Original Article
Linkage of the Angiotensinogen Gene to Essential Hypertension
N Engl J Med 1994; 330:1629-1633June 9, 1994
- Abstract
Background
The renin-angiotensin system is a powerful pressor system with a major influence on salt and water homeostasis. Angiotensinogen (also called renin substrate) is a key component of this system; it is cleaved by renin to yield angiotensin I, which is then cleaved by angiotensin-converting enzyme to yield angiotensin II. The observation that plasma angiotensinogen levels correlate with blood pressure and track through families suggests that angiotensinogen may have a role in essential hypertension. We therefore investigated whether there is linkage between the angiotensinogen gene on chromosome 1q42-43 and essential hypertension.
Methods
Samples of DNA from 63 white European families in which two or more members had essential hypertension were tested for linkage of the angiotensinogen gene to this disorder. Affected cousins, nephews, nieces, and half-siblings were included when possible. To test for linkage, we used as a marker a dinucleotide-repeat sequence flanking this gene, and we employed the affected-pedigree-member method of linkage analysis. Two molecular variants of the angiotensinogen gene, one encoding threonine instead of methionine at position 235 (M235T) and the other encoding methionine rather than threonine at position 174 (T174M), were also tested for possible association with essential hypertension.
Results
We found significant linkage (t = 5.00, P<0.001) and association (chi-square = 53.3, P<0.001) of the angiotensinogen-gene locus to essential hypertension in the 63 multiplex families. This linkage was consistently maintained in the subgroup of subjects with diastolic pressure above 100 mm Hg and in the subgroups classified according to sex. It has been proposed previously that T174M and M235T are associated with essential hypertension. However, we found no association in our population between either polymorphism and this disorder.
Conclusions
This study provides strong and consistent support for the linkage to essential hypertension of regions within or close to the angiotensinogen gene. Precisely how mutations in this region may result in hypertension remains to be determined.
Media in This Article
Figure 1
Genotype Determination of M235T and T174M on Ethidium-Stained Gels.Figure 2
Distribution of the Observed and Expected Frequencies of Shared Alleles, as Indicated by the t-Statistic, in 63 Multiplex Families with Essential Hypertension.Article Activity
- Article
Essential hypertension represents the upper quintile of the blood-pressure distribution in the general population and is a major risk factor for morbidity and mortality from cardiovascular causes1. The causes of essential hypertension, which accounts for 90 percent of high blood pressure, have not yet been determined. Studies of families and twins imply that 20 to 40 percent of essential hypertension may have a genetic basis2. Epidemiologic studies indicate a continuous distribution of blood pressure in the population, and the genetic basis of this disorder appears to be polygenic and therefore does not follow simple mendelian patterns of inheritance3. It is likely that several genes interact with environmental stimuli to produce high blood pressure in susceptible persons4.
The renin-angiotensin system influences vascular tone, cardiovascular remodeling, and salt and water homeostasis, and this system is closely involved in the physiologic regulation of blood pressure5. For these reasons, genes encoding components of this system are attractive candidates for the investigation of the genetic basis of essential hypertension. The angiotensinogen gene has recently been linked to essential hypertension in affected sibships6. In study populations from France and Utah, 15 DNA polymorphisms of differing frequency were identified in this gene. Two of them within exon 2 -- one with threonine instead of methionine at position 235 (M235T) and one with methionine rather than threonine at position 174 (T174M) -- were found to be significantly associated with hypertension6.
In the investigation of the genetic basis of polygenic disorders, it is critical to be able to substantiate the linkage of candidate genes or markers in pairs of affected relatives in different populations7. We sought to determine whether there was linkage of the angiotensinogen gene to essential hypertension in affected white European families from the United Kingdom. We also set out to develop a simple, reproducible method for analyzing the angiotensinogen-gene variants M235T and T174M and testing whether they are associated with hypertension in this population.
Methods
Multiplex Families with Hypertension and Controls
After ethical approval was given in 1990, 63 families containing two or more members with essential hypertension were identified at the hypertension clinic of St. Bartholomew's Hospital and three primary care clinics in southeast England. All the subjects were white Europeans, had begun to have hypertension before the age of 60 years, and had had diastolic pressures above 95 mm Hg on three occasions or were being treated for essential hypertension. After the identification of the proband, a family history was taken, and only affected relatives as defined by the above criteria were studied. To maximize genetic informativeness, affected cousins, nieces, nephews, and half-siblings were included whenever possible. Hence, these affected relatives form “multiplex” families rather than simply affected sibling pairs. Families in which any member had secondary hypertension as defined by clinical evidence of intrinsic renal disease or renovascular hypertension were excluded. A population-based control group of 64 white Europeans was identified at primary care clinics to provide control allele frequencies. Genomic DNA was isolated by phenol-chloroform extraction from whole blood drawn into tubes containing potassium EDTA8.
Analysis of the Angiotensinogen Dinucleotide GT-Repeat Sequence
The angiotensinogen 3' dinucleotide repeat9 was analyzed by amplification using the polymerase chain reaction (PCR) with primer pairs 5'AATGGGAAGTTAGGTCAGG3' and 5'TAGGCACTTGCAACTCCAGG3'. PCR was performed on approximately 250 ng of genomic DNA, with 50 nmol of one unlabeled primer and approximately 5 nmol of the opposite-strand primer that had previously been labeled with [32P]ATP with T4 polynucleotide kinase (New England Biolabs, Bishops Stortford, United Kingdom)8. The reactions were carried out in a total volume of 25 microliters containing 50 mM potassium chloride, 2.5 mM magnesium chloride, 10 mM TRIS-hydrochloric acid (pH 9.0), 0.1 percent Triton X-100, 100 μmol of each deoxynucleotide triphosphate, and 0.5 U of Taq polymerase. This involved an initial denaturation at 94 °C, followed by 25 cycles of one minute at 94 °C, one minute at 61 °C, and one minute at 72 °C. Radioactive fragments were analyzed by electrophoresis through 5 percent denaturing polyacrylamide gels containing 8 M urea, 89 mM TRIS base, 89 mM boric acid, and 2 mM EDTA. The gels were run for approximately 4 hours at a constant voltage of 1350 V, dried, and exposed for 12 hours to Kodak XAR-2 film for autoradiography8.
M235T and T174M Genotypes of Angiotensinogen
The M235T and T174M polymorphisms were investigated by PCR amplification of genomic DNA followed by restriction-endonuclease digestion. Genomic DNA (250 ng) was amplified with 50 nmol of each unlabeled primer (5'GATGCGCACAAGGTCCTG3' and 5'CAGGGTGCTGTCCACACTGGCTCGC3') in a total volume of 50 microliters containing 50 mM potassium chloride, 2.5 mM magnesium chloride, 10 mM TRIS-hydrochloric acid (pH 9.0), 0.1 percent Triton X-100, 100 μmol of each deoxynucleotide triphosphate, and 0.5 U of Taq polymerase. There was an initial denaturation at 94 °C, followed by 25 cycles of one minute at 94 °C, one minute at 61 °C, and one minute at 72 °C. The most 3' guanosine residue in the longer oligonucleotide is mismatched with genomic DNA, which (depending on the sequence) creates an SfaNI restriction site during amplification. If the codon 235 is ATG (M235), digestion with SfaNI yields a 266-bp product relative to the undigested 303-bp product (T235). After restriction-endonuclease digestion, fragments were analyzed by electrophoresis through 5 percent polyacrylamide gels (Figure 1Figure 1
Genotype Determination of M235T and T174M on Ethidium-Stained Gels.). The T174M genotype was determined by digestion of the same 303-bp amplified product with an existing NcoI cutting site. After digestion at 37 °C with NcoI (New England Biolabs), the genotypes of the samples were determined by size fractionation on ethidium-stained 1 percent agarose TRIS borate EDTA gels (Figure 1). All persons were studied for the M235T and T174M genotypes in a blinded fashion.Single-Strand Sequencing of Exon 2
Genomic DNA was amplified with 50 ng of each primer pair (biotinylated 5'TAAAGGTCAGTTAATAACCACC3' and 5' CCATCTCCAAGGCCTGACTGGC3') in PCR mixture as described above, with cycles of 94 °C for three minutes followed by 25 cycles of 94 °C for one minute, 63 °C for one minute, and 72 °C for one minute. The biotinylated product was purified on M-280 streptavidin paramagnetic beads (Dynabeads, Dynal, Norway), and single-stranded templates were prepared by denaturation with 100 mM sodium hydroxide. Once neutralized, the antisense template was subjected to T7 sequencing with a Pharmacia kit (Uppsala, Sweden) and the primer 5'GATGCGCACAAGTCCTG3'. The sequences of a substantial proportion of the undigested products (i.e., T235 and products from heterozygotes) were analyzed on 5 percent denaturing polyacrylamide gels as described, followed by autoradiography. The genotypes previously assigned by restriction analysis were confirmed with 100 percent specificity.
Statistical Analysis
The affected-pedigree-member method of linkage analysis is an established statistical test for the investigation of the genetic basis of complex traits, such as essential hypertension10-13. This method was used to compute a t-statistic that tested whether affected relatives shared alleles at the angiotensinogen locus more often than would be expected by chance10,11. This t-statistic based on allele sharing does not involve parental genotypes and is weighted to permit the excessive sharing of rare alleles to outweigh the sharing of common alleles (the intermediate weighting function 1/[p was used, where p denotes the frequency of shared marker alleles)10,11.
Such analyses make no explicit assumptions about mode of inheritance, genotype penetrance, or the presence of phenocopies and are particularly useful for disorders of late onset in which parental genotypes may be unavailable10,11,14. This robustness is partly offset by the fact that the t-statistics derived by the affected-pedigree-member method are influenced by the numbers analyzed and should not be considered a direct measure of the strength of linkage. We present as an indicator of the strength of linkage the percentage of excess alleles shared in each data set.
