorectal neoplasms. J Pathol 1994;172:5-12
CrossRef | Web of Science | Medline52
Remvikos Y ,Tominaga O ,Hammel P , et al. Increased p53 protein content of colorectal tumours correlates with poor survival. Br J Cancer 1992;66:758-764
CrossRef | Web of Science | Medline53
Hamelin R ,Laurent-Puig P ,Olschwang S , et al. Association of p53 mutations with short survival in colorectal cancer. Gastroenterology 1994;106:42-48
Web of Science | Medline54
Hedrick L ,Cho KR ,Vogelstein B . Cell adhesion molecules as tumour suppressors. Trends Cell Biol 1993;3:36-39
CrossRef | Medline55
Nigam AK ,Savage FJ ,Boulos PB ,Stamp GWH ,Liu D ,Pignatelli M . Loss of cell-cell and cell-matrix adhesion molecules in colorectal cancer. Br J Cancer 1993;68:507-514
CrossRef | Web of Science | Medline56
Wielenga VJ ,Heider KH ,Offerhaus GJ , et al. Expression of CD44 variant proteins in human colorectal cancer is related to tumor progression. Cancer Res 1993;53:4754-4756
Web of Science | Medline57
Zetter BR . Adhesion molecules in tumor metastasis. Semin Cancer Biol 1993;4:219-229
Web of Science | Medline
- Citing Articles (265)
Citing Articles
1
Edward Chu. (2011) Application of Microsatellite Instability and Oncotype DX in Stage II Colon Cancer Adjuvant Chemotherapy. Current Colorectal Cancer Reports 7:4, 260-266
CrossRef2
Efrat Dotan, Steven J. Cohen. (2011) Challenges in the Management of Stage II Colon Cancer. Seminars in Oncology 38:4, 511-520
CrossRef3
Rachel S Midgley, David Church, David J Kerr. (2011) The emergence of ‘omics for the management of colorectal cancer. Current Opinion in Oncology 23:4, 410-414
CrossRef4
Alessandro Franchi, Annarita Palomba, Cristina Fondi, Lucia Miligi, Milena Paglierani, Monica Pepi, Marco Santucci. (2011) Immunohistochemical investigation of tumorigenic pathways in sinonasal intestinal-type adenocarcinoma. A tissue microarray analysis of 62 cases. Histopathology 59:1, 98-105
CrossRef5
Ben George, Scott Kopetz. (2011) Predictive and Prognostic Markers in Colorectal Cancer. Current Oncology Reports 13:3, 206-215
CrossRef6
Ibrahim Aldoss, Syma Iqbal. (2011) Adjuvant Treatment and Predictors of Response in Colon Cancer. Seminars in Colon and Rectal Surgery 22:2, 131-136
CrossRef7
Montse Verdú, Ruth Román, Miquel Calvo, Natàlia Rodón, Beatriz García, Marta González, August Vidal, Xavier Puig. (2011) Clinicopathological and molecular characterization of colorectal micropapillary carcinoma. Modern Pathology 24:5, 729-738
CrossRef8
Cinzia Azzoni, Lorena Bottarelli, Stefano Cecchini, Enrico Maria Silini, Cesare Bordi, Leopoldo Sarli. (2011) Sporadic colorectal carcinomas with low-level microsatellite instability: a distinct subgroup with specific clinicopathological and molecular features. International Journal of Colorectal Disease 26:4, 445-453
CrossRef9
Liu Meimei, Li Peiling, Li Baoxin, Li Changmin, Zhuang Rujin, Hu Chunjie. (2011) Lost expression of DCC gene in ovarian cancer and its inhibition in ovarian cancer cells. Medical Oncology 28:1, 282-289
CrossRef10
Thomas Dyrsø, Jian Li, Kai Wang, Jan Lindebjerg, Steen Kølvraa, Lars Bolund, Anders Jakobsen, Gert Bruun-Petersen, Shengting Li, Dorthe G. Crüger. (2011) Identification of chromosome aberrations in sporadic microsatellite stable and unstable colorectal cancers using array comparative genomic hybridization. Cancer Genetics 204:2, 84-95
CrossRef11
A. Lièvre. (2010) Vers un traitement personnalisé du cancer colorectal: facteurs pronostiques et prédictifs. Oncologie 12:10, 584-592
CrossRef12
Manny D. Bacolod, Francis Barany. (2010) Gene Dysregulations Driven by Somatic Copy Number Aberrations-Biological and Clinical Implications in Colon Tumors. The Journal of Molecular Diagnostics 12:5, 552-561
CrossRef13
Monica M. Bertagnolli. (2010) Interpreting the Inconsistent Data Concerning the Role of 18qLOH as a Prognostic Marker for Colorectal Cancer. Current Colorectal Cancer Reports 6:3, 158-167
CrossRef14
Kakil Ibrahim Rasul, David J. Kerr. (2010) QUASAR Results: The Prognostic Validity of a Colon Cancer Recurrence Score and the Role of Multigene Profiles in Determining Risk. Current Colorectal Cancer Reports 6:3, 144-147
CrossRef15
Tara Gangadhar, Richard L. Schilsky. (2010) Molecular markers to individualize adjuvant therapy for colon cancer. Nature Reviews Clinical Oncology 7:6, 318-325
CrossRef16
Tina Ashley Khair, Peter Kozuch. (2010) Minimizing the Therapy-Related Morbidity in the Rectal Cancer Patient. Seminars in Colon and Rectal Surgery 21:2, 120-125
CrossRef17
Ruth Román, Montse Verdú, Miquel Calvo, August Vidal, Xavier Sanjuan, Mireya Jimeno, Antonio Salas, Josefina Autonell, Isabel Trias, Marta González, Beatriz García, Natalia Rodón, Xavier Puig. (2010) Microsatellite instability of the colorectal carcinoma can be predicted in the conventional pathologic examination. A prospective multicentric study and the statistical analysis of 615 cases consolidate our previously proposed logistic regression model. Virchows Archiv 456:5, 533-541
CrossRef18
C K Kontos, I N Papadopoulos, E G Fragoulis, A Scorilas. (2010) Quantitative expression analysis and prognostic significance of L-DOPA decarboxylase in colorectal adenocarcinoma. British Journal of Cancer 102:9, 1384-1390
CrossRef19
Ben Markman, Víctor Rodríguez-Freixinos, Josep Tabernero. (2010) Biomarkers in colorectal cancer. Clinical and Translational Oncology 12:4, 261-270
CrossRef20
David Cunningham, Wendy Atkin, Heinz-Josef Lenz, Henry T Lynch, Bruce Minsky, Bernard Nordlinger, Naureen Starling. (2010) Colorectal cancer. The Lancet 375:9719, 1030-1047
CrossRef21
J.G. Tralhão, E. Hoti, M. Serôdio, P. Laranjeiro, A. Paiva, A.M. Abrantes, M.L. Pais, M.F. Botelho, F. Castro Sousa. (2010) Perioperative tumor cell dissemination in patients with primary or metastatic colorectal cancer. European Journal of Surgical Oncology (EJSO) 36:2, 125-129
CrossRef22
Toshiaki Tanaka, Toshiaki Watanabe, Joji Kitayama, Takamitsu Kanazawa, Yoshihiro Kazama, Junichiro Tanaka, Shinsuke Kazama, Hirokazu Nagawa. (2009) Chromosome 18q Deletion as a Novel Molecular Predictor for Colorectal Cancer With Simultaneous Hepatic Metastasis. Diagnostic Molecular Pathology 18:4, 219-225
CrossRef23
Edit Rápolti, András Szigeti, Róbert Farkas, Szabolcs Bellyei, Árpád Boronkai, András Papp, Éva Gömöri, Örs Péter Horváth, László Mangel. (2009) Neoadjuváns radiokemoterápia a lokoregionálisan előrehaladott rectumtumorok ellátásában. Magyar Onkológia 53:4, 345-349
CrossRef24
Andreas Herbst, Guido T. Bommer, Lydia Kriegl, Andreas Jung, Andrea Behrens, Endy Csanadi, Markus Gerhard, Christian Bolz, Rainer Riesenberg, Wolfgang Zimmermann, Wolfgang Dietmaier, Isabella Wolf, Thomas Brabletz, Burkhard Göke, Frank T. Kolligs. (2009) ITF-2 Is Disrupted via Allelic Loss of Chromosome 18q21, and ITF-2B Expression Is Lost at the Adenoma-Carcinoma Transition. Gastroenterology 137:2, 639-648.e9
CrossRef25
Frank A Sinicrope, Daniel J Sargent. (2009) Clinical implications of microsatellite instability in sporadic colon cancers. Current Opinion in Oncology 21:4, 369-373
CrossRef26
Veena Shankaran, Polina Khrizman, Al B. Benson. (2009) Risk assessment and adjuvant systemic therapy in resected stage II colon cancer. Current Colorectal Cancer Reports 5:3, 158-165
CrossRef27
Yanhong Deng, Brenda F. Kurland, Jianping Wang, Jiong Bi, Wen Li, Sujata Rao, Ping Lan, Tongyu Lin, Edward Lin. (2009) High Epidermal Growth Factor Receptor Expression in Metastatic Colorectal Cancer Lymph Nodes May Be More Prognostic of Poor Survival Than in Primary Tumor. American Journal of Clinical Oncology 32:3, 245-252
CrossRef28
MARK REDSTON. 2009. Epithelial Neoplasms of the Large Intestine. , 597-637.
CrossRef29
Kang Young Lee. (2009) Genomic Instability in Colorectal Cancer; from Bench to Bed. Journal of the Korean Society of Coloproctology 25:2, 129
CrossRef30
Christos K. Kontos, Iordanis N. Papadopoulos, Andreas Scorilas. (2008) Quantitative expression analysis and prognostic significance of the novel apoptosis-related gene BCL2L12 in colon cancer. Biological Chemistry 389:12, 1467-1475
CrossRef31
Kim M Smits, Arjen HG Cleven, Matty P Weijenberg, Laura AE Hughes, James G Herman, Adriaan P de Bruïne, Manon van Engeland. (2008) Pharmacoepigenomics in colorectal cancer: a step forward in predicting prognosis and treatment response. Pharmacogenomics 9:12, 1903-1916
CrossRef32
Rami Badreddine, Kenneth K. Wang. (2008) Biomarkers in Gastrointestinal Cancers. The American Journal of Gastroenterology 103:8, 2106-2110
CrossRef33
C. Richard Boland. (2008) The Molecular Biology of Gastrointestinal Cancer: Implications for Diagnosis and Therapy. Gastrointestinal Endoscopy Clinics of North America 18:3, 401-413
CrossRef34
Augusto Villanueva, Sara Toffanin, Josep M Llovet. (2008) Linking molecular classification of hepatocellular carcinoma and personalized medicine: preliminary steps. Current Opinion in Oncology 20:4, 444-453
CrossRef35
Keiichi Nakagawa, Hideomi Yamashita, Naoki Nakamura, Hiroshi Igaki, Masao Tago, Yoshio Hosoi, Toshimitsu Momose, Kuni Ohtomo, Tetsuichiro Muto, Hirokazu Nagawa. (2008) Preoperative Radiation Response Evaluated by 18-Fluorodeoxyglucose Positron Emission Tomography Predicts Survival in Locally Advanced Rectal Cancer. Diseases of the Colon & Rectum 51:7, 1055-1060
CrossRef36
Yutaka Suehiro, Yuji Hinoda. (2008) Genetic and epigenetic changes in aberrant crypt foci and serrated polyps. Cancer Science 99:6, 1071-1076
CrossRef37
Sergio Huerta. (2008) Recent advances in the molecular diagnosis and prognosis of colorectal cancer. Expert Review of Molecular Diagnostics 8:3, 277-288
CrossRef38
Sarli Leopoldo, Bottarelli Lorena, Azzoni Cinzia, Di Cola Gabriella, Barilli Angela Luciana, Costi Renato, Mazzeo Antonio, Salvemini Carlo, Porrini Cristina, Cecchini Stefano, Taglia Maurizio, Roncoroni Luigi, Bordi Cesare. (2008) Two Subtypes of Mucinous Adenocarcinoma of The Colorectum: Clinicopathological and Genetic Features. Annals of Surgical Oncology 15:5, 1429-1439
CrossRef39
Aristotle Bamias, George Fountzilas, Michael Michael, Christos Konstantaras, Eleftheria Vrettou, Efstathios Eleftheriadis, Pavlos Papakostas, Konstantionos Papadimitriou, Nicholas Pavlidis, Nikos Xiros, Maria Bai. (2008) DCC and TS protein expression in resected gastric cancer: A Hellenic Cooperative Oncology Group Study. Central European Journal of Medicine 3:1, 29-39
CrossRef40
Maria Tzouvala, Andreas C. Lazaris, George V. Papatheodoridis, Chariklia Kouvidou, Thomas G. Papathomas, Nikos Kavantzas, Ioannis Elemenoglou, Demetrios G. Karamanolis, Emmanouil Agapitos. (2008) Potential Role of Apoptosis and Apoptotic Regulatory Proteins in Colorectal Neoplasia: Correlations with Clinico-Pathological Parameters and Survival. Digestive Diseases and Sciences 53:2, 451-460
CrossRef41
Sanjay R Hegde, Weijing Sun, John P Lynch. (2008) Systemic and targeted therapy for advanced colon cancer. Expert Review of Gastroenterology & Hepatology 2:1, 135-149
CrossRef42
A. BUHMEIDA, A. ELZAGHEID, A. ÅLGARS, Y. COLLAN, K. SYRJÄNEN, S. PYRHÖNEN. (2008) Expression of the cell-cell adhesion molecule β-catenin in colorectal carcinomas and their metastases. APMIS 116:1, 1-9
CrossRef43
Toshiaki Tanaka, Toshiaki Watanabe, Yoshihiro Kazama, Junichiro Tanaka, Takamitsu Kanazawa, Shinsuke Kazama, Hirokazu Nagawa. (2008) Loss of Smad4 protein expression and 18qLOH as molecular markers indicating lymph node metastasis in colorectal cancer—a study matched for tumor depth and pathology. Journal of Surgical Oncology 97:1, 69-73
CrossRef44
Matthew G. Mutch. (2007) Molecular profiling and risk stratification of adenocarcinoma of the colon. Journal of Surgical Oncology 96:8, 693-703
CrossRef45
Yih-Huei Uen, Shiu-Ru Lin, Deng-Chyang Wu, Yu-Chung Su, Jeng-Yih Wu, Tian-Lu Cheng, Chin-Wen Chi, Jaw-Yuan Wang. (2007) Prognostic Significance of Multiple Molecular Markers for Patients With Stage II Colorectal Cancer Undergoing Curative Resection. Annals of Surgery 246:6, 1040-1046
CrossRef46
Mathew Joseph, Al B. Benson. (2007) Current Issues in Rectal Cancer Chemotherapy. The Cancer Journal 13:3, 198-203
CrossRef47
Audrey Killian, Frédéric Di Fiore, Florence Le Pessot, France Blanchard, Aude Lamy, Grégory Raux, Jean–Michel Flaman, Bernard Paillot, Pierre Michel, Jean–Christophe Sabourin, Jean–Jacques Tuech, Francis Michot, Jean–Pierre Kerckaert, Richard Sesboüé, Thierry Frebourg. (2007) A Simple Method for the Routine Detection of Somatic Quantitative Genetic Alterations in Colorectal Cancer. Gastroenterology 132:2, 645-653
CrossRef48
David Ota, Heidi Nelson. (2007) The Surgeon and Adjuvant Therapy for Stage II Colon Cancer. Annals of Surgical Oncology 14:2, 272-273
CrossRef49
Cinzia Azzoni, Lorena Bottarelli, Nicoletta Campanini, Gabriella Cola, Giovanni Bader, Antonio Mazzeo, Carlo Salvemini, Silvia Morari, Davide Mauro, Enrico Donadei, Luigi Roncoroni, Cesare Bordi, Leopoldo Sarli. (2006) Distinct molecular patterns based on proximal and distal sporadic colorectal cancer: arguments for different mechanisms in the tumorigenesis. International Journal of Colorectal Disease 22:2, 115-126
CrossRef50
T Tanaka, T Watanabe, Y Kazama, J Tanaka, T Kanazawa, S Kazama, H Nagawa. (2006) Chromosome 18q deletion and Smad4 protein inactivation correlate with liver metastasis: a study matched for T- and N- classification. British Journal of Cancer 95:11, 1562-1567
CrossRef51
Frank A. Sinicrope, Rafaela L. Rego, Nathan Foster, Daniel J. Sargent, Harold E. Windschitl, Lawrence J. Burgart, Thomas E. Witzig, Stephen N. Thibodeau. (2006) Microsatellite Instability Accounts for Tumor Site-Related Differences in Clinicopathologic Variables and Prognosis in Human Colon Cancers. The American Journal of Gastroenterology 101:12, 2818-2825
CrossRef52
Khaled M. Madbouly, Anthony J. Senagore, Abir Mukerjee, Conor P. Delaney, Jason Connor, Victor W. Fazio. (2006) Does immunostaining effectively upstage colorectal cancer by identifying micrometastatic nodal disease?. International Journal of Colorectal Disease 22:1, 39-48
CrossRef53
Amr S. Soliman, Melissa Bondy, Charity Renee Webb, David Schottenfeld, Joseph Bonner, Nabih El-Ghawalby, Ahmed Soultan, Mohamed Abdel-Wahab, Omar Fathy, Gamal Ebidi, Qing Zhang, Joel K. Greenson, James L. Abbruzzese, Stanley R. Hamilton. (2006) Differing molecular pathology of pancreatic adenocarcinoma in Egyptian and United States patients. International Journal of Cancer 119:6, 1455-1461
CrossRef54
Julia Draznin, Weijing Sun. (2006) Cancers of the bowel and hepatobiliary tract. Update on Cancer Therapeutics 1:3, 353-365
CrossRef55
Neil P. Zauber, Marlene Sabbath-Solitare, Stephen Marotta, Lilani P. Perera, David T. Bishop. (2006) Adequacy of Colonoscopic Biopsy Specimens for Molecular Analysis: A Comparative Study With Colectomy Tissue. Diagnostic Molecular Pathology 15:3, 162-168
CrossRef56
Robert Gryfe. (2006) Clinical Implications of Our Advancing Knowledge of Colorectal Cancer Genetics: Inherited Syndromes, Prognosis, Prevention, Screening and Therapeutics. Surgical Clinics of North America 86:4, 787-817
CrossRef57
L SARLI, L BOTTARELLI, C AZZONI, N CAMPANINI, G DICOLA, A BARILLI, F MARCHESI, A MAZZEO, C SALVEMINI, S MORARI. (2006) Loss of p27 expression and microsatellite instability in sporadic colorectal cancer. Surgical Oncology 15:2, 97-106
CrossRef58
Z Zheng, A Cantor, G Bepler. (2006) A global genome damage score predictive of lung cancer patients outcome. Oncogene 25:32, 4491-4494
CrossRef59
Dirk M. Bernold, Frank A. Sinicrope. (2006) Advances in Chemotherapy for Colorectal Cancer. Clinical Gastroenterology and Hepatology 4:7, 808-821