The programs Apmmult (version 2.0) and Simmult were used to apply the algorithms devised by Weeks and Lange for use with the affected-pedigree-member method of linkage analysis10,11. The t-statistic for large data sets (i.e., those with more than 20 families) has an approximately normal distribution and is interpreted in a one-tailed test. Significant results from the Apmmult program were checked by computer simulation with the accompanying Simmult program. Both theoretical and empirical P values are reported.
The genotypes and allele frequencies for the GT repeat, M235T, and T174M were tested by the chi-square test for their association with hypertension in 63 index patients with hypertension and population-based controls. Entire families were not tested in this case-control comparison, because relatives may share alleles by virtue of their family relationship.
Results
Genetic Linkage of the Angiotensinogen Gene to Essential Hypertension
In the test for linkage, we used a dinucleotide GT-repeat sequence in the 3' flanking region of the angiotensinogen gene with a heterozygosity of 77 percent9. Sixty-three multiplex white European families, including 149 affected relatives with essential hypertension identified at a hospital hypertension clinic and three primary care clinics, were genotyped in a blinded fashion with this GT repeat. These sibships were selected under strict criteria, as described in the Methods section, and their demographic characteristics are summarized in Table 1Table 1
Demographic Characteristics of 149 Persons with Essential Hypertension Who Belonged to 63 Multiplex Families.. Control allele frequencies were determined in a random population of 64 unrelated white Europeans and found to be similar to published frequencies in the large reference pedigrees of the Centre d'Etude du Polymorphisme Humain9. The data were tested for linkage by the affected-pedigree-member method, which uses identity-by-state scoring to take account of allele sharing10,11.Linkage was detected among the 63 multiplex families (t = 5.00, P<0.001) (Table 2Table 2
Linkage between the Angiotensinogen Dinucleotide Repeat and the Presence of Essential Hypertension in Affected Sibships.) after comparison with the marker-allele frequencies in the 64 control subjects. In 40 of the 63 families, there was a 25.9 percent excess of shared alleles. The affected-pedigree-member method is known to be sensitive to marker-allele frequencies; for example, recalculation with the published marker frequencies yielded a t-statistic of 7.709.The difference between the observed and the expected frequency distributions of the family-by-family t-statistics in the 63 families can be seen in a histogram (Figure 2Figure 2
Distribution of the Observed and Expected Frequencies of Shared Alleles, as Indicated by the t-Statistic, in 63 Multiplex Families with Essential Hypertension.). The expected distribution was computed under the null hypothesis that affected family members share a proportion of marker alleles that is consistent with the independent segregation of the marker and the disease. There is a clear shift to the right for the observed distribution, supporting the hypothesis of linkage of the angiotensinogen GT-repeat sequence to hypertension.Multiple different alleles were shared in excess at this locus, making it unlikely that stratification of the population produced an artificial increase in allele sharing. This is demonstrated by inspecting the genotypes and allele frequencies of the index patients with hypertension and the control subjects (Table 3Table 3
Angiotensinogen GT-Repeat Genotypes in 63 Hypertensive Patients and 64 Controls.). This comparison of genotypes was tested for association with hypertension by the chi-square test, and a significant association was found (chi-square = 53.3, 10 df, P<0.001) (Table 3).In view of the quantitative nature of blood pressure and the previous finding of a stronger linkage with diastolic blood pressure greater than 100 mm Hg, we stratified the families according to the severity of hypertension6. Thirty-one families had pairs of affected relatives with diastolic pressures greater than 100 mm Hg, and there was evidence of linkage in this subgroup (t = 3.65, P<0.001); they shared alleles at a frequency 25.1 percent higher than expected (Table 2). Although 71 percent of the cohort was receiving antihypertensive-drug treatment at the time of recruitment, we were able to determine pretreatment blood pressures for 69 percent of the families from primary care records and from the data base at our hypertension clinic. On the basis of these records, at least 63 percent of the cohort had diastolic blood pressures higher than 100 mm Hg.
Linkage was also tested according to sex. Despite the small number of male-male pairs (18), linkage remained significant (t = 2.09, P<0.018), with a frequency of shared alleles 17.0 percent higher than expected. The 28 female-female pairs also showed linkage between hypertension and the angiotensinogen gene (t = 3.73, P<0.001), and allele sharing was 29.1 percent higher than expected, in contrast with previous findings6 (Table 2).
Angiotensinogen-Gene Variants M235T and T174M
Using restriction enzymes, we determined the frequency of the M235T and T174M genotypes in index patients from the 63 families and in 80 control subjects (Figure 1). Only index patients with hypertension were studied, and the genotype of each variant was determined in those patients and compared with those of control subjects identified by population screening. Both populations were in Hardy-Weinberg equilibrium. The allele frequencies for the two variants were very similar in the hypertensive patients and the controls, and neither M235T nor T174M was significantly associated with hypertension (Table 4Table 4
Tests of Association between Angiotensinogen Variants and Hypertension.). Both M235T and T174M were tested for linkage by the affected-pedigree-member method in the 63 families, and there was no evidence that either polymorphism was linked to hypertension (t-statistic for M235T, -0.411, P = 0.68; t-statistic for T174M, -0.86313, P = 0.65).Discussion
The linkage of the angiotensinogen-gene locus to essential hypertension provides valuable confirmation that a susceptibility locus on human chromosome lq42-43 may contribute to the development of hypertension. This has now been shown in two studies, including three affected sibships of white European ancestry6. There is complementary support for these data in physiologic observations that elevated blood pressure tracks with high plasma levels of angiotensinogen in families15. In addition, hypertension develops in transgenic animal models in association with overexpression of the angiotensinogen gene16. Interestingly, the same GT-repeat sequence analyzed here has been linked to proteinuric preeclampsia in Scottish and Icelandic families17.
The problems of determining the genetic basis of polygenic disease are highlighted in the cases of schizophrenia and atopy, in which linkage of putative markers has not thus far been replicated in other populations18,19. These conflicting findings may reflect differences in ascertainment of families, variable penetrance of causative genes, or alternative definitions of the disease phenotype.
The striking feature of our study is the consistency of the linkage detected by the affected-pedigree-member method, in that linkage was detected in both sexes and in a group of more severely affected families. In the previous study of this gene locus, sibships were stratified according to the severity of diastolic hypertension (>100 mm Hg) or the receipt of two or more antihypertensive agents. Although these criteria are arbitrary thresholds for severity, there is evidence to suggest that such stratification may be important6. In the present study, linkage was not more significant for the 31 families with diastolic pressures greater than 100 mm Hg than for the overall cohort. This may be explained by the high median (±SD) diastolic blood pressure of 102 ±7 mm Hg in the 63 families. This finding suggests that even though the subjects in 71 percent of families were receiving drug treatment, the cohort still contained persons with markedly elevated diastolic pressure. These observations, in tandem with previous data, imply that in the genetic study of this quantitative trait it may be critical to define more severely affected persons in order to link a marker to hypertension6.
The percentage of excess alleles shared offers an indication of the strength of the linkage in this population, which shows an excess percentage that is consistent among all 63 families and among the 31 families with more severely affected pairs of relatives. The positive association of the angiotensinogen GT-repeat sequence with hypertension and the excess sharing of several alleles imply that this locus has a high probability of harboring a susceptibility gene for essential hypertension. There may be several different mutations within or close to the angiotensinogen gene that contribute to the development of essential hypertension. Since different alleles of the angiotensinogen repeat sequence were significantly over- and underrepresented in the patients, both susceptibility and protective angiotensinogen-gene variants may exist. However, this study does not provide direct evidence in support of this concept. These observations raise the possibility that analysis of other populations may reveal important differences in the gene variants.
It has previously been suggested that the angiotensinogen-gene variant M235T, or perhaps less likely T174M, may be the factor that contributes to the hypertension phenotype6. The M235T polymorphism has also recently been associated with preeclampsia20. These polymorphisms are at some distance from the angiotensin-cleavage sites in the angiotensinogen molecule21. Accordingly, it is unclear how these variants might functionally influence the activity of the renin-angiotensin system. We did not find significant associations of either variant with hypertension as compared with two population-based control groups. The absence of linkage of M235T and T174M with hypertension reflects the lack of informativeness of these polymorphisms and is not surprising. Furthermore, direct sequencing of the region of exon 2 that contains these variants was used to confirm the genotypes ascribed by restriction analysis to several members of the cohort. Therefore, we cannot conclude that either of these polymorphisms is acting as a marker or playing a directly causative part in relation to hypertension in our population.
The renin-angiotensin system includes other candidate genes that could be implicated in the genetic basis of essential hypertension. In contrast to the promising data from animal models of hypertension, the renin gene and the angiotensin-converting-enzyme gene have both been the focus of negative linkage studies in affected white sibships22-25. Angiotensinogen is a crucial rate determinant of this pressor system, and regions within or near the angiotensinogen gene on chromosome 1q42-43 have now been linked to essential hypertension in two separate investigations6. Our findings suggest that a further search for mutations in the angiotensinogen gene that might result in hypertension is needed in this population.
Supported by the Joint Research Board of St. Bartholomew's Hospital, the Medical Research Council of Great Britain, the Fellowship of Postgraduate Medicine, and the Mason Medical Research Foundation.
We are indebted to the families and doctors from Bersted Green Surgery in Bognor Regis, St. John's Hill Surgery in Sevenoaks, Queensbridge Road Surgery in Hackney, and the hypertension clinic at St. Bartholomew's Hospital.
Source Information
From the Departments of Clinical Pharmacology (M.C., P.M., M.L., P.T.) and Chemical Endocrinology (P.L., A.J.L.C.), St. Bartholomew's Hospital; and the Medical Research Council Molecular Medicine Group, Royal Postgraduate Medical School (M.F.) -- both in London.
Address reprint requests to Dr. Caulfield at the Department of Clinical Pharmacology, St. Bartholomew's Hospital, London EC1A 7BE, United Kingdom.