CrossRef60
Takumi Ochiai, Kazuhiko Nishimura, Hajime Noguchi, Masayuki Kitajima, Akira Tsukada, Emiko Watanabe, Isao Nagaoka, Shunji Futagawa. (2006) Prognostic impact of orotate phosphoribosyl transferase among 5-fluorouracil metabolic enzymes in resectable colorectal cancers treated by oral 5-fluorouracil-based adjuvant chemotherapy. International Journal of Cancer 118:12, 3084-3088
CrossRef61
Ki-Young Y. Chung, David Kelsen. (2006) Adjuvant therapy for stage II colorectal cancer: Who and with what?. Current Treatment Options in Gastroenterology 9:3, 272-280
CrossRef62
Shih-Ching Chang, Jen-Kou Lin, Shung Haur Yang, Huann-Sheng Wang, Anna Fen-Yau Li, Chin-Wen Chi. (2006) Relationship between genetic alterations and prognosis in sporadic colorectal cancer. International Journal of Cancer 118:7, 1721-1727
CrossRef63
Yasuhiro Inoue, Chikao Miki, Hideki Watanabe, Eiki Ojima, Masato Kusunoki. (2006) Genomic instability and tissue expression of angiogenic growth factors in sporadic colorectal cancer. Surgery 139:3, 305-311
CrossRef64
A. Buhmeida, A. Ålgars, R. Ristamäki, Y. Collan, K. Syrjänen, S. Pyrhönen. (2006) DNA Image Cytometry Is a Useful Adjunct Tool in the Prediction of Disease Outcome in Patients with Stage II and Stage III Colorectal Cancer. Oncology 70:6, 427-437
CrossRef65
Anna Colomer, Nadina Erill, August Vidal, Miquel Calvo, Ruth Roman, Montse Verd??, Carlos Cordon-Cardo, Xavier Puig. (2005) A Novel Logistic Model Based on Clinicopathological Features Predicts Microsatellite Instability in Colorectal Carcinomas. Diagnostic Molecular Pathology 14:4, 213-223
CrossRef66
Christian N. Arnold, Ajay Goel, Hubert E. Blum, C. Richard Boland. (2005) Molecular pathogenesis of colorectal cancer. Cancer 104:10, 2035-2047
CrossRef67
Nadina Erill, Anna Colomer, Miquel Calvo, August Vidal, Ruth Román, Montse Verdú, Carlos Cordón-Cardó, Xavier Puig. (2005) A Novel Multiplexing, Polymerase Chain Reaction-Based Assay for the Analysis of Chromosome 18q Status in Colorectal Cancer. The Journal of Molecular Diagnostics 7:4, 478-485
CrossRef68
M. Nishikawa, S. Nishiguchi, K. Kioka, A. Tamori, M. Inoue. (2005) Interferon reduces somatic mutation of mitochondrial DNA in liver tissues from chronic viral hepatitis patients. Journal of Viral Hepatitis 12:5, 494-498
CrossRef69
Diego Arango, Paivi Laiho, Antti Kokko, Pia Alhopuro, Heli Sammalkorpi, Reijo Salovaara, Daniel Nicorici, Sampsa Hautaniemi, Hafid Alazzouzi, Jukka–Pekka Mecklin, Heikki Järvinen, Akseli Hemminki, Jaakko Astola, Simo Schwartz, Lauri A. Aaltonen. (2005) Gene-Expression Profiling Predicts Recurrence in Dukes’ C Colorectal Cancer. Gastroenterology 129:3, 874-884
CrossRef70
N. Peter Zauber, Marlene Sabbath-Solitare, Stephen Marotta, Ann G. Zauber, William Foulkes, May Chan, Faye Turner, D. Timothy Bishop. (2005) Clinical and genetic findings in an Ashkenazi Jewish population with colorectal neoplasms. Cancer 104:4, 719-729
CrossRef71
P Mehlen, F Llambi. (2005) Role of netrin-1 and netrin-1 dependence receptors in colorectal cancers. British Journal of Cancer 93:1, 1-6
CrossRef72
Jose M. Fernández-Cebrián, Peter Vorwald Kuborn, Mar Pardo Lama, Alfonso Sanjuanbenito Dehesa, Manuel Nevado Santos, Pedro A. Pacheco Martínez, Beatriz Fernández-Escudero. (2005) Estado actual del valor pronóstico de los marcadores moleculares en pacientes con cáncer colorrectal y la predicción de respuesta al tratamiento adyuvante. Clinical and Translational Oncology 7:3, 101-109
CrossRef73
Tianyan Gao, Frank Furnari, Alexandra C. Newton. (2005) PHLPP: A Phosphatase that Directly Dephosphorylates Akt, Promotes Apoptosis, and Suppresses Tumor Growth. Molecular Cell 18:1, 13-24
CrossRef74
Sigal Starinsky, Arie Figer, Edna Ben-Asher, Ravit Geva, Dov Flex, Herma H. Fidder, Jamal Zidan, Doron Lancet, Eitan Friedman. (2005) Genotype phenotype correlations in Israeli colorectal cancer patients. International Journal of Cancer 114:1, 58-73
CrossRef75
James T. Wu, Sanjay Kakar, Richard L. Nelson, Michael L. Mihalov, Brooke Hayward, Peter B. Gilbert, Luna Ghosh. (2005) Prognostic Significance of DCC and p27Kip1 in Colorectal Cancer. Applied Immunohistochemistry & Molecular Morphology 13:1, 45-54
CrossRef76
Luis A. Diaz. (2005) The current clinical value of genomic instability. Seminars in Cancer Biology 15:1, 67-71
CrossRef77
A Sobrero, G Frassineti, A Falcone, L Dogliotti, R Rosso, F D Costanzo, P Bruzzi. (2005) Adjuvant sequential methotrexate → 5-fluorouracil vs 5-fluorouracil plus leucovorin in radically resected stage III and high-risk stage II colon cancer. British Journal of Cancer 92:1, 24-29
CrossRef78
Iana Storojeva, Jean-Louis Boulay, Pierluigi Ballabeni, Martin Buess, Luigi Terracciano, Urban Laffer, Gabriele Mild, Richard Herrmann, Christoph Rochlitz. (2005) Prognostic and Predictive Relevance of DNAM-1, SOCS6 and CADH-7 Genes on Chromosome 18q in Colorectal Cancer. Oncology 68:2-3, 246-255
CrossRef79
Pascal Gervaz, Pascal Bucher, Philippe Morel. (2004) Two colons-two cancers: Paradigm shift and clinical implications. Journal of Surgical Oncology 88:4, 261-266
CrossRef80
Satoru Takebayashi, Arthur Hickson, Tetsuya Ogawa, Kwang-Yoon Jung, Hiroyuki Mineta, Yo Ueda, Reidar Gr
nman, Susan G. Fisher, Thomas E. Carey. (2004) Loss of chromosome arm 18q with tumor progression in head and neck squamous cancer. Genes, Chromosomes and Cancer 41:2, 145-154
CrossRef81
Leopoldo Sarli, Lorena Bottarelli, Giovanni Bader, Domenico Iusco, Silvia Pizzi, Renato Costi, Tiziana DʼAdda, Marco Bertolani, Luigi Roncoroni, Cesare Bordi. (2004) Association Between Recurrence of Sporadic Colorectal Cancer, High Level of Microsatellite Instability, and Loss of Heterozygosity at Chromosome 18q. Diseases of the Colon & Rectum 47:9, 1467-1482
CrossRef82
Marijana Popović Hadžija, Senka Radoševic, Duje Kovačević, Josip Lukač, Mirko Hadžija, Radan Spaventi, Krešimir Pavelić, Sanja Kapitanović. (2004) Status of the DPC4 tumor suppressor gene in sporadic colon adenocarcinoma of Croatian patients: identification of a novel somatic mutation. Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis 548:1-2, 61-73
CrossRef83
Y. Dekel, V. Kugel, P.M. Livne, R. Gal, R. Koren. (2004) DCC protein expression in clear cell renal cell carcinoma. BJU International 93:6, 867-869
CrossRef84
M Kahlenberg. (2003) Molecular prognostics in colorectal cancer. Surgical Oncology 12:3, 173-186
CrossRef85
T Knosel, K Schluns, U Stein, H Schwabe, P M Schlag, M Dietel, I Petersen. (2003) Genetic imbalances with impact on survival in colorectal cancer patients. Histopathology 43:4, 323-331
CrossRef86
Tzong-Shin Tzai, Helen Hai-Wen Chen, Shih-Huang Chan, Chung-Liang Ho, Yuh-Shyan Tsai, Hong-Lin Cheng, Yuan-Chang Dai, Johnny Shinn-Nan Lin, Wen-Hong Yang, Nan-Haw Chow. (2003) Clinical significance of allelotype profiling for urothelial carcinoma. Urology 62:2, 378-384
CrossRef87
U. Lindforss, N. Papadogiannakis, H. Zetterquist, G. Lindberg, H. Olivecrona. (2003) Distribution of genetic variants in preneoplastic areas of colorectal tumours. European Journal of Surgical Oncology (EJSO) 29:6, 491-496
CrossRef88
Rumelia Koren, Yoram Dekel, Evgeny Sherman, Yona Weissman, Zeev Dreznik, Baruch Klein, Rivka Gal. (2003) The Expression of DCC Protein in Female Breast Cancer. Breast Cancer Research and Treatment 80:2, 215-220
CrossRef89
Sharlene Gill, Richard M. Goldberg. (2003) New developments in therapy for colorectal cancer. Current Oncology Reports 5:3, 183-191
CrossRef90
Jean-Louis Boulay, Gabriele Mild, Adam Lowy, Juergen Reuter, Magali Lagrange, Luigi Terracciano, Urban Laffer, Richard Herrmann, Christoph Rochlitz. (2003) SMAD7 is a prognostic marker in patients with colorectal cancer. International Journal of Cancer 104:4, 446-449
CrossRef91
D.A Lawes, S SenGupta, P.B Boulos. (2003) The clinical importance and prognostic implications of microsatellite instability in sporadic cancer. European Journal of Surgical Oncology (EJSO) 29:3, 201-212