- References
References
1
MacMahon S ,Peto R ,Cutler J , et al. Blood pressure, stroke and coronary heart disease: part 1, prolonged differences in blood pressure: prospective observational studies corrected for the regression dilution bias. Lancet 1990;335:765-774
CrossRef | Web of Science | Medline2
Ward R. Familial aggregation and genetic epidemiology of blood pressure. In: Laragh JH, Brenner BM, eds. Hypertension: pathophysiology, diagnosis, and management. Vol. 1. New York: Raven Press, 1990:81-100.
3
Pickering G . Hyperpiesis: high blood-pressure without evident cause: essential hypertension. BMJ 1965;2:1021-1026
CrossRef | Web of Science | Medline4
Williams RR ,Hunt SC ,Hasstedt SJ , et al. Current knowledge regarding the genetics of human hypertension. J Hypertens Suppl 1989;7:S8-S13
Medline5
MacGregor GA ,Markandu ND ,Roulston JE ,Jones JC ,Morton JJ . Maintenance of blood pressure by the renin-angiotensin system in normal man. Nature 1981;291:329-331
CrossRef | Web of Science | Medline6
Jeunemaitre X ,Soubrier F ,Kotelevtsev YV , et al. Molecular basis of human hypertension: role of angiotensinogen. Cell 1992;71:169-180
CrossRef | Web of Science | Medline7
Kurtz TW ,Spence MA . Genetics of essential hypertension. Am J Med 1993;94:77-84
CrossRef | Web of Science | Medline8
Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory, 1989.
9
Kotelevtsev YV ,Clauser E ,Corvol P ,Soubrier F . Dinucleotide repeat polymorphism in the human angiotensinogen gene. Nucleic Acids Res 1991;19:6978-6978
CrossRef | Web of Science | Medline10
Weeks DE ,Lange K . The affected-pedigree-member method of linkage analysis. Am J Hum Genet 1988;42:315-326
Web of Science | Medline11
Weeks DE ,Lange K . A multilocus extension of the affected-pedigree-member method of linkage analysis. Am J Hum Genet 1992;50:859-868
Web of Science | Medline12
Pericak-Vance MA ,Bebout JL ,Gaskell PC Jr , et al. Linkage studies in familial Alzheimer disease: evidence for chromosome 19 linkage. Am J Hum Genet 1991;48:1034-1050
Web of Science | Medline13
Hall JM ,Lee MK ,Newman B , et al. Linkage of early-onset familial breast cancer to chromosome 17q21. Science 1990;250:1684-1689
CrossRef | Web of Science | Medline14
Bishop DT ,Williamson JA . The power of identity-by-state methods for linkage analysis. Am J Hum Genet 1990;46:254-265
Web of Science | Medline15
Watt GCM ,Harrap SB ,Foy CJW , et al. Abnormalities of glucocorticoid metabolism and the renin-angiotensin system: a four-corners approach to the identification of genetic determinants of blood pressure. J Hypertens 1992;10:473-482
CrossRef | Web of Science | Medline16
Kimura S ,Mullins JJ ,Bunnemann B , et al. High blood pressure in transgenic mice carrying the rat angiotensinogen gene. EMBO J 1992;11:821-827
Web of Science | Medline17
Arngrimsson R ,Purandare S ,Connor M , et al. Angiotensinogen: a candidate gene involved in preeclampsia? Nat Genet 1993;4:114-115
CrossRef | Web of Science | Medline18
Split verdict on schizophreniaNat Genet 1992;1:231-232
CrossRef | Web of Science | Medline19
Marsh DG ,Meyers DA . A major gene for allergy -- fact or fancy? Nat Genet 1992;2:252-254
CrossRef | Web of Science | Medline20
Ward K ,Hata A ,Jeunemaitre X , et al. A molecular variant of angiotensinogen associated with preeclampsia. Nat Genet 1993;4:59-61
CrossRef | Web of Science | Medline21
Gaillard I ,Clauser E ,Corvol P . Structure of human angiotensinogen gene. DNA 1989;8:87-99
CrossRef | Medline22
Hilbert P ,Lindpaintner K ,Beckmann JS , et al. Chromosomal mapping of two genetic loci associated with blood-pressure regulation in hereditary hypertensive rats. Nature 1991;353:521-529
CrossRef | Web of Science | Medline23
Kurtz TW ,Simonet L ,Kabra PM , et al. Cosegregation of the renin allele of the spontaneously hypertensive rat with an increase in blood pressure. J Clin Invest 1990;85:1328-1332
CrossRef | Web of Science | Medline24
Jeunemaitre X ,Lifton RP ,Hunt SC ,Williams RR ,Lalouel JM . Absence of linkage between the angiotensin converting enzyme locus and human essential hypertension. Nat Genet 1992;1:72-75
CrossRef | Web of Science | Medline25
Jeunemaitre X ,Rigat B ,Charru A ,Houot A-M ,Soubrier F ,Corvol P . Sib pair linkage analysis of renin gene haplotypes in human essential hypertension. Hum Genet 1992;88:301-306
CrossRef | Web of Science | Medline
- Citing Articles (172)
Citing Articles
1
Vamsi U. Mohana, N. Swapna, Reddy S. Surender, S. Vishnupriya, Tirunilai Padma. (2011) Gender-Related Association of AGT Gene Variants (M235T and T174M) with Essential Hypertension—A Case-Control Study. Clinical and Experimental Hypertension1-7
CrossRef2
Prasanta K. Borah, Priyanka Shankarishan, Jagadish Mahanta. (2011) Glutathione S-Transferase M1 and T1 Gene Polymorphisms and Risk of Hypertension in Tea Garden Workers of North–East India. Genetic Testing and Molecular Biomarkers 15:11, 771-776
CrossRef3
Toby Johnson, Tom R. Gaunt, Stephen J. Newhouse, Sandosh Padmanabhan, Maciej Tomaszewski, Meena Kumari, Richard W. Morris, Ioanna Tzoulaki, Eoin T. O'Brien, Neil R. Poulter, Peter Sever, Denis C. Shields, Simon Thom, Sasiwarang G. Wannamethee, Peter H. Whincup, Morris J. Brown, John M. Connell, Richard J. Dobson, Philip J. Howard, Charles A. Mein, Abiodun Onipinla, Sue Shaw-Hawkins, Yun Zhang, George Davey Smith, Ian N.M. Day, Debbie A. Lawlor, Alison H. Goodall, F. Gerald Fowkes, Gonçalo R. Abecasis, Paul Elliott, Vesela Gateva, Peter S. Braund, Paul R. Burton, Christopher P. Nelson, Martin D. Tobin, Pim van der Harst, Nicola Glorioso, Hani Neuvrith, Erika Salvi, Jan A. Staessen, Andrea Stucchi, Nabila Devos, Xavier Jeunemaitre, Pierre-François Plouin, Jean Tichet, Peeter Juhanson, Elin Org, Margus Putku, Siim Sõber, Gudrun Veldre, Margus Viigimaa, Anna Levinsson, Annika Rosengren, Dag S. Thelle, Claire E. Hastie, Thomas Hedner, Wai K. Lee, Olle Melander, Björn Wahlstrand, Rebecca Hardy, Andrew Wong, Jackie A. Cooper, Jutta Palmen, Li Chen, Alexandre F.R. Stewart, George A. Wells, Harm-Jan Westra, Marcel G.M. Wolfs, Robert Clarke, Maria Grazia Franzosi, Anuj Goel, Anders Hamsten, Mark Lathrop, John F. Peden, Udo Seedorf, Hugh Watkins, Willem H. Ouwehand, Jennifer Sambrook, Jonathan Stephens, Juan-Pablo Casas, Fotios Drenos, Michael V. Holmes, Mika Kivimaki, Sonia Shah, Tina Shah, Philippa J. Talmud, John Whittaker, Chris Wallace, Christian Delles, Maris Laan, Diana Kuh, Steve E. Humphries, Fredrik Nyberg, Daniele Cusi, Robert Roberts, Christopher Newton-Cheh, Lude Franke, Alice V. Stanton, Anna F. Dominiczak, Martin Farrall, Aroon D. Hingorani, Nilesh J. Samani, Mark J. Caulfield, Patricia B. Munroe. (2011) Blood Pressure Loci Identified with a Gene-Centric Array. The American Journal of Human Genetics
CrossRef4
, Tadashi Konoshita. (2011) Do Genetic Variants of the Renin-Angiotensin System Predict Blood Pressure Response to Renin-Angiotensin System–Blocking Drugs? A Systematic Review of Pharmacogenomics in the Renin-Angiotensin System. Current Hypertension Reports 13:5, 356-361
CrossRef5
A. Kujawa-Szewieczek, A. Kolonko, M. Kocierz, M. Szotowska, W. Trusolt, H. Karkoszka, J. Gumprecht, J. Chudek, A. Więcek. (2011) Association Between Gene Polymorphisms of the Components of the Renin-Angiotensin-Aldosteron System, Graft Function, and the Prevalence of Hypertension, Anemia, and Erythrocytosis After Kidney Transplantation. Transplantation Proceedings 43:8, 2957-2963
CrossRef6
Eros Balam-Ortiz, Adolfo Esquivel-Villarreal, Luis Alfaro-Ruiz, Karol Carrillo, Adela Elizalde, Trinidad Gil, Maki Urushihara, Hiroyuki Kobori, Gerardo Jimenez-Sanchez. (2011) Variants and Haplotypes in Angiotensinogen Gene Are Associated With Plasmatic Angiotensinogen Level in Mexican Population. The American Journal of the Medical Sciences 342:3, 205-211
CrossRef7
M. Gopi Chand, J. Srinath, R. S. Rao, Bhaskar V. K. S. Lakkakula, Satish Kumar, V. R. Rao. (2011) Association Between the M268T Polymorphism in the Angiotensinogen Gene and Essential Hypertension in a South Indian Population. Biochemical Genetics 49:7-8, 474-482
CrossRef8
Juan Carlos Yugar-Toledo, José Fernando Vilela Martin, José Eduardo Krieger, Alexandre C Pereira, Caroline Demacq, Otávio Rizzi Coelho, Eduardo Pimenta, David A. Calhoun, Heitor Moreno Júnior. (2011) Gene Variation in Resistant Hypertension: Multilocus Analysis of the Angiotensin 1-Converting Enzyme, Angiotensinogen, and Endothelial Nitric Oxide Synthase Genes. DNA and Cell Biology 30:8, 555-564
CrossRef9
YU-JI LEE, HYE RYOUN JANG, SEONG GYUN KIM, DONG-WAN CHAE, JUN-YOUNG DO, JUNG EUN LEE, WOOSEONG HUH, DAE JOONG KIM, HA YOUNG OH, YOON-GOO KIM. (2011) Renoprotective efficacy of valsartan in chronic non-diabetic proteinuric nephropathies with renin-angiotensin system gene polymorphisms. Nephrology 16:5, 502-510
CrossRef10
Wei Ding, Furu Wang, Qiaoqiao Fang, Minmin Zhang, Jing Chen, Yong Gu. (2011) Association between two genetic polymorphisms of the renin-angiotensin-aldosterone system and diabetic nephropathy: a meta-analysis. Molecular Biology Reports
CrossRef11
Duane A. Tewksbury. 2011. Angiotensinogen. .
CrossRef12
Lucia Maria Procopciuc, Adela Sitar-Tăut, Dana Pop, Dan-Andrei Sitar-Tăut, Ileana Olteanu, Dumitru Zdrenghea. (2010) Renin angiotensin system polymorphisms in patients with metabolic syndrome (MetS). European Journal of Internal Medicine 21:5, 414-418
CrossRef13
Nesrine Abboud, Lakhder Ghazouani, Belhassen Kaabi, Sonia Ben-Hadj-Khalifa, Fawzi Addad, Mahjoub Marwen, Wassim Y. Almawi, Touhami Mahjoub. (2010) Evaluation of the Contribution of Renin Angiotensin System Polymorphisms to the Risk of Coronary Artery Disease Among Tunisians. Genetic Testing and Molecular Biomarkers 14:5, 661-666
CrossRef14
Yu-Jing Fang, Han-Bing Deng, G Neil Thomas, Chi H Tzang, Cai-Xia Li, Zong-Li Xu, Mengsu Yang, Brian Tomlinson. (2010) Linkage of angiotensinogen gene polymorphisms with hypertension in a sibling study of Hong Kong Chinese. Journal of Hypertension1
CrossRef15
Artemis P. Simopoulos. (2010) Nutrigenetics/Nutrigenomics. Annual Review of Public Health 31:1, 53-68
CrossRef16
Gavin R. Norton, Richard Brooksbank, Angela J. Woodiwiss. (2010) Gene variants of the renin–angiotensin system and hypertension: from a trough of disillusionment to a welcome phase of enlightenment?. Clinical Science 118:8, 487-506
CrossRef17
Felix Gomez-Gallego, Catalina Santiago, Marta González-Freire, Thomas Yvert, Carlos A. Muniesa, Luis Serratosa, Signe Altmäe, Jonatan R. Ruiz, Alejandro Lucia. (2009) The C allele of the AGT Met235Thr polymorphism is associated with power sports performance. Applied Physiology, Nutrition, and Metabolism 34:6, 1108-1111
CrossRef18
Christopher J. McLeod, J. Martijn Bos, Jeanne L. Theis, William D. Edwards, Bernard J. Gersh, Steve R. Ommen, Michael J. Ackerman. (2009) Histologic characterization of hypertrophic cardiomyopathy with and without myofilament mutations. American Heart Journal 158:5, 799-805
CrossRef19
Rahul Kumar, Azim Nejatizadeh, Ehtesham Arif, Salman Akhtar, Mohit Gupta, Sanjay Tyagi, A.K. Goyal, S.K. Jain, M.A. Qadar Pasha. (2009) Multi-locus interactions of vascular homeostasis genes in essential hypertension: A gender-based study. Clinica Chimica Acta 405:1-2, 87-93
CrossRef20
Jiali Yuan, Wenru Tang, Yinan Chun, Hua Ying, Yang Yang, Chunjie Xiao. (2009) Angiotensinogen T174M and M235T Variants and Hypertension in the Hani and Yi Minority Groups of China. Biochemical Genetics 47:5-6, 344-350
CrossRef21
Y Sato, N M Laird, K Nagashima, R Kato, T Hamano, A Yafune, N Kaniwa, Y Saito, E Sugiyama, S-R Kim, J Furuse, H Ishii, H Ueno, T Okusaka, N Saijo, J-i Sawada, T Yoshida. (2009) A new statistical screening approach for finding pharmacokinetics-related genes in genome-wide studies. The Pharmacogenomics Journal 9:2, 137-146
CrossRef22
Anna Möllsten, Ingrid Kockum, Maria Svensson, Susanne Rudberg, Anna Ugarph-Morawski, Kerstin Brismar, Jan W. Eriksson, Gisela Dahlquist. (2008) The effect of polymorphisms in the renin–angiotensin–aldosterone system on diabetic nephropathy risk. Journal of Diabetes and its Complications 22:6, 377-383
CrossRef23
Craig Wong, Peter Kanetsky, Dominic Raj. (2008) Genetic polymorphisms of the RAS-cytokine pathway and chronic kidney disease. Pediatric Nephrology 23:7, 1037-1051
CrossRef24
Ulrich H Frey, Hagen S Bachmann, Jürgen Peters, Winfried Siffert. (2008) PCR-amplification of GC-rich regions: 'slowdown PCR'. Nature Protocols 3:8, 1312-1317
CrossRef25
Azim Nejatizadeh, Rahul Kumar, Tsering Stobdan, Ajit K Goyal, Mohit Gupta, Saleem Javed, MA Qadar Pasha. (2008) Significance of angiotensinogen gene haplotypes and genotypes combinations in hypertension. Journal of Hypertension 26:6, 1094-1101
CrossRef26
Patricia H. Gallego, Neil Shephard, Max K. Bulsara, Frank M. van Bockxmeer, Brenda L. Powell, John P. Beilby, Gillian Arscott, Michael Le Page, Lyle J. Palmer, Elizabeth A. Davis, Timothy W. Jones, Catherine S.Y. Choong. (2008) Angiotensinogen gene T235 variant: a marker for the development of persistent microalbuminuria in children and adolescents with type 1 diabetes mellitus. Journal of Diabetes and its Complications 22:3, 191-198
CrossRef27
Nikos Zdoukopoulos, Elias Zintzaras. (2008) Genetic Risk Factors for Placental Abruption. Epidemiology 19:2, 309-323
CrossRef28
Dzuzaini M. Ghazali, Asia Rehman, Abdul Rashid A. Rahman. (2008) Candidate gene polymorphisms and their association with hypertension in Malays. Clinica Chimica Acta 388:1-2, 46-50
CrossRef29
Y Qi, W Niu, W Zhou, S Hou, C Qiu. (2008) Correlation between angiotensinogen gene polymorphisms and essential hypertension in Chinese population. Journal of Human Hypertension 22:2, 147-150
CrossRef30
Leonelo E. BAUTISTA, Clara I. VARGAS, Myriam ORÓSTEGUI, Germán GAMARRA. (2008) Population-Based Case-Control Study of Renin-Angiotensin System Genes Polymorphisms and Hypertension among Hispanics. Hypertension Research 31:3, 401-408
CrossRef31
Taizen Nakase, Toshiki Mizuno, Sanae Harada, Kei Yamada, Tsunehiko Nishimura, Kotaro Ozasa, Yoshiyuki Watanabe, Ken Nagata. (2007) Angiotensinogen gene polymorphism as a risk factor for ischemic stroke. Journal of Clinical Neuroscience 14:10, 943-947
CrossRef32
Eric M. Snyder, Thomas P. Olson, Bruce D. Johnson. (2007) Genetics and pharmacogenetics in heart failure. Current Heart Failure Reports 4:3, 139-144
CrossRef33
Alexander Binder. (2007) A review of the genetics of essential hypertension. Current Opinion in Cardiology 22:3, 176-184
CrossRef34
Claudia Handtrack, Nada Cordasic, Bernd Klanke, Roland Veelken, Karl F. Hilgers. (2007) Effect of the angiotensinogen genotype on experimental hypertension in mice. Journal of Molecular Medicine 85:4, 343-350
CrossRef35
Dieter Rosskopf, Markus Schürks, Christian Rimmbach, Rafael Schäfers. (2007) Genetics of arterial hypertension and hypotension. Naunyn-Schmiedeberg's Archives of Pharmacology 374:5-6, 429-469
CrossRef36
T V Tupitsina, P A Slominsky, Y M Yufereva, N I Perova, D M Aronov, S A Limborska. (2007) Linkage Analysis by a Transmission/Disequilibrium Test of Russian Sibling Pairs with Coronary Artery Disease. Balkan Journal of Medical Genetics 10:2, 43-54
CrossRef37
Wenquan NIU, Yue QI, Weijun CEN, Chaoying CUI, Ciren ZHUOMA, Dan CAI, Wenyu ZHOU, Changchun QIU. (2007) Genetic Polymorphisms of Angiotensinogen and Essential Hypertension in a Tibetan Population. Hypertension Research 30:11, 1129-1137
CrossRef38
Robert Feneck. (2007) Drugs for the Perioperative Control of Hypertension. Drugs 67:14, 2023-2044
CrossRef39
M.V. Shestakova, O.K. Vikulova, N.M. Gorashko, O.E. Voronko, N.B. Babunova, V.V. Nosikov, I.I. Dedov. (2006) The relationship between genetic and haemodynamic factors in diabetic nephropathy (DN): Case–control study in type 1 diabetes mellitus (T1DM). Diabetes Research and Clinical Practice 74:2, S41-S50
CrossRef40
J.R. Maximino, M.F.R. Ferrari, E.F. Coelho, D.R. Fior-Chadi. (2006) Time course analysis of tyrosine hydroxylase and angiotensinogen mRNA expression in central nervous system of rats submitted to experimental hypertension. Neuroscience Research 55:3, 292-299
CrossRef41
Xiaoling Wang, Haidong Zhu, Yanbin Dong, Frank A Treiber, Harold Snieder. (2006) Effects of Angiotensinogen and Angiotensin II Type I Receptor Genes on Blood Pressure and Left Ventricular Mass Trajectories in Multiethnic Youth. Twin Research and Human Genetics 9:3, 393-402
CrossRef42
Yasuto Takakura, Toshihide Yoshida, Keiji Yoshioka, Tsunekazu Umekawa, Akinori Kogure, Hitoshi Toda, Keizo Kagawa, Susumu Fukui, Toshikazu Yoshikawa. (2006) Angiotensinogen gene polymorphism (Met235Thr) influences visceral obesity and insulin resistance in obese Japanese women. Metabolism 55:6, 819-824
CrossRef43
Christian Götting, Doris Hendig, Alexandra Adam, Sylvia Schön, Veronika Schulz, Christiane Szliska, Joachim Kuhn, Knut Kleesiek. (2005) Elevated xylosyltransferase I activities in pseudoxanthoma elasticum (PXE) patients as a marker of stimulated proteoglycan biosynthesis. Journal of Molecular Medicine 83:12, 984-992