CrossRef92
Jan Stoehlmacher, Heinz-Josef Lenz. (2003) Implications of Genetic Testing in the Management of Colorectal Cancer. American Journal of PharmacoGenomics 3:2, 73-88
CrossRef93
Jacinto Garcia, Angel Duran, Maria Dolores Tabernero, Asunci
CrossRef94
PL Barratt, MT Seymour, SP Stenning, I Georgiades, C Walker, K Birbeck, P Quirke. (2002) DNA markers predicting benefit from adjuvant fluorouracil in patients with colon cancer: a molecular study. The Lancet 360:9343, 1381-1391
CrossRef95
Leonard B Saltz, Bruce Minsky. (2002) Adjuvant therapy of cancers of the colon and rectum. Surgical Clinics of North America 82:5, 1035-1058
CrossRef96
J-L Boulay, G Mild, A Lowy, J Reuter, M Lagrange, L Terracciano, U Laffer, R Herrmann, C Rochlitz. (2002) SMAD4 is a predictive marker for 5-fluorouracil-based chemotherapy in patients with colorectal cancer. British Journal of Cancer 87:41, 630-634
CrossRef97
William M. Grady, Sanford D. Markowitz. (2002) G
ENETIC AND EPIGENETIC ALTERATIONS IN COLON CANCER . Annual Review of Genomics and Human Genetics 3:1, 101-128
CrossRef98
June L. Traicoff, James K. V. Willson, Sanford D. Markowitz. (2002) Early loss of deleted in colorectal carcinoma gene transcript detected in a group of benign colon adenomas. Journal of Biomedical Science 9:6, 716-720
CrossRef99
Holly L. Neibergs, David W. Hein, John S. Spratt. (2002) Genetic profiling of colon cancer. Journal of Surgical Oncology 80:4, 204-213
CrossRef100
Weijing Sun, Daniel G Haller. (2002) Chemotherapy for colorectal cancer. Hematology/Oncology Clinics of North America 16:4, 969-994
CrossRef101
Amy V. Gerstein, Teresa Acosta Almeida, Guojing Zhao, Eric Chess, Ie-Ming Shih, Kent Buhler, Kenneth Pienta, Mark A. Rubin, Robert Vessella, Nickolas Papadopoulos. (2002) APC/CTNNB1 (?-catenin) pathway alterations in human prostate cancers. Genes, Chromosomes and Cancer 34:1, 9-16
CrossRef102
Han-Shiang Chen, Shyr-Ming Sheen-Chen, Chen-Chang Lu. (2002) DNA index and S-phase fraction in curative resection of colorectal adenocarcinoma: Analysis of prognosis and current trends. World Journal of Surgery 26:5, 626-630
CrossRef103
M. E. Candusso, O. Luinetti, L. Villani, P. Alberizzi, C. Klersy, R. Fiocca, G. N. Ranzani, E. Solcia. (2002) Loss of heterozygosity at 18q21 region in gastric cancer involves a number of cancer-related genes and correlates with stage and histology, but lacks independent prognostic value. The Journal of Pathology 197:1, 44-50
CrossRef104
Boris Pasche, Mary Mulcahy, Al B. Benson. (2002) Molecular markers in prognosis of colorectal cancer and prediction of response to treatment. Best Practice & Research Clinical Gastroenterology 16:2, 331-345
CrossRef105
Jennifer T. Loud, June A. Peters, Mary Fraser, Jean Jenkins. (2002) Applications of Advances in Molecular Biology and Genomics to Clinical Cancer Care. Cancer Nursing 25:2, 110-122
CrossRef106
Pascal Gervaz, Jean-Philippe Cerottini, Hanifa Bouzourene, Dieter Hahnloser, Christy L Doan, Jean Benhattar, Pascal Chaubert, Michelle Secic, Michel Gillet, John M Carethers. (2002) Comparison of microsatellite instability and chromosomal instability in predicting survival of patients with T3N0 colorectal cancer. Surgery 131:2, 190-197
CrossRef107
F Piard, C Chapusot, A Ecarnot-Laubriet, T Ponnelle, L Martin. (2002) Molecular markers of heterogeneity in colorectal cancers and adenomas. European Journal of Cancer Prevention 11:1, 85-97
CrossRef108
Wei Zhou, Steven N Goodman, Gennaro Galizia, Eva Lieto, Francesca Ferraraccio, Carlo Pignatelli, Colin A Purdie, Juan Piris, Robert Morris, David J Harrison, Philip B Paty, Al Culliford, Katharine E Romans, Elizabeth A Montgomery, Michael A Choti, Kenneth W Kinzler, Bert Vogelstein. (2002) Counting alleles to predict recurrence of early-stage colorectal cancers. The Lancet 359:9302, 219-225
CrossRef109
Xiao Cheng Wu, Vivien W. Chen, Brooke Steele, Bernado Ruiz, John Fulton, Lihua Liu, Susan E. Carozza, Robert Greenlee. (2001) Subsite-specific incidence rate and stage of disease in colorectal cancer by race, gender, and age group in the United States, 1992-1997. Cancer 92:10, 2547-2554
CrossRef110
G. Burdy, Y. Panis, A. Alves, J. Nemeth, A. Lavergne-Slove, P. Valleur. (2001) Identifying patients with T3-T4 node-negative colon cancer at high risk of recurrence. Diseases of the Colon & Rectum 44:11, 1682-1688
CrossRef111
Yoko Harima, Satoshi Sawada, Kenji Nagata, Mitsuharu Sougawa, Takeo Ohnishi. (2001) Chromosome 6p21.2, 18q21.2 and human papilloma virus (HPV) DNA can predict prognosis of cervical cancer after radiotherapy. International Journal of Cancer 96:5, 286-296
CrossRef112
A S Soliman, M L Bondy, S A El-Badawy, N Mokhtar, S Eissa, S Bayoumy, I A Seifeldin, P S Houlihan, J R Lukish, T Watanabe, A On On Chan, D Zhu, C I Amos, B Levin, S R Hamilton. (2001) Contrasting molecular pathology of colorectal carcinoma in Egyptian and Western patients. British Journal of Cancer 85:7, 1037-1046
CrossRef113
Susanne Merkel, Axel Wein, Klaus G
CrossRef114
Stefania Vasselli, PhD, Alessia Brenna, Igea D'Agnano, PhD, Carmen D'Angelo, Maurizio Cosimelli, MD, Maria Benevolo, PhD, Simonetta Buglioni, PhD, Marcella Mottolese, PhD, Raffaele Perrone Donnorso, MD, Gabriella Zupi, PhD. (2001) p53 Nuclear Accumulation and Multiploidy Are Adverse Prognostic Factors in Surgically Resected Stage II Colorectal Cancers Independent of Fluorouracil-Based Adjuvant Therapy. American Journal of Clinical Pathology 116:3, 360-368
CrossRef115
Francesco Graziano, Vincenzo Catalano, Anna Maria Baldelli, Stefano Cascinu. (2001) Prognostic biomarkers in resected colorectal cancer: implications for adjuvant chemotherapy. Expert Review of Anticancer Therapy 1:2, 247-257
CrossRef116
Heini Lassus, Reijo Salovaara, Lauri A. Aaltonen, Ralf Butzow. (2001) Allelic Analysis of Serous Ovarian Carcinoma Reveals Two Putative Tumor Suppressor Loci at 18q22-q23 Distal to SMAD4, SMAD2, and DCC. The American Journal of Pathology 159:1, 35-42
CrossRef117
Maarit I. Tiirikainen, Brian P. Mullaney, Elizabeth A. Holly, Maria G. Pallavicini, Ronald H. Jensen. (2001) DNA Copy Number Alterations in HIV-Positive and HIV-Negative Patients With Diffuse Large-Cell Lymphomas. JAIDS Journal of Acquired Immune Deficiency Syndromes 27:3, 272-276
CrossRef118
Maarit I. Tiirikainen, Brian P. Mullaney, Elizabeth A. Holly, Maria G. Pallavicini, Ronald H. Jensen. (2001) DNA Copy Number Alterations in HIV-Positive and HIV-Negative Patients With Diffuse Large-Cell Lymphomas. Journal of Acquired Immune Deficiency Syndromes 27:3, 272-276
CrossRef119
S. M. Dong, G. Traverso, C. Johnson, L. Geng, R. Favis, K. Boynton, K. Hibi, S. N. Goodman, M. D'Allessio, P. Paty, S. R. Hamilton, D. Sidransky, F. Barany, B. Levin, A. Shuber, K. W. Kinzler, B. Vogelstein, J. Jen. (2001) Detecting Colorectal Cancer in Stool With the Use of Multiple Genetic Targets. JNCI Journal of the National Cancer Institute 93:11, 858-865
CrossRef120
Abeezar I. Sarela, Nigel Scott, Jane Ramsdale, Alexander F. Markham, Pierre J Guillou. (2001) Immunohistochemical Detection of the Anti-Apoptosis Protein, Survivin, Predicts Survival After Curative Resection of Stage II Colorectal Carcinomas. Annals of Surgical Oncology 8:4, 305-310
CrossRef121
Watanabe, Toshiaki, Wu, Tsung-Teh, Catalano, Paul J., Ueki, Takashi, Satriano, RobertHaller, Daniel G., Benson, Al B., Hamilton, Stanley R., . (2001) Molecular Predictors of Survival after Adjuvant Chemotherapy for Colon Cancer. New England Journal of Medicine 344:16, 1196-1206
Full Text122
Albert Font, Albert Abad, Mariano Monzó, Jose J. Sanchez, Monica Guillot, Jose L. Manzano, Marta Piñol, Isabel Ojanguren, Rafael Rosell. (2001) Prognostic value of K- ras mutations and allelic imbalance on chromosome 18q in patients with resected colorectal cancer. Diseases of the Colon & Rectum 44:4, 549-557
CrossRef123