CrossRef44
Jean-Brice Marteau, Mohamed Zaiou, Gérard Siest, Sophie Visvikis-Siest. (2005) Genetic determinants of blood pressure regulation. Journal of Hypertension 23:12, 2127-2143
CrossRef45
Karsten Grote, Maren Luchtefeld, Bernhard Schieffer. (2005) JANUS under stress—Role of JAK/STAT signaling pathway in vascular diseases. Vascular Pharmacology 43:5, 357-363
CrossRef46
Hernan Rincon-Choles, Farook Thameem, Donna M Lehman, Rector Arya, Nedal Arar, Ravindranath Duggirala, Michael P Stern, Hanna E Abboud. (2005) Genetic Basis of Diabetic Nephropathy. American Journal of Therapeutics 12:6, 555-561
CrossRef47
A.R. Michell. (2005) Comparative clinical science: The medicine of the future. The Veterinary Journal 170:2, 153-162
CrossRef48
Silvia Sookoian, Gustavo Castano, Silvia I. Garcia, Pedro Viudez, Claudio Gonzalez, Carlos J. Pirola. (2005) A1166C Angiotensin II Type 1 Receptor Gene Polymorphism May Predict Hemodynamic Response to Losartan in Patients with Cirrhosis and Portal Hypertension. The American Journal of Gastroenterology 100:3, 636-642
CrossRef49
Matthew J. Delmonico, Robert E. Ferrell, Anish Meerasahib, Greg F. Martel, Stephen M. Roth, Matthew C. Kostek, Ben F. Hurley. (2005) Blood Pressure Response to Strength Training May Be Influenced by Angiotensinogen Aâ20C and Angiotensin II Type I Receptor A1166C Genotypes in Older Men and Women. Journal of the American Geriatrics Society 53:2, 204-210
CrossRef50
Jianhua Qin, Zhaoyi Liu, Dapeng Wu, Ning Zhu, Xiaomian Zhou, Yingsing Fung, Bingcheng Lin. (2005) Genotyping the -6A/G functional polymorphism in the core promoter region of angiotensinogen gene by microchip electrophoresis. ELECTROPHORESIS 26:1, 219-224
CrossRef51
Huimin YU, Shuguang LIN, Guozhang LIU, Yuqing ZHANG, Chunyu DENG, Wenjun MA. (2005) T1198C Polymorphism of the Angiotensinogen Gene and Antihypertensive Response to Angiotensin-Converting Enzyme Inhibitors. Hypertension Research 28:12, 981-986
CrossRef52
Usman AHMAD, Danish SALEHEEN, Awais BOKHARI, Philippe M. FROSSARD. (2005) Strong Association of a Renin Intronic Dimorphism with Essential Hypertension. Hypertension Research 28:4, 339-344
CrossRef53
Afig Berdeli, Cevad Sekuri, F. Sirri Cam, Ertugrul Ercan, Abdi Sagcan, Istemihan Tengiz, Erhan Eser, Mustafa Akın. (2005) Association between the eNOS (Glu298Asp) and the RAS genes polymorphisms and premature coronary artery disease in a Turkish population. Clinica Chimica Acta 351:1-2, 87-94
CrossRef54
ANGELA YEE-MOON WANG, PHILIP KAM-TAO LI, SIU-FAI LUI, JOHN E SANDERSON. (2004) Review Article. Angiotensin converting enzyme inhibition for cardiac hypertrophy in patients with end-stage renal disease: What is the evidence?. Nephrology 9:4, 190-197
CrossRef55
Marc Romana, Jean-Pierre Diara, Lydia Doumbo, Shanmugakonar Muralitharan, Rajendranath Ramasawmy, Lysiane Keclard, Vanessa Tarer, Vicky Chaar, Jacques Elion, Rajagopal Krishnamoorthy, John Clayton. (2004) Angiotensinogen gene associated polymorphisms and risk of stroke in sickle cell anemia: Additional data supporting an association. American Journal of Hematology 76:3, 310-311
CrossRef56
Stefan-Martin Brand-Herrmann, Karla Köpke, Florian Reichenberger, Klaus Schmidt-Petersen, Thomas Reineke, Martin Paul, Walter Zidek, Eva Brand. (2004) Angiotensinogen promoter haplotypes are associated with blood pressure in untreated hypertensives. Journal of Hypertension 22:7, 1289-1297
CrossRef57
Scott M. Williams, Jonathan L. Haines, Jason H. Moore. (2004) The use of animal models in the study of complex disease: all else is never equal or why do so many human studies fail to replicate animal findings?. BioEssays 26:2, 170-179
CrossRef58
Kazumasa YAMAGISHI, Hiroyasu ISO, Takeshi TANIGAWA, Renzhe CUI, Minako KUDO, Takashi SHIMAMOTO. (2004) High Sodium Intake Strengthens the Association between Angiotensinogen T174M Polymorphism and Blood Pressure Levels among Lean Men and Women: a Community-Based Study. Hypertension Research 27:1, 53-60
CrossRef59
Hedi Schelleman, Bruno H Ch Stricker, Anthonius de Boer, Abraham A Kroon, Monique W M Verschuren, Cornelia M van Duijn, Bruce M Psaty, Olaf H Klungel. (2004) Drug-Gene Interactions between Genetic Polymorphisms and Antihypertensive Therapy. Drugs 64:16, 1801-1816
CrossRef60
Judith A Miller, James W Scholey. (2004) The impact of renin-angiotensin system polymorphisms on physiological and pathophysiological processes in humans. Current Opinion in Nephrology and Hypertension 13:1, 101-106
CrossRef61
Scott M. Williams, Marylyn D. Ritchie, John A. Phillips III, Elliot Dawson, Melissa Prince, Elvira Dzhura, Alecia Willis, Amma Semenya, Marshall Summar, Bill C. White, Jonathan H. Addy, John Kpodonu, Lee-Jun Wong, Robin A. Felder, Pedro A. Jose, Jason H. Moore. (2004) Multilocus Analysis of Hypertension: A Hierarchical Approach. Human Heredity 57:1, 28-38
CrossRef62
Hagen S Bachmann, Winfried Siffert, Ulrich H Frey. (2003) Successful amplification of extremely GC-rich promoter regions using a novel ???slowdown PCR??? technique. Pharmacogenetics 13:12, 759-766
CrossRef63
Leopoldo Raij. (2003) End-organ susceptibility as a determinant of renal disease in hypertension. Kidney International 64:5, 1923-1932
CrossRef64
Jop H. van Berlo, Yigal M. Pinto. (2003) Polymorphisms in the RAS and cardiac function. The International Journal of Biochemistry & Cell Biology 35:6, 932-943
CrossRef65
Angela Yee-Moon Wang, Juliana Chung-Ngor Chan, Mei Wang, Emily Poon, Siu-Fai Lui, Philip Kam-Tao Li, John Sanderson. (2003) Cardiac hypertrophy and remodeling in relation to ACE and angiotensinogen genes genotypes in Chinese dialysis patients. Kidney International 63:5, 1899-1907
CrossRef66
K.G. Nair, K.K. Shalia, T.F. Ashavaid, J.J. Dalal. (2003) Coronary heart disease, hypertension, and angiotensinogen gene variants in indian opulation. Journal of Clinical Laboratory Analysis 17:5, 141-146
CrossRef67
JianFeng Peng, Birgitta Kimura, M.Ian Phillips. (2002) The predominant role of brain angiotensinogen and angiotensin in environmentally induced hypertension. Regulatory Peptides 110:1, 25-32
CrossRef68
Artemis P Simopoulos. (2002) Genetic variation and dietary response: Nutrigenetics/nutrigenomics. Asia Pacific Journal of Clinical Nutrition 11:s6, S117-S128
CrossRef69
Lisa Kurland, Håkan Melhus, Julia Karlsson, Thomas Kahan, Karin Malmqvist, Peter Öhman, Fredrik Nyström, Anders Hägg, Lars Lind. (2002) Polymorphisms in the angiotensinogen and angiotensin II type 1 receptor gene are related to change in left ventricular mass during antihypertensive treatment: results from the Swedish Irbesartan Left Ventricular Hypertrophy Investigation versus Atenolol (SILVHIA) trial. Journal of Hypertension 20:4, 657-663
CrossRef70
Lucia Procopciuc, T. Popescu, Gh. Jebeleanu, D. Pop, D. Zdrengehea. (2002) Essential arterial hypertension and polymorphism of angiotensiongen M235T gene. Journal of Cellular and Molecular Medicine 6:2, 245-250
CrossRef71
Mamoru Toyofyuku, Michinori Imazu, Kotaro Sumii, Hideya Yamamoto, Yasuhiko Hayashi, Keiko Hiyama, Nobuoki Kohno. (2002) Influence of angiotensinogen M253T gene polymorphism and an angiotensin converting enzyme inhibitor on restenosis after percutaneous coronary intervention. Atherosclerosis 160:2, 339-344
CrossRef72
Delia C. Tang, Ron Prauner, Wenli Liu, Kye-Hyun Kim, Robert P. Hirsch, M. Catherine Driscoll, Griffin P. Rodgers. (2001) Polymorphisms within the angiotensinogen gene (GT-Repeat) and the risk of stroke in pediatric patients with sickle cell disease: A case-control study. American Journal of Hematology 68:3, 164-169
CrossRef73
Lisa Kurland, Håkan Melhus, Julia Karlsson, Thomas Kahan, Karin Malmqvist, K. Peter Öhman, Fredrik Nyström, Anders Hägg, Lars Lind. (2001) Angiotensin converting enzyme gene polymorphism predicts blood pressure response to angiotensin II receptor type 1 antagonist treatment in hypertensive patients. Journal of Hypertension 19:10, 1783-1787
CrossRef74
Jonathan D. Rippin, Ashok Patel, Stephen C. Bain. (2001) Genetics of diabetic nephropathy. Best Practice & Research Clinical Endocrinology & Metabolism 15:3, 345-358
CrossRef75
Perrin C. White, Anil K. Agarwal, Airong Li, Heli Nikkila, J. Howard Pratt, Mark Caulfield, Adrian Clark, Claire McTernan, Paul M. Stewart. (2001) Possible association but no linkage of the HSD11B2 gene encoding the kidney isozyme of 11beta-hydroxysteroid dehydrogenase to hypertension in Black people. Clinical Endocrinology 55:2, 249-252
CrossRef76
Emanuela Lovati, Alain Richard, Brigitte M Frey, Felix J Frey, Paolo Ferrari. (2001) Genetic polymorphisms of the renin-angiotensin-aldosterone system in end-stage renal disease. Kidney International 60:1, 46-54
CrossRef77
N Fernández-Arcás, JL Dieguez-Lucena, E Muñoz-Morán, M Ruiz-Galdón, S Espinosa-Caliani, P Aranda-Lara, F Rius-Diaz, MJ Gaitán-Arroyo, E De Teresa-Galván, A Reyes-Engel. (2001) Both alleles of the M235T polymorphism of the angiotensinogen gene can be a risk factor for myocardial infarction. Clinical Genetics 60:1, 52-57
CrossRef78
M. Carluccio, M. Soccio, R. De Caterina. (2001) Aspects of gene polymorphisms in cardiovascular disease: the renin-angiotensin system. European Journal of Clinical Investigation 31:6, 476-488
CrossRef79
José C Rodrı́guez-Pérez, Francisco Rodrı́guez-Esparragón, Octavio Hernández-Perera, Aránzazu Anabitarte, Antonio Losada, Alfonso Medina, Enrique Hernández, Dolores Fiuza, Octavio Avalos, Carla Yunis, Carlos M Ferrario. (2001) Association of angiotensinogen m235t and a(-6)g gene polymorphisms with coronary heart disease with independence of essential hypertension: the procagene study. Journal of the American College of Cardiology 37:6, 1536-1542
CrossRef80
Lisa Kurland, Hakan Melhus, Mahziar Sarabi, Jonas Millgard, Sverker Ljunghall, Lars Lind. (2001) Polymorphisms in the renin-angiotensin system and endothelium-dependent vasodilation in normotensive subjects. Clinical Physiology 21:3, 343-349
CrossRef81
Paolo Mulatero, Franco Rabbia, Stefania Morra di Cella, Domenica Schiavone, Claudio Plazzotta, Leigh Pascoe, Franco Veglio. (2001) Angiotensin-converting enzyme and angiotensinogen gene polymorphisms are non-randomly distributed in oral contraceptive-induced hypertension.. Journal of Hypertension 19:4, 713-719
CrossRef82
Monika Stoll, Howard J. Jacob. (2001) Genetic rat models of hypertension: Relationship to human hypertension. Current Hypertension Reports 3:2, 157-164
CrossRef83
David S. Timberlake, Daniel T. O??Connor, Robert J. Parmer. (2001) Molecular genetics of essential hypertension: recent results and emerging strategies. Current Opinion in Nephrology and Hypertension 10:1, 71-79
CrossRef84
Kevin M. O'Shaughnessy. (2001) The genetics of essential hypertension. British Journal of Clinical Pharmacology 51:1, 5-11
CrossRef85
Tadashi Konoshita, Kyoko Miyagi, Tamehito Onoe, Kenichi Katano, Hisao Mutoh, Hideki Nomura, Ichiro Koni, Isamu Miyamori, Hiroshi Mabuchi. (2001) Effect of ACE gene polymorphism on age at renal death in polycystic kidney disease in Japan. American Journal of Kidney Diseases 37:1, 113-118
CrossRef86
Christian Delles, Jeanette Erdmann, Johannes Jacobi, Eckart Fleck, Vera Regitz-Zagrosek, Roland E. Schmieder. (2000) Lack of association between polymorphisms of angiotensin II receptor genes and response to short-term angiotensin II infusion. Journal of Hypertension 18:11, 1573-1578
CrossRef87
Hiroyasu Iso, Shoji Harada, Takashi Shimamoto, Shinichi Sato, Akihiko Kitamura, Tomoko Sankai, Takeshi Tanigawa, Minoru Iida, Yoshio Komachi. (2000) Angiotensinogen T174M and M235T variants, sodium intake and hypertension among non-drinking, lean Japanese men and women. Journal of Hypertension 18:9, 1197-1206
CrossRef88
Michael A. Province, Eric Boerwinkle, Aravinda Chakravarti, Richard Cooper, Myriam Fornage, Mark Leppert, Neil Risch, Koustubh Ranade. (2000) Lack of association of the angiotensinogen-6 polymorphism with blood pressure levels in the comprehensive NHLBI Family Blood Pressure Program. Journal of Hypertension 18:7, 867-876
CrossRef89
Masahiro Sugano, Keiko Tsuchida, Shojiro Sawada, Naoki Makino. (2000) Reduction of plasma angiotensin II to normal levels by antisense oligodeoxynucleotides against liver angiotensinogen cannot completely attenuate vascular remodeling in spontaneously hypertensive rats. Journal of Hypertension 18:6, 725-731
CrossRef90
Barry I. Freedman, Scott G. Satko. (2000) Genes and renal disease. Current Opinion in Nephrology and Hypertension 9:3, 273-277
CrossRef91
Roberto Pontremoli, Maura Ravera, Francesca Viazzi, Clizia Nicolella, Valeria Berruti, Giovanna Leoncini, Francesca Giacopelli, Gian Paolo Bezante, Giorgio Sacchi, Roberto Ravazzolo, Giacomo Deferrari. (2000) Genetic polymorphism of the renin-angiotensin system and organ damage in essential hypertension. Kidney International 57:2, 561-569
CrossRef92
Eva Brand, Jens Ringel, Arya M. Sharma. (2000) Die Rolle des Angiotensinogengens für die essentielle Hypertonie. Herz 25:1, 15-25
CrossRef93
Gary C. Armitage, Yafei Wu, Hwa-Ying Wang, Julian Sorrell, Francesco S. di Giovine, Gordon W. Duff. (2000) Low Prevalence of a Periodontitis-Associated Interleukin-1 Composite Genotype in Individuals of Chinese Heritage. Journal of Periodontology 71:2, 164-171
CrossRef94
Anna Solini, Gilberta Giacchetti, Andrea Sfriso, Paola Fioretto, Cipriana Sardu, Alois Saller, Giancarlo Tonolo, Mario Maioli, Franco Mantero, Romano Nosadini. (1999) Polymorphisms of angiotensin-converting enzyme and angiotensinogen genes in type 2 diabetic sibships in relation to albumin excretion rate. American Journal of Kidney Diseases 34:6, 1002-1009
CrossRef95
Roger R. Williams, Paul N. Hopkins, Susan Stephenson, Lily Wu, Steven C. Hunt. (1999) Primordial Prevention of Cardiovascular Disease through Applied Genetics. Preventive Medicine 29:6, S41-S49
CrossRef96
William Y.S. Wang, Cheryl L. Glenn, Weiyi Zhang, Adam V. Benjafield, Dale R. Nyholt, Brian J. Morris. (1999) Exclusion of angiotensinogen gene in molecular basis of human hypertension: Sibpair linkage and association analyses in Australian Anglo-Caucasians. American Journal of Medical Genetics 87:1, 53-60
CrossRef97
Satoshi Morimoto, Susumu Sasaki, Hiroshi Itoh, Tetsuo Nakata, Kazuo Takeda, Masao Nakagawa, Seiichi Furuya, Shoji Naruse, Ryuichi Fukuyama, Shinji Fushiki. (1999) Sympathetic activation and contribution of genetic factors in hypertension with neurovascular compression of the rostral ventrolateral medulla. Journal of Hypertension 17:11, 1577-1582
CrossRef98
Kristina Bengtsson, Marju Orho-Melander, Ulf Lindblad, Olle Melander, Erik Bøg-Hansen, Jonas Ranstam, Lennart Råstam, Leif Groop. (1999) Polymorphism in the angiotensin converting enzyme but not in the angiotensinogen gene is associated with hypertension and type 2 diabetes. Journal of Hypertension 17:11, 1569-1575
CrossRef99
Johannes Jacobi, Karl F. Hilgers, Markus P. Schlaich, Winfried Siffert, Roland E. Schmieder. (1999) 825T allele of the G-protein β3 subunit gene (GNB3) is associated with impaired left ventricular diastolic filling in essential hypertension. Journal of Hypertension 17:10, 1457-1462
CrossRef100
Junnosuke Miura, Yasuko Uchigata, Hiroki Yokoyama, Yasue Omori, Yasuhiko Iwamoto. (1999) Genetic polymorphism of renin-angiotensin system is not associated with diabetic vascular complications in Japanese subjects with long-term insulin dependent diabetes mellitus. Diabetes Research and Clinical Practice 45:1, 41-49
CrossRef101
Robert A Hegele, Matthew R Ban, Christopher P Busch, Samuel Ramsewak, D.Dan Ramdath. (1999) Lipoprotein-genotype associations in Trinidadian neonates. Clinical Biochemistry 32:6, 429-437