Ettore Seregni, Leonardo Ferrari, Antonia Martinetti, Emilio Bombardieri. (2001) Diagnostic and prognostic tumor markers in the gastrointestinal tract. Seminars in Surgical Oncology 20:2, 147-166
CrossRef124
Kentaro Nakao, M. Shibusawa, A. Ishihara, H. Yoshizawa, A. Tsunoda, M. Kusano, A. Kurose, T. Makita, K. Sasaki. (2001) Genetic changes in colorectal carcinoma tumors with liver metastases analyzed by comparative genomic hybridization and DNA ploidy. Cancer 91:4, 721-726
CrossRef125
Barbara A. Leggett, Benedict Devereaux, Kelli Biden, Jeffrey Searle, Joanne Young, Jeremy Jass. (2001) Hyperplastic Polyposis. The American Journal of Surgical Pathology 25:2, 177-184
CrossRef126
J. Zhang, Z. Fan, Y. Gao, Z. Xiao, C. Li, Q. An, S. Cheng. (2001) Detecting Bladder Cancer in the Chinese by Microsatellite Analysis: Ethnic and Etiologic Considerations. JNCI Journal of the National Cancer Institute 93:1, 45-50
CrossRef127
Annika Lindblom. (2001) Different mechanisms in the tumorigenesis of proximal and distal colon cancers. Current Opinion in Oncology 13:1, 63-69
CrossRef128
M. Ponz de Leon, A. Percesepe. (2000) Pathogenesis of colorectal cancer. Digestive and Liver Disease 32:9, 807-821
CrossRef129
F.Charles Brunicardi. (2000) Molecular surgery and biology. The American Journal of Surgery 180:6, 397-401
CrossRef130
Wenting Fu, Lukas Bubendorf, Niels Willi, Holger Moch, Michael J Mihatsch, Guido Sauter, Thomas C Gasser. (2000) Genetic changes in clinically organ-confined prostate cancer by comparative genomic hybridization. Urology 56:5, 880-885
CrossRef131
Jianming Zhao, Roland R. de Krijger, Dorette Meier, Ernst-Jan M. Speel, Parvin Saremaslani, Seraina Muletta-Feurer, Claudia Matter, Jürgen Roth, Philipp U. Heitz, Paul Komminoth. (2000) Genomic Alterations in Well-Differentiated Gastrointestinal and Bronchial Neuroendocrine Tumors (Carcinoids). The American Journal of Pathology 157:5, 1431-1438
CrossRef132
Richard Naidoo, Michelle Tarin, Runjan Chetty. (2000) A comparative microsatellite analysis of colorectal cancer in patients <35 years and >50 years of age. The American Journal of Gastroenterology 95:11, 3266-3275
CrossRef133
Pilar Iniesta, Mar
CrossRef134
Ulrik Lindforss, Hanna Fredholm, Nikos Papadogiannakis, Adel Gad, Henrik Zetterquist, Hans Olivecrona. (2000) Allelic loss is heterogeneous throughout the tumor in colorectal carcinoma. Cancer 88:12, 2661-2667
CrossRef135
Thomas Anthony, Jason B Fleming, Samuel C Bieligk, George A Sarosi, Lawrence T Kim, Sharon G Gregorcyk, Clifford L Simmang, Richard H Turnage. (2000) Postoperative colorectal cancer surveillance. Journal of the American College of Surgeons 190:6, 737-749
CrossRef136
Alyssa Gelmann, Rodwige Desnoyers, Burt Cagir, David Weinberg, Bruce M Boman, Scott A Waldman. (2000) Colorectal cancer staging and adjuvant chemotherapy. Expert Opinion on Pharmacotherapy 1:4, 737-755
CrossRef137
Morton S. Kahlenberg, Daniel L. Stoler, Miguel A. Rodriguez-Bigas, Thomas K. Weber, Deborah L. Driscoll, Garth R. Anderson, Nicholas J. Petrelli. (2000) p53 tumor suppressor gene mutations predict decreased survival of patients with sporadic colorectal carcinoma. Cancer 88:8, 1814-1819
CrossRef138
JIN JEN, LI WU, DAVID SIDRANSKY. (2000) An Overview on the Isolation and Analysis of Circulating Tumor DNA in Plasma and Serum. Annals of the New York Academy of Sciences 906:1, 8-12
CrossRef139
Carolyn Compton, Cecilia M. Fenoglio-Preiser, Norman Pettigrew, L. Peter Fielding. (2000) American Joint Committee on Cancer prognostic factors consensus conference. Cancer 88:7, 1739-1757
CrossRef140
Mark A. Rubin, Amy Gerstein, Kris Reid, David G. Bostwick, Liang Cheng, Ramon Parsons, Nickolas Papadopoulos. (2000) 1Oq23.3 loss of heterozygosity is higher inlymph node-positive (PT2-3,N+) versus lymph node-negative (PT2-3,N0) prostate cancer. Human Pathology 31:4, 504-508
CrossRef141
Geeta Lal, Ling Liu, David Hogg, Norman J. Lassam, Mark S. Redston, Steven Gallinger. (2000) Patients with both pancreatic adenocarcinoma and melanoma may harbor germlineCDKN2A mutations. Genes, Chromosomes and Cancer 27:4, 358-361
CrossRef142
J Takita. (2000) Allelic imbalance on chromosome 18 in neuroblastoma. European Journal of Cancer 36:4, 508-513
CrossRef143
Minoru Takata, Reiji Morita, Kazuhiko Takehara. (2000) Clonal heterogeneity in sporadic melanomas as revealed by loss-of-heterozygosity analysis. International Journal of Cancer 85:4, 492-497
CrossRef144
Karin D. Berg, Cynthia L. Glaser, Richard E. Thompson, Stanley R. Hamilton, Constance A. Griffin, James R. Eshleman. (2000) Detection of Microsatellite Instability by Fluorescence Multiplex Polymerase Chain Reaction. The Journal of Molecular Diagnostics 2:1, 20-28
CrossRef145
Offit, Kenneth, . (2000) Genetic Prognostic Markers for Colorectal Cancer. New England Journal of Medicine 342:2, 124-125
Full Text146
Daniela E. Aust, Robert F. Willenbucher, Jonathan P. Terdiman, Linda D. Ferrell, Cornell G. Chang, Dan H. Moore, Annette Molinaro-Clark, Gustavo B. Baretton, Udo Loehrs, Frederic M. Waldman. (2000) Chromosomal alterations in ulcerative colitis-related and sporadic colorectal cancers by comparative genomic hybridization. Human Pathology 31:1, 109-114
CrossRef147
Yoshimitsu Akiyama, Takehiro Arai, Hiromi Nagasaki, Osmar Kenji Yagi, Atsuko Nakahata, Tomoko Nakajima, Yasuo Ohkura, Takehisa Iwai, Kiyoshi Saitoh, Yasuhito Yuasa. (1999) Frequent Allelic Imbalance on Chromosome 18q21 in Early Superficial Colorectal Cancers. Cancer Science 90:12, 1329-1337
CrossRef148
Jeffrey N. Weitzel. (1999) Genetic cancer risk assessment. Cancer 86:S11, 2483-2492
CrossRef149
Antonieta Salud, Jos
CrossRef150
Jeffrey N. Weitzel. (1999) Genetic cancer risk assessment. Cancer 86:S8, 1663-1672
CrossRef151
Pilar Jim
CrossRef152
Richard Naidoo, Michelle Tarin, Anunathan Reddi, Runjan Chetty. (1999) Allelic Imbalance and Microsatellite Instability in Chromosomes 2p, 3p, 5q, and 18q in Esophageal Squamous Carcinoma in Patients From South Africa. Diagnostic Molecular Pathology 8:3, 131-137
CrossRef153
Beatriz Carvalho, Raquel Seruca, F
CrossRef154
K. C. Halling, A. J. French, S. K. McDonnell, L. J. Burgart, D. J. Schaid, B. J. Peterson, L. Moon-Tasson, M. R. Mahoney, D. J. Sargent, M. J. O'Connell, T. E. Witzig, G. H. Farr, R. M. Goldberg, S. N. Thibodeau. (1999) Microsatellite Instability and 8p Allelic Imbalance in Stage B2 and C Colorectal Cancers. JNCI Journal of the National Cancer Institute 91:15, 1295-1303
CrossRef155
Werner Hilgers, Gloria H. Su, Bas Groot Koerkamp, David J. Tang, Manu C. Shekher, Avrahom Y. Sugar, Charles J. Yeo, Ralph H. Hruban, Scott E. Kern. (1999) Novel homozygous deletions of chromosomal band 18q22 in pancreatic adenocarcinoma identified by STS marker scanning. Genes, Chromosomes and Cancer 25:4, 370-375
CrossRef156
John S. Spratt, John S. Meyer. (1999) Biological considerations with pelvic neoplasms. Journal of Surgical Oncology 71:3, 198-205
CrossRef157
Robert F. Willenbucher, Daniela E. Aust, Cornell G. Chang, Suzanne J. Zelman, Linda D. Ferrell, Dan H. Moore, Frederic M. Waldman. (1999) Genomic Instability Is an Early Event during the Progression Pathway of Ulcerative-Colitis-Related Neoplasia. The American Journal of Pathology 154:6, 1825-1830
CrossRef158
Nancy Dumont. (1999) Genetic and epigenetic contributions to colorectal cancer. APMIS 107:7-12, 711-722
CrossRef159
Bruce D. Minsky, Alfred M. Cohen. (1999) Blood Vessel Invasion in Colorectal Cancer?an Alternative to TNM Staging?. Annals of Surgical Oncology 6:2, 129-130
CrossRef160
AGUIARI, MARTINELLO, CASARO, ROSSI, PIVA, MOLLICA, CAVAZZINI, DEL SENNO. (1999) LOH of chromosome 6q compared with LOH of 17q and 18q in ovarian cancers: relationship to p53 expression and clinicopathological findings. International Journal of Gynecological Cancer 9:2, 147-155
CrossRef161
R GRYFE, N DINICOLA, G LAL, S GALLINGER, M REDSTON. (1999) Inherited Colorectal Polyposis and Cancer Risk of the APC I1307K Polymorphism. The American Journal of Human Genetics 64:2, 378-384