CrossRef102
Ra Hegele, Sb Harris, Ajg Hanley, B Zinman. (1999) Association between AGT codon 235 polymorphism and variation in serum concentrations of creatinine and urea in Canadian Oji-Cree. Clinical Genetics 55:6, 438-443
CrossRef103
Norihiro Kato, Takao Sugiyama, Hiroyuki Morita, Hiroki Kurihara, Yukio Yamori, Yoshio Yazaki. (1999) Angiotensinogen gene and essential hypertension in the Japanese. Journal of Hypertension 17:6, 757-763
CrossRef104
Tianhua Niu, Changzhong Chen, Jianhua Yang, Binyan Wang, Zhaoxi Wang, Nicholas Schork, Zhian Fang, Xiping Xu. (1999) Blood Pressure and the T174M and M235T Polymorphisms of the Angiotensinogen Gene. Annals of Epidemiology 9:4, 245-253
CrossRef105
Robert A Hegele, Stewart B Harris, Anthony J.G Hanley, Bernard Zinman. (1999) Association between AGT T235 variant and microalbuminuria in Canadian Oji-cree with type 2 diabetes mellitus. Clinical Biochemistry 32:3, 201-205
CrossRef106
Helen Colhoun. (1999) Confirmation needed for genes for hypertension. The Lancet 353:9160, 1200-1201
CrossRef107
RICHARD COOPER. (1999) The Role of Genetic and Environmental Factors in Cardiovascular Disease in African Americans. The American Journal of the Medical Sciences 317:3, 208-213
CrossRef108
Hajime Nakahama, Kyoko Obata, Taisuke Nakajima, Hitoshi Nakamura, Osamu Kitada, Minoru Sugita, Yoshimasa Fujita, Noritaka Kawada, Toshiki Moriyama. (1999) Renin-Angiotensin System Component Gene Polymorphism in Japanese Bronchial Asthma Patients. Journal of Asthma 36:2, 187-193
CrossRef109
Jan A. Staessen, Tatyana Kuznetsova, Ji G. Wang, Dmitri Emelianov, Robert Vlietinck, Robert Fagard. (1999) M235T angiotensinogen gene polymorphism and cardiovascular renal risk. Journal of Hypertension 17:1, 9-17
CrossRef110
Xavier Jeunemaitre, Anne-Paule Gimenez-Roqueplo, Jérôme Célérier, Pierre Corvol. (1999) Angiotensinogen variants and human hypertension. Current Hypertension Reports 1:1, 31-41
CrossRef111
Norihiro Kato, Cècile Julier. (1999) Linkage mapping for hypertension susceptibility genes. Current Hypertension Reports 1:1, 15-24
CrossRef112
Yaacov Frishberg, Rachel Becker-Cohen, David Halle, Elad Feigin, Bella Eisenstein, Raphael Halevy, Danny Lotan, Isam Juabeh, Nathan Ish-Shalom, Daniella Magen, Yigal Shvil, Levana Sinai-Treiman, Alfred Drukker. (1998) Genetic polymorphisms of the renin-angiotensin system and the outcome of focal segmental glomerulosclerosis in children. Kidney International 54:6, 1843-1849
CrossRef113
Anna F. Dominiczak, James S. Clark, Baxter Jeffs, Niall H. Anderson, Cervantes D. Negrin, Wai K. Lee, M Julia Brosnan. (1998) Genetics of experimental hypertension. Journal of Hypertension 16:Supplement, 1859-1869
CrossRef114
NGUYEN DUC CONG, KAZUYUKI HAMAGUCHI, TETSUNORI SAIKAWA, MASAHIDE HARA, TOSHIIE SAKATA. (1998) A Polymorphism of Angiotensinogen Gene Codon 174 and Coronary Artery Disease in Japanese Subjects. The American Journal of the Medical Sciences 316:5, 339-344
CrossRef115
Brian J. Morris, Lyn R. Griffiths. (1998) SCANNING THE GENOME FOR ESSENTIAL HYPERTENSION LOCI. Clinical and Experimental Pharmacology and Physiology 25:S1, S72-S78
CrossRef116
Carola E. Lemne. (1998) Increased blood pressure reactivity in children of borderline hypertensive fathers. Journal of Hypertension 16:9, 1243-1248
CrossRef117
Daniele Cusi, Giuseppe Bianchi. (1998) A primer on the genetics of hypertension. Kidney International 54:2, 328-342
CrossRef118
Bernard M.Y. Cheung, Raymond Leung, Sammi Shiu, Kathryn C.B. Tan, Chu-Pak Lau, Cyrus R. Kumana. (1998) M235T polymorphism of the angiotensinogen gene and hypertension in Chinese. Journal of Hypertension 16:8, 1137-1140
CrossRef119
Anna Vasku, Miroslav Soucek, Vladimir Znojil, Ivan Rihacek, Svatava Tschoplova, Lenka Strelcova, Karel Cidl, Michaela Blazkova, Dobroslav Hajek, Lydie Holla, Jiri Vacha. (1998) Angiotensin I-converting enzyme and angiotensinogen gene interaction and prediction of essential hypertension. Kidney International 53:6, 1479-1482
CrossRef120
Carlos E. Fardella, Ximena Claverie, Pamela Vignolo, Joaquín Montero, Luis Villarroel. (1998) T235 variant of the angiotensinogen gene and blood pressure in the Chilean population. Journal of Hypertension 16:6, 829-833
CrossRef121
Richard Cooper, Terrence Forrester, Olufemi Ogunbiyi, Jacob Muffinda. (1998) Angiotensinogen levels and obesity in four black populations. Journal of Hypertension 16:5, 571-575
CrossRef122
Donna K Arnett, Ingrid B Borecki, Erwin H Ludwig, James S Pankow, Richard Myers, Greg Evans, Aaron R Folsom, Gerardo Heiss, Millicent Higgins. (1998) Angiotensinogen and angiotensin converting enzyme genotypes and carotid atherosclerosis: The atherosclerosis risk in communities and the NHLBI family heart studies. Atherosclerosis 138:1, 111-116
CrossRef123
Pavel Hamet, Zdenka Pausova, Viacheslav Adarichev, Kira Adaricheva, Johanne Tremblay. (1998) Hypertension. Journal of Hypertension 16:4, 397-418
CrossRef124
Heribert Schunkert. (1998) Molecular Genetics of Congestive Heart Failure. Scandinavian Cardiovascular Journal 32:47, 37-43
CrossRef125
Laurence Tiret, Hervé Blanc, Jean-Bernard Ruidavets, Dominique Arveiler, Gérald Luc, Xavier Jeunemaitre, Jean Tichet, Christine Mallet, Odette Poirier, Pierre-François Plouin, François Cambien. (1998) Gene polymorphisms of the renin-angiotensin system in relation to hypertension and parental history of myocardial infarction and stroke. Journal of Hypertension 16:1, 37-44
CrossRef126
S G. Megarry, A S. Hall, A J. Balmforth, S G. Ball. (1997) 2.1 Polymorphisms leading to amino-acid changes in the angiotensin II type 1 receptor gene in a hypertensive population. Journal of Hypertension 15:12, 1532-1533
CrossRef127
MARK CAULFIELD, PIERRE-MARC BOULOUX, PATRICIA MUNROE. (1997) Progress in Determining the Genes for Hypertension, Insulin Resistance, and Dyslipidemia. Annals of the New York Academy of Sciences 827:1 Lipids and Sy, 110-117
CrossRef128
Fetnat M. Fouad-Tarazi. (1997) HYPERTENSION HEMODYNAMICS. Medical Clinics of North America 81:5, 1131-1145
CrossRef129
Vinjamur S. Srikanthan, Francis G. Dunn. (1997) HYPERTENSION AND CORONARY ARTERY DISEASE. Medical Clinics of North America 81:5, 1147-1163
CrossRef130
Noritaka KAWADA, Toshiki MORIYAMA, Kenji YOKOYAMA, Atsushi YAMAUCHI, Akio ANDO, Hiroshi MIKAMI, Masamitu FUJII, Yoshiteru KAJIMOTO, Masaru HORIO, Enyu IMAI. (1997) Renin-angiotensin system component gene polymorphisms in Japanese maintenance haemodialysis patients. Nephrology 3:4, 521-526
CrossRef131
K. E. Berge, A. Bakken, M. Bøhn, J. Erikssen, K. Berg. (1997) Analyses of mutations in the human renal kallikrein (hKLKl) gene and their possible relevance to blood pressure regulation and risk of myocardial infarction. Clinical Genetics 52:2, 86-95
CrossRef132
Suzanne Lesage, Giberto Velho, Nathalie Vionnet, Nathalie Chatelain, Florence Demenais, Philippe Passa, Florent Soubrier, Philippe Froguel. (1997) Genetic studies of the renin-angiotensin system in arterial hypertension associated with non-insulin-dependent diabetes mellitus. Journal of Hypertension 15:6, 601-606
CrossRef133
Fu-Tien Chiang, Kwan-Lih Hsu, Chuen-Den Tseng, Wei-Hon Hsiao, Huey-Ming Lo, Tser-Haw Chern, Yung-Zu Tseng. (1997) Molecular variant M235T of the angiotensinogen gene is associated with essential hypertension in Taiwanese. Journal of Hypertension 15:6, 607-611
CrossRef134
Xavier Jeunemaitre, Ituro Inoue, Christopher Williams, Anne Charru, Jean Tichet, Mike Powers, Arya Mitra Sharma, Anne-Paule Gimenez-Roqueplo, Akira Hata, Pierre Corvol, Jean-Marc Lalouel. (1997) Haplotypes of Angiotensinogen in Essential Hypertension. The American Journal of Human Genetics 60:6, 1448-1460
CrossRef135
Joachim Beige, Oliver Zilch, Henriette Hohenbleicher, Jens Ringel, Regina Kunz, Armin Distler, Arya M. Sharma. (1997) Genetic variants of the renin–angiotensin system and ambulatory blood pressure in essential hypertension. Journal of Hypertension 15:5, 503-508
CrossRef136
Kr\[zstrok]ys\[zstrok]tof Strojek, Władysław Grzeszczak, Ewa Morawin, Miroslaw Adamski, Beata Lacka, Henryk Rudzki, Susanne Schmidt, Christine Keller, Eberhard Ritz. (1997) Nephropathy of type II diabetes: Evidence for hereditary factors?. Kidney International 51:5, 1602-1607
CrossRef137
Francesco Perticone, Roberto Ceravolo, Carmela Cosco, Maria Trapasso, Adriana Zingone, Paola Malatesta, Nicola Perrotti, Donatella Tramontano, Pier L Mattioli. (1997) Deletion Polymorphism of Angiotensin-Converting Enzyme Gene and Left Ventricular Hypertrophy in Southern Italian Patients. Journal of the American College of Cardiology 29:2, 365-369
CrossRef138
T. Nakayama, M. Soma, Y. Takahashi, Y. Izumi, K. Kanmatsuse, M. Esumi. (1997) Association analysis of CA repeat polymorphism of the endothelial nitric oxide synthase gene with essential hypertension in Japanese. Clinical Genetics 51:1, 26-30
CrossRef139
Brian J. Morris. (1997) Insulin Receptor Gene in Hypertension. Clinical and Experimental Hypertension 19:5-6, 551-565
CrossRef140
Guanglan Guo, Alan N. Wilton, Yuliang Fu, Hongyu Qiu, Shaun P. Brennecke, Desmond W. Cooper. (1997) Angiotensinogen gene variation in a population case-control study of preeclampsia/eclampsia in Australians and Chinese. Electrophoresis 18:9, 1646-1649
CrossRef141
Fumihiro SUGIYAMA. (1997) Development of Genetically Engineered Mice with Hypertension and Hypotension. Experimental Animals 46:3, 171-183
CrossRef142
I.B. Borecki, M.A. Province, E.H. Ludwig, R.C. Ellison, A.R. Folsom, G. Heiss, J.M. Lalouel, M. Higgins, D.C. Rao. (1997) Associations of candidate loci angiotensinogen and angiotensin-converting enzyme with severe hypertension: The NHLBI family heart study. Annals of Epidemiology 7:1, 13-21
CrossRef143
William Y. S. Wang, Robert L Zee, Brian J. Morris. (1997) Association of angiotensin II type 1 receptor gene polymorphism with essential hypertension. Clinical Genetics 51:1, 31-34
CrossRef144
L. Morgan, F. Broughton Pipkin, N. Kalsheker. (1996) Angiotensinogen: Molecular biology, biochemistry and physiology. The International Journal of Biochemistry & Cell Biology 28:11, 1211-1222
CrossRef145
Robin G Woolfson, Hugh E de Wardener. (1996) Primary renal abnormalities in hereditary hypertension. Kidney International 50:3, 717-731
CrossRef146
Hiroaki Yoshida, Satoru Kuriyama, Yoshihito Atsumi, Haruo Tomonari, Tetsuya Mitarai, Akihiko Hamaguchi, Hitoshi Kubo, Yoshindo Kawaguchi, Valentina Kon, Kenpei Matsuoka, Iekuni Ichikawa, Osamu Sakai. (1996) Angiotensin I converting enzyme gene polymorphism in non-insulin dependent diabetes mellitus. Kidney International 50:2, 657-664
CrossRef147
KK Wong, KM Summers, DJ Burstow, MJ West. (1996) GENETIC VARIANTS OF PROTEINS FROM THE RENIN ANGIOTENSIN SYSTEM ARE ASSOCIATED WITH PRESSURE LOAD CARDIAC HYPERTROPHY. Clinical and Experimental Pharmacology and Physiology 23:6-7, 587-590
CrossRef148
Tracy E Hunley, Bruce A Julian, John A Phillips, Marshal L Summar, Hiroaki Yoshida, Robert G Horn, Nancy J Brown, Agnes Fogo, Iekuni Ichikawa, Valentina Kon. (1996) Angiotensin converting enzyme gene polymorphism: Potential silencer motif and impact on progression in IgA nephropathy. Kidney International 49:2, 571-577
CrossRef149
Soumitra Ghosh, M.D., Ph.D, Francis S. Collins, M.D., Ph.D. (1996) THE GENETICIST'S APPROACH TO COMPLEX DISEASE 1. Annual Review of Medicine 47:1, 333-353
CrossRef150
Tomio Ohno, Shoji Kawazu, Shoichi Tomono. (1996) Association analyses of the polymorphisms of angiotensin-converting enzyme and angiotensinogen genes with diabetic nephropathy in Japanese non-insulin-dependent diabetics. Metabolism 45:2, 218-222
CrossRef151
Andrew P. Schrader, Robert Y. L. Zee, Brian J. Morris. (1996) Association analyses of NsiI RFLP of human insulin receptor gene in hypertensives. Clinical Genetics 49:2, 74-78
CrossRef152
(1996) Review. Biological Chemistry Hoppe-Seyler 377:1, 1-18
CrossRef153
X JEUNEMAITRE, P CORVOL. (1996) Aspects génétiques de l'hypertension artérielle. Annales de l'Institut Pasteur/Actualités 7:1, 49-54
CrossRef154
Philippe M. Frossard, Gilles G. Lestringant. (1995) Association between a dimorphic site on chromosome 12 and clinical diagnosis of hypertension in three independent populations. Clinical Genetics 48:6, 284-287
CrossRef155
Christopher RK Dudley, Bernard Keavney, Irene M Stratton, Robert C Turner, Peter J Ratcliffe. (1995) U.K. Prospective Diabetes Study XV: Relationship of renin-angiotensin system gene polymorphisms with microalbuminuria in NIDDM. Kidney International 48:6, 1907-1911
CrossRef156
Daniel E. Weeks, G.Mark Lathrop. (1995) Polygenic disease: methods for mapping complex disease traits. Trends in Genetics 11:12, 513-519
CrossRef157
Alessandro Doria, James H. Warram, Andrzej S. Krolewski. (1995) Genetic susceptibility to nephropathy in insulin-dependent diabetes: From epidemiology to molecular genetics. Diabetes / Metabolism Reviews 11:4, 287-314
CrossRef158
Akira Hata. (1995) Role of angiotensinogen in the genetics of essential hypertension. Life Sciences 57:26, 2385-2395
CrossRef159
Postma, Dirkje S., Bleecker, Eugene R., Amelung, Pamela J., Holroyd, Kenneth J., Xu, Jianfeng, Panhuysen, Carolien I.M., Meyers, Deborah A., Levitt, Roy C., . (1995) Genetic Susceptibility to Asthma — Bronchial Hyperresponsiveness Coinherited with a Major Gene for Atopy. New England Journal of Medicine 333:14, 894-900
Full Text160
Robert Roberts. (1995) Molecular genetics: Cardiac disease and risk-related genes-Genetic risk factors. Clinical Cardiology 18:S4, IV13-IV19
CrossRef161
Kimiko Yamakawa-Kobayashi, Tadao Arinami, Hideo Hamaguchi. (1995) Absence of association of angiotensinogen gene T235 allele with increased risk of coronary heart disease in Japanese. The Lancet 346:8973, 515
CrossRef162
K. K. Wong, K. M. Summers, D. J. Burstow, M. J. West. (1995) ANGIOTENSIN-CONVERTING ENZYME AND ANGIOTENSINOGEN GENES IN PATTERNS OF LEFT VENTRICULAR HYPERTROPHY AND IN DIASTOLIC DYSFUNCTION. Clinical and Experimental Pharmacology and Physiology 22:6-7, 438-440
CrossRef163
Jörg Peters. (1995) Molecular basis of human hypertension: The role of angiotensin. Baillière's Clinical Endocrinology and Metabolism 9:3, 657-678
CrossRef164
T. Katsuya, G. Koike, M. Horiuchi, R.E. Pratt, V.J. Dzau, T.W. Yee, N. Sharpe, S. MacMahon, R. Jackson, R. Norton. (1995) Association of angiotensinogen gene T235 variant with increased risk of coronary heart disease. The Lancet 345:8965, 1600-1603
CrossRef165
Marc Thibonnier, Nicholas J Schork. (1995) The genetics of hypertension. Current Opinion in Genetics & Development 5:3, 362-370
CrossRef166
Conrad Sernia. (1995) Location and secretion of brain angiotensinogen. Regulatory Peptides 57:1, 1-18
CrossRef167
Wolfgang Kübler. (1995) Cardioprotection and cardiovascular reparation by ACE inhibition?. Clinical Cardiology 18:S2, I-1-I-2
CrossRef168
Sandford Skinner, Jacob Bouhnik, Huaming Huang, Marie-Françoise Gonzalez, Joël Ménard, Pierre Corvol. (1995) Plasma Angiotensin in Binephrectomised Mice. Clinical and Experimental Hypertension 17:5, 847-860
CrossRef169
Y. M. Pinto, H. Buikema, W. H. Van Gilst. (1995) Hyperactive Tissue Renin-Angiotensin Systems in Cardiovascular Dysfunction: Experimental Evidence and Clinical Hypotheses. Clinical and Experimental Hypertension 17:3, 441-468
CrossRef170
Frank K Fujimura. (1994) Diagnosis and the new genetics. Current Opinion in Biotechnology 5:6, 654-662
CrossRef171
(1994) Linkage of the Angiotensinogen Gene to Essential Hypertension. New England Journal of Medicine 331:16, 1096-1097
Full Text172
Lindpaintner, Klaus, . (1994) Genes, Hypertension, and Cardiac Hypertrophy. New England Journal of Medicine 330:23, 1678-1679
Full Text