CrossRef162
Bret A. Lashner, Bradley D. Shapiro, Asif Husain, John R. Goldblum. (1999) Evaluation of the usefulness of testing for p53 mutations in colorectal cancer surveillance for ulcerative colitis. The American Journal of Gastroenterology 94:2, 456-462
CrossRef163
H L McLeod, G I Murray. (1999) Tumour markers of prognosis in colorectal cancer. British Journal of Cancer 79:2, 191-203
CrossRef164
Upender Manne, Heidi L. Weiss, Russell B. Myers, Omar K. Danner, Cecilia Moron, Sudhir Srivastava, William E. Grizzle. (1998) Nuclear accumulation of p53 in colorectal adenocarcinoma. Cancer 83:12, 2456-2467
CrossRef165
James D. Mueller, Nina Haegle, Gisela Keller, Elke Mueller, Gabriele Saretzky, Birgit Bethke, Manfred Stolte, Heinz Höfler. (1998) Loss of Heterozygosity and Microsatellite Instability inDe Novo versus Ex-Adenoma Carcinomas of the Colorectum. The American Journal of Pathology 153:6, 1977-1984
CrossRef166
Jan Zedenius, Trisha Dwight, Bruce G. Robinson, Leigh Delbridge, Martin Backdahl, Goran Wallin, Catharina Larsson, Gunther Weber. (1998) A Rapid Method for DNA Extraction from Fine-Needle Aspiration Biopsies of Thyroid Tumors, and Subsequent RET Mutation Analysis. Cancer Detection <html_ent glyph="@amp;" ascii="&"/> Prevention 22:6, 544-548
CrossRef167
J MilburnJessup. (1998) Tumor markers – prognostic and therapeutic implications for colorectal carcinoma. Surgical Oncology 7:3-4, 139-151
CrossRef168
B Fahy. (1998) Epidemiology and molecular genetics of colorectal cancer. Surgical Oncology 7:3-4, 115-123
CrossRef169
Tadahiro Nozoe, Takashi Matsumata, Masayuki Kitamura, Keizo Sugimachi. (1998) Significance of preoperative elevation of serum C-reactive protein as an indicator for prognosis in colorectal cancer. The American Journal of Surgery 176:4, 335-338
CrossRef170
Toru Hiyama, Hiroshi Yokozaki, Fumio Shimamoto, Ken Haruma, Wataru Yasui, Goro Kajiyama, Eiichi Tahara. (1998) Frequentp53 gene mutations in serrated adenomas of the colorectum. The Journal of Pathology 186:2, 131-139
CrossRef171
Takato Fujiwara, Joshua M. Stolker, Toshiaki Watanabe, Asif Rashid, Patti Longo, James R. Eshleman, Susan Booker, Henry T. Lynch, Jeremy R. Jass, Jane S. Green, Hoguen Kim, Jin Jen, Bert Vogelstein, Stanley R. Hamilton. (1998) Accumulated Clonal Genetic Alterations in Familial and Sporadic Colorectal Carcinomas with Widespread Instability in Microsatellite Sequences. The American Journal of Pathology 153:4, 1063-1078
CrossRef172
Matilde E. Lleonart, Jes
CrossRef173
J. Milburn Jessup, Massimo Loda. (1998) Prognostic markers in rectal carcinoma. Seminars in Surgical Oncology 15:2, 131-140
CrossRef174
C. Richard Boland, Juichi Sato, Koji Saito, John M. Carethers, Giancarlo Marra, Luigi Laghi, Chauhan. (1998) Genetic Instability and Chromosomal Aberrations in Colorectal Cancer: A Review of the Current Models. Cancer Detection <html_ent glyph="@amp;" ascii="&"/> Prevention 22:5, 377-382
CrossRef175
Giovanni Lanza, Maurizio Matteuzzi, Roberta Gafá, Enrico Orvieto, Iva Maestri, Alessandra Santini, Laura del Senno. (1998) Chromosome 18q allelic loss and prognosis in stage II and III colon cancer. International Journal of Cancer 79:4, 390-395
CrossRef176
Carlo Ratto, Luigi Sofo, Massimo Ippoliti, Marta Merico, Giovanni Battista Doglietto, Francesco Crucitti. (1998) Prognostic factors in colorectal cancer. Diseases of the Colon & Rectum 41:8, 1033-1049
CrossRef177
Liefers, Gerrit-Jan, Cleton-Jansen, Anne-Marie, van de Velde, Cornelis J.H., Hermans, Jo, van Krieken, Johannes H.J.M., Cornelisse, Cees J., Tollenaar, Rob A.E.M., . (1998) Micrometastases and Survival in Stage II Colorectal Cancer. New England Journal of Medicine 339:4, 223-228
Full Text178
Patrice Watson, Kevin M. Lin, Miguel A. Rodriguez-Bigas, Tom Smyrk, Stephen Lemon, M. Shashidharan, Barbara Franklin, Beth Karr, Alan Thorson, Henry T. Lynch. (1998) Colorectal carcinoma survival among hereditary nonpolyposis colorectal carcinoma family members. Cancer 83:2, 259-266
CrossRef179
Graeme A. Macdonald, Joel K. Greenson, Koji Saito, Sajeev P. Cherian, Henry D. Appelman, C. Richard Boland. (1998) Microsatellite instability and loss of heterozygosity at DNA mismatch repair gene loci occurs during hepatic carcinogenesis. Hepatology 28:1, 90-97
CrossRef180
Eva Martínez-López, Albert Abad, Albert Font, Mariano Monzó, Isabel Ojanguren, Alex Pifarré, José Javier Sánchez, Cristina Martín, Rafael Rosell. (1998) Allelic loss on chromosome 18q as a prognostic marker in stage II colorectal cancer. Gastroenterology 114:6, 1180-1187
CrossRef181
Marc A. Reymond, Otto Dworak, Stephan Remke, Werner Hohenberger, Thomas Kirchner, Ferdinand Köckerling. (1998) DCC protein as a predictor of distant metastases after curative surgery for rectal cancer. Diseases of the Colon & Rectum 41:6, 755-760
CrossRef182
Daniel C. Chung. (1998) Molecular prognostic markers and colorectal cancer: The search goes on. Gastroenterology 114:6, 1330-1332
CrossRef183
John M. Carethers, Mary T. Hawn, Joel K. Greenson, Charles L. Hitchcock, C.Richard Boland. (1998) Prognostic significance of allelic loss at chromosome 18q21 for stage II colorectal cancer. Gastroenterology 114:6, 1188-1195
CrossRef184
Daniel A Haber, Eric R Fearon. (1998) The promise of cancer genetics. The Lancet 351, SII1-SII8
CrossRef185
Phyllis C Huettner, Daniela S Gerhard, Lina Li, Deborah J Gersell, Keith Dunnigan, Tatiana Kamarasova, Janet S Rader. (1998) Loss of heterozygosity in clinical stage IB cervical carcinoma: Relationship with clinical and histopathologic features. Human Pathology 29:4, 364-370
CrossRef186
Robert D. Madoff. (1998) Reply to walfisch and Koretz. Diseases of the Colon & Rectum 41:4, 528-529
CrossRef187
Richard P. Pearlstein, Michael S. Benninger, Thomas E. Carey, Richard J. Zarbo, Frank X. Torres, Benjamin A. Rybicki, Daniel L. Van Dyke. (1998) Loss of 18q predicts poor survival of patients with squamous cell carcinoma of the head and neck. Genes, Chromosomes and Cancer 21:4, 333-339
CrossRef188
Jean-Philippe Cerottini, Scott Caplin, Emilia Saraga, Jean-Claude Givel, Jean Benhattar. (1998) The Type of K-ras Mutation Determines Prognosis in Colorectal Cancer. The American Journal of Surgery 175:3, 198-202
CrossRef189
Hiroyuki Yamamoto, Fumio Itoh, Masanobu Kusano, Yukinari Yoshida, Yuji Hinoda, Kohzoh Imai. (1998) Infrequent Inactivation ofDCCGene in Replication Error-Positive Colorectal Cancers. Biochemical and Biophysical Research Communications 244:1, 204-209
CrossRef190
Robert Jenkins, Satoru Takahashi, Karen Delacey, Erik Bergstralh, Michael Lieber. (1998) Prognostic significance of allelic imbalance of chromosome arms 7q, 8p, 16q, and 18q in stage T3N0M0 prostate cancer. Genes, Chromosomes and Cancer 21:2, 131-143
CrossRef191
Jeffrey R. Lukish, Kenji Muro, John DeNobile, Rachel Katz, John Williams, David F. Cruess, William Drucker, Ilan Kirsch, Stanley R. Hamilton. (1998) Prognostic Significance of DNA Replication Errors in Young Patients With Colorectal Cancer. Annals of Surgery 227:1, 51-56
CrossRef192
Hoguen Kim, Zhe Piao, Jae Woo Kim, Jin Sub Choi, Nam Kyu Kim, Jae Myun Lee, Jeon-Han Park. (1998) Expression of hMSH2 and hMLH1 in Colorectal Carcinomas with Microsatellite Instability. Pathology - Research and Practice 194:1, 3-9
CrossRef193
Giovanni Lanza, Roberta Gafà, Alessandra Santini, Iva Maestri, Alessandra Dubini, Giuseppe Gilli, Luigi Cavazzini. (1998) Prognostic significance of DNA ploidy in patients with stage II and stage III colon carcinoma. Cancer 82:1, 49-59
CrossRef194
Alfred M. Cohen, David Kelsen, Leonard Saltz, Bruce D. Minsky, Heidi Nelson, Dr.Ridzuan Farouk, Leonard L. Gunderson, Fabrizio Michelassi, Richard B. Arenas, Richard L. Schilsky, Christopher G. Willet. (1998) Adjuvant therapy for colorectal cancer. Current Problems in Cancer 22:1, 11-77
CrossRef195
B Bradley. (1997) Molecular advances in the etiology and treatment of colorectal cancer. Surgical Oncology 6:3, 143-156
CrossRef196
Zhe Piao, Young Nyun Park, Hoguen Kim, Chanil Park. (1997) Clonality of large regenerative nodules in liver cirrhosis. Liver 17:5, 251-256
CrossRef197
John Roesler, Eri Srivatsan, Farhad Moatamed, Julius Peters, Edward H. Livingston. (1997) Tumor suppressor activity of neural cell adhesion molecule in colon carcinoma. The American Journal of Surgery 174:3, 251-257
CrossRef198
Steven J. Laken, Gloria M. Petersen, Stephen B. Gruber, Carole Oddoux, Harry Ostrer, Francis M. Giardiello, Stanley R. Hamilton, Heather Hampel, Arnold Markowitz, David Klimstra, Suresh Jhanwar, Sidney Winawer, Kenneth Offit, Michael C. Luce, Kenneth W. Kinzler, Bert Vogelstein. (1997) Familial colorectal cancer in Ashkenazim due to a hypermutable tract in APC. Nature Genetics 17:1, 79-83
CrossRef199
Robert Gryfe, Bharati Bapat, Steven Gallinger, Carol Swallow, Mark Redston, Jean Couture. (1997) Molecular biology of colorectal cancer. Current Problems in Cancer 21:5, 233-299
CrossRef200
Georgia Bardi, Luis Antonio Parada, Lilian Bomme, Nikos Pandis, Bertil Johansson, Roger Willén, Claus Fenger, Ole Kronborg, Felix Mitelman, Sverre Heim. (1997) Cytogenetic findings in metastases from colorectal cancer. International Journal of Cancer 72:4, 604-607
CrossRef201
Sergio Casillas, Robert J. Pelley, Jeffrey W. Milsom. (1997) Adjuvant therapy for colorectal cancer. Diseases of the Colon & Rectum 40:8, 977-992
CrossRef202
David J. Vaughn, Daniel G. Haller. (1997) THE ROLE OF ADJUVANT CHEMOTHERAPY IN THE TREATMENT OF COLORECTAL CANCER. Hematology/Oncology Clinics of North America 11:4, 699-719
CrossRef203
Timothy C. Hoops, Peter G. Traber. (1997) MOLECULAR PATHOGENESIS OF COLORECTAL CANCER. Hematology/Oncology Clinics of North America 11:4, 609-633
CrossRef204
T. H. K. Schiedeck, S. Christoph, H. -P. Bruch. (1997) Serologische Diagnostik kolorektaler Karzinome. Coloproctology 19:4, 155-158
CrossRef205
Rafael Rosell, Alex Pifarré, Mariano Monzó, Julio Astudillo, M. Paz López-Cabrerizo, Roser Calvo, Isabel Moreno, Montserrat Sánchez-Céspedes, Albert Font, José J. Navas-Palacios. (1997) Reduced survival in patients with stage-I non-small-cell lung cancer associated with DNA-replication errors. International Journal of Cancer 74:3, 330-334
CrossRef206
Michel Longy, Bernadette Duboue, Pierre Soubeyran, Daniel Moynet. (1997) Method for the Purification of Tissue DNA Suitable for PCR After Fixation with Bouinʼs Fluid. Diagnostic Molecular Pathology 6:3, 167-173
CrossRef207
C Caldas, BAJ Ponder. (1997) Cancer genes and molecular oncology in the clinic. The Lancet 349, S16-S18
CrossRef208
Alastair J. M. Watson. (1997) The role of apoptosis in intestinal disease. Journal of Gastroenterology 32:3, 414-423
CrossRef209
Caroline Fung, Tara Bragg, Ronald Newland, Owen Dent, Garth Nicholson, Lesley BOKEY, Pierre Chapuis. (1997) K-RAS MUTATION AND LOSS OF HETEROZYGOSITY OF CHROMOSOME 17P AND SURVIVAL IN COLORECTAL CANCER. ANZ Journal of Surgery 67:5, 239-244
CrossRef210
Maria R. Oliva, Francisco Ripoll, Pilar Muñiz, Antonio Iradi, Ramón Trullenque, Victoria Valls, Eraci Drehmer, Guillermo T. Sáez. (1997) Genetic alterations and oxidative metabolism in sporadic colorectal tumors from a Spanish community. Molecular Carcinogenesis 18:4, 232-243
CrossRef211
Victor E. Pricolo, Sydney D. Finkelstein, Kirby I. Bland. (1997) Topographic genotyping of colorectal carcinoma: From a molecular carcinogenesis model to clinical relevance. Annals of Surgical Oncology 4:3, 269-278
CrossRef212
Anjan K Banerjee. (1997) DCC expression and prognosis in colorectal cancer. The Lancet 349:9057, 968
CrossRef213
Ruby Kochhar, Kevin C. Hailing, Shannon McDonnell, Daniel J. Schaid, Amy J. French, Michael J. OʼConnell, David M. Nagorney, Stephen N. Thibodeau. (1997) Allelic Imbalance and Microsatellite Instability in Resected Dukeʼs D Colorectal Cancer. Diagnostic Molecular Pathology 6:2, 78-84
CrossRef214
Makoto Ohbu, Makoto Saegusa, Nobuyuki Kobayashi, Hideto Tsukamoto, Hironobu Mieno, Akira Kakita, Isao Okayasu. (1997) Expression ofbcl-2 protein in esophageal squamous cell carcinomas and its association with lymph node metastasis. Cancer 79:7, 1287-1293
CrossRef215
Hugh E. Mulcahy, Mary Toner, Stephen E. Patchett, Leslie Daly, Diarmuid P. OʼDonoghue. (1997) Identifying Stage B colorectal cancer patients at high risk of tumor recurrence and death. Diseases of the Colon & Rectum 40:3, 326-331
CrossRef216
Nancy A. Krucher, John W. Ludlow. (1997) Clonal evolution of N-methylnitrosourea-induced C57BL/6J thymic lymphomas by analysis of multiple genetic alterations. Leukemia Research 21:3, 199-200
CrossRef217
Mario Lise, Massimo Loda, Michelangelo Fiorentino, Arthur M. Mercurio, Ian C. Summerhayes, Philip T. Lavin, J. Milburn Jessup. (1997) Association between sucrase-isomaltase and p53 expression in colorectal cancer. Annals of Surgical Oncology 4:2, 176-183
CrossRef218
James R. Howe, José G. Guillem. (1997) THE GENETICS OF COLORECTAL CANCER. Surgical Clinics of North America 77:1, 175-195
CrossRef219
Enrique A. Diaz-Canton, Richard Pazdur. (1997) ADJUVANT MEDICAL THERAPY FOR COLORECTAL CANCER. Surgical Clinics of North America 77:1, 211-228
CrossRef220
Kenneth H. Cohn, Deborah L. Ornstein, Fusheng Wang, Fidelina DeSoto LaPaix, Kathy Phipps, Cheryl Edelsberg, Rosemary Zuna, Leila A. Mott, John L. Dunn. (1997) The significance of allelic deletions and aneuploidy in colorectal carcinoma. Cancer 79:2, 233-244
CrossRef221
Terry C. Lairmore, Jeffrey A. Norton. (1997) Advances in molecular genetics. The American Journal of Surgery 173:1, 37-41
CrossRef222
Thomas E. Carey, Christopher J. Frank, Jeffrey R. Raval, Jessica W. Jones, Kenneth D. McClatchey, Theodore F. Beals, Maria J. Worsham, Dxaniel L. van Dyke. (1997) Identifying Genetic Changes Associated with Tumor Progression in Squamous Cell Carcinoma. Acta Oto-laryngologica 117:s529, 229-232
CrossRef223
David J. Vaughn, Daniel G. Haller. (1997) Adjuvant Therapy for Colorectal Cancer: Past Accomplishments, Future Directions. Cancer Investigation 15:5, 435-447
CrossRef224
R.H. Wilson, M.C.R. Whiteside, S.E.H. Russell. (1997) Molecular genetics of colorectal cancer (part 2). Clinical Oncology 9:2, 79-82
CrossRef225
Shibata, David, Reale, Michael A., Lavin, Philip, Silverman, Mark, Fearon, Eric R., Steele, Glenn Jr., Jessup, John M., Loda, Massimo, Summerhayes, Ian C., . (1996) The DCC Protein and Prognosis in Colorectal Cancer. New England Journal of Medicine 335:23, 1727-1732
Full Text226
John M. Carethers. (1996) THE CELLULAR AND MOLECULAR PATHOGENESIS OF COLORECTAL CANCER. Gastroenterology Clinics of North America 25:4, 737-754
CrossRef227
Robert S. Bresalier. (1996) THE BIOLOGY OF COLORECTAL CANCER METASTASIS. Gastroenterology Clinics of North America 25:4, 805-820
CrossRef228
Jia-Lin Yang, Kim T. Ow, Pamela J. Russell, John M. Ham, Philip J. Crowe. (1996) Higher expression of oncoproteins c-myc, c-erbB-2/neu, PCNA, and p53 in metastasizing colorectal cancer than in nonmetastasizing tumors. Annals of Surgical Oncology 3:6, 574-579
CrossRef229
Kazuyuki Wakita, Norio Kohno, Yoko Sakoda, Yoshio Ishikawa, Morito Sakaue. (1996) Decreased expression of the DCC gene in human breast carcinoma. Surgery Today 26:11, 900-903
CrossRef230
Steven H. Itzkowitz, Bruce Greenwald, Stephen J. Meltzer. (1996) Colon carcinogenesis in inflammatory bowel disease. Inflammatory Bowel Diseases 1:2, 142-158
CrossRef231
Eric R. Fearon. (1996) DCC: Is there a connection between tumorigenesis and cell guidance molecules?. Biochimica et Biophysica Acta (BBA) - Reviews on Cancer 1288:2, M17-M23
CrossRef232
Annika Lindblom, Stig Linder. (1996) The metastatic phenotype—prognostic implications. Critical Reviews in Oncology/Hematology 24:2, 71-96
CrossRef233
Kelly A. Przylepa, William Paznekas, Minghuang Zhang, Mahin Golabi, Wilma Bias, Michael J. Bamshad, John C. Carey, Bryan D. Hall, Roger Stevenson, Seth J. Orlow, M. Michael Cohen Jr., Ethylin Wang Jabs. (1996) Fibroblast growth factor receptor 2 mutations in Beare–Stevenson cutis gyrata syndrome. Nature Genetics 13:4, 492-494
CrossRef234
Guo-Wen Sun, Thomas L. Shook, Gregory L. Kay. (1996) Inappropriate use of bivariable analysis to screen risk factors for use in multivariable analysis. Journal of Clinical Epidemiology 49:8, 907-916
CrossRef235
Sam Thiagalingam, Christoph Lengauer, Frederick S. Leach, Mieke Schutte, Stephan A. Hahn, Joan Overhauser, James K.V. Willson, Sanford Markowitz, Stanley R. Hamilton, Scott E. Kern, Kenneth W. Kinzler, Bert Vogelstein. (1996) Evaluation of candidate tumour suppressor genes on chromosome 18 in colorectal cancers. Nature Genetics 13:3, 343-346
CrossRef236
Masataka Kato, Yasushi Ito, Susumu Kobayashi, Kaichi Isono. (1996) Detection of DCC and Ki-ras gene alterations in colorectal carcinoma tissue as prognostic markers for liver metastatic recurrence. Cancer 77:8, 1729-1735
CrossRef237
Frederick Richards, Charles P. Richards. (1996) Colorectal cancer: Etiologic and clinical aspects. Seminars in Roentgenology 31:2, 103-110
CrossRef238
Bernard Nordlinger, Marguerite Guiguet, Jean-Christophe Vaillant, Pierre Balladur, Karim Boudjema, Philippe Bachellier, Daniel Jaeck, Association Française de Chirurgie. (1996) Surgical resection of colorectal carcinoma metastases to the liver: A prognostic scoring system to improve case selection, based on 1568 patients. Cancer 77:7, 1254-1262
CrossRef239
M. Schenk, C. Leib-Mösch, I. U. Schenck, M. Jaenicke, S. Indraccolo, H. -D. Saeger, G. Dallenbach-Hellweg, R. Hehlmann. (1996) Lower frequency of allele loss on chromosome 18q in human breast cancer than in colorectal tumors. Journal of Molecular Medicine 74:3, 155-159
CrossRef240
Kokichi Sugano, Yuki Nakashima, Kensei Yamaguchi, Noriko Fukayama, Masato Maekawa, Hisanao Ohkura, Tadao Kakizoe, Takao Sekiya. (1996) Sensitive detection of loss of heterozygosity in theTP53 gene in pancreatic adenocarcinoma by fluorescence-based single-strand conformation polymorphism analysis using blunt-end DNA fragments. Genes, Chromosomes and Cancer 15:3, 157-164
CrossRef241
Bo Liu, Ramon Parsons, Nickolas Papadopoulos, Nicholas C. Nicolaides, Henry T. Lynch, Patrice Watson, Jeremy R. Jass, Malcolm Dunlop, Andrew Wyllie, Païvi Peltomäki, Albert De La Chapeele, Stanley R. Hamilton, Bert Vocelstein, Kenneth W. Kinzler. (1996) Analysis of mismatch repair genes in hereditary non–polyposis colorectal cancer patients. Nature Medicine 2:2, 169-174
CrossRef242
D.Mark Pritchard, Alastair J.M. Watson. (1996) Apoptosis and gastrointestinal pharmacology. Pharmacology & Therapeutics 72:2, 149-169
CrossRef243
Hartley S. Stem. (1996) Contributions of molecular genetics to the clinical management of colorectal cancer. The American Journal of Surgery 171:1, 10-15
CrossRef244
Eric R. Fearon. (1996) Colorectal cancer: Molecular genetic studies and their future clinical applications. Medical and Pediatric Oncology 27:S1, 35-40
CrossRef245
Victor E. Pricolo, Sydney D. Finkelstein, Tsung-Teh Wu, Gerald Keller, Anke Bakker, Patricia A. Swalsky, Kirby I. Bland. (1996) Prognostic value of TP53 and K-ras-2 mutational analysis in stage III carcinoma of the colon. The American Journal of Surgery 171:1, 41-46
CrossRef246
XIAO-FENG SUN, JOHN M. CARSTENSEN, OLLE STÅL, HONG ZHANG, BERNT BOERYD, BO NORDENSKJÖLD. (1996) Interrelations of clinicopathologic variables and their prognostic value in colorectal adenocarcinoma. APMIS 104:1-6, 35-38
CrossRef247
Jose A. Bufill. (1995) Colorectal cancer genetics. Closing the gap between genotype and phenotype. Cancer 76:12, 2389-2392
CrossRef248
J. M. Jessup, P. T. Lavin, C. W. Andrews, M. Loda, A. Mercurio, B. D. Minsky, C. Mies, B. Cukor, R. Bleday, G. Steele. (1995) Sucrase-isomaltase is an independent prognostic marker for colorectal carcinoma. Diseases of the Colon & Rectum 38:12, 1257-1264
CrossRef249
Kenneth P. Mathews, Konstantin N. Konstantinov, Ichiro Kuwabara, Paul N. Hill, Daniel K. Hsu, Bruce L. Zuraw, Fu-Tong Liu. (1995) Evidence for IgG autoantibodies to galectin-3, a ?-galactoside-binding lectin (Mac-2, ? binding protein, or carbohydrate binding protein 35) in human serum. Journal of Clinical Immunology 15:6, 329-337
CrossRef250
John I. Allen. (1995) Molecular biology of colon polyps and colon cancer. Seminars in Surgical Oncology 11:6, 399-405
CrossRef251
J. W. R. Mulder, P. M. Kruyt, M. Sewnath, C. A. Seldenrijk, W. F. Weidema, S. T. Pals, G. J. A. Offerhaus. (1995) Difference in expression of CD44 splice variants between proximal and distal adenocarcinoma of the large bowel. British Journal of Surgery 82:11, 1468-1470
CrossRef252
Christopher J.N. Rall, Jaime A. Rivera, Barbara A. Centeno, Carlos Fernandez-del Castillo, David W. Rattner, Andrew L. Warshaw, Anil K. Rustgi. (1995) Peritoneal exfoliative cytology and Ki-ras mutational analysis in patients with pancreatic adenocarcinoma. Cancer Letters 97:2, 203-211
CrossRef253
ERIC R. FEARON. (1995) Molecular Genetics of Colorectal Cancer. Annals of the New York Academy of Sciences 768:1, 101-110
CrossRef254
C. Richard Boland, Juichi Sato, Henry D. Appelman, Robert S. Bresalier, Andrew P. Feinberg. (1995) Microallelotyping defines the sequence and tempo of alleiic losses at tumour suppressor gene loci during colorectal cancer progression. Nature Medicine 1:9, 902-909
CrossRef255
Frank A. Sinicrope, Steven M. Sugarman. (1995) Role of adjuvant therapy in surgically resected colorectal carcinoma. Gastroenterology 109:3, 984-993
CrossRef256
H. J. Nielsen. (1995) Detrimental effects of perioperative blood transfusion. British Journal of Surgery 82:5, 582-587
CrossRef257
Bo Liu, Susan M. Farrington, Gloria M. Petersen, Stanley R. Hamilton, Ramon Parsons, Nickolas Papadopoulos, Takato Fujiwara, Jin Jen, Kenneth W. Ainzler, Andrew H. Wyllie, Bert Vogelstein, Malcolm G. Dunlop. (1995) Genetic instability occurs in the majority of young patients with colorectal cancer. Nature Medicine 1:4, 348-352
CrossRef258
Hamilton, Stanley R., Liu, Bo, Parsons, Ramon E., Papadopoulos, Nickolas, Jen, Jin, Powell, Steven M., Krush, Anne J., Berk, Theresa, Cohen, Zane, Tetu, Bernard, Burger, Peter C., Wood, Patricia A., Taqi, Fowzia, Booker, Susan V., Petersen, Gloria M., Offerhaus, G. Johan A., Tersmette, Anne C., Giardiello, Francis M., Vogelstein, Bert, Kinzler, Kenneth W., . (1995) The Molecular Basis of Turcot's Syndrome. New England Journal of Medicine 332:13, 839-847
Full Text259
Toribara, Neil W., Sleisenger, Marvin H., . (1995) Screening for Colorectal Cancer. New England Journal of Medicine 332:13, 861-867
Full Text260
Kathleen R. Cho, Eric R. Fearon. (1995) DCC: linking tumor suppressor genes and altered cell surface interactions in cancer?. Current Opinion in Genetics & Development 5:1, 72-78
CrossRef261
Mark S. Redston, Nickolas Papadopoulos, Carlos Caldas, Kenneth W. Kinzler, Scott E. Kern. (1995) Common occurrence of APC and K-ras gene mutations in the spectrum of colitis-associated neoplasias. Gastroenterology 108:2, 383-392
CrossRef262
Randall W. Burt, M.D, James A. DiSario, M.D, Lisa Cannon-Albright, Ph.D. (1995) GENETICS OF COLON CANCER: Impact of Inheritance on Colon Cancer Risk 1. Annual Review of Medicine 46:1, 371-379
CrossRef263
Bo Liu, Nicholas C. Nicolaides, Sanford Markowitz, James K.V. Willson, Ramon E. Parsons, Jin Jen, Nickolas Papadopolous, Päivi Peltomäki, Albert de la Chapelle, Stanley R. Hamilton, Kenneth W. Kinzler, Bert Vogelstein. (1995) Mismatch repair gene defects in sporadic colorectal cancers with microsatellite instability. Nature Genetics 9:1, 48-55
CrossRef264
(1994) Alleles Lost and Gained in Malignant Cells. New England Journal of Medicine 331:23, 1591-1592
Full Text265
Tempero, Margaret, Anderson, James, . (1994) Progress in Colon Cancer -- Do Molecular Markers Matter?. New England Journal of Medicine 331:4, 267-268
Full Text
- Letters
