Original Article
A Subtype of Diabetes Mellitus Associated with a Mutation of Mitochondrial DNA
N Engl J Med 1994; 330:962-968April 7, 1994
- Abstract
Background
Several families have been described in which a mutation of mitochondrial DNA, the substitution of guanine for adenine (A-to-G) at position 3243 of leucine transfer RNA, is associated with diabetes mellitus and deafness. The prevalence, clinical features, and pathophysiology of diabetes with this mutation are largely undefined.
Methods
We studied 55 patients with insulin-dependent diabetes mellitus (IDDM) and a family history of diabetes (group 1), 85 patients with IDDM and no family history of diabetes (group 2), 100 patients with non-insulin-dependent diabetes mellitus (NIDDM) and a family history of diabetes (group 3), and 5 patients with diabetes and deafness (group 4) for the mutation. We also studied the prevalence and characteristics of diabetes in 39 patients with a syndrome consisting of mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes who were known to have the mutation and 127 of their relatives (group 5).
Results
We identified 16 unrelated patients with diabetes associated with the A-to-G mutation: 3 patients from group 1 (6 percent), 2 patients from group 3 (2 percent), 3 patients from group 4 (60 percent), and 8 patients from group 5 (21 percent). We also identified 16 additional subjects who had diabetes and the mutation among 42 relatives of the patients with diabetes and the mutation in groups 1, 2, 3, and 4 and 20 affected subjects among the 127 relatives of the patients in group 5. Diabetes cosegregated with the mutation in a fashion consistent with maternal transmission, was frequently (in 61 percent of cases) associated with sensory hearing loss, and was generally accompanied by impaired insulin secretion.
Conclusions
Diabetes mellitus associated with the A-to-G mutation at position 3243 of mitochondrial leucine transfer RNA represents a subtype of diabetes found in both patients with IDDM and patients with NIDDM in Japan.
Media in This Article
Figure 1
Identification of an A-to-G Mutation at Position 3243 of Mitochondrial Leucine tRNA.Figure 2
Pedigrees of Nine Families with Diabetes Mellitus and the A to G Mutation at Position 3243.Article Activity
- Article
Diabetes mellitus is one of the most common chronic disorders, affecting as many as 5 to 10 percent of persons in both Japan and Western countries1. Both types of diabetes mellitus -- insulin-dependent (IDDM) and non-insulin-dependent (NIDDM) -- are heterogeneous disorders, and several mechanisms have been implicated in their causes. These include autoimmune destruction of pancreatic β cells in IDDM and mutations in the insulin gene, the insulin-receptor gene,2,3 a gene linked to the adenosine deaminase gene on chromosome 20,4 and the glucokinase gene5,6 in NIDDM. Although defects in both glucose-induced insulin secretion and peripheral insulin sensitivity are generally thought to contribute to the pathogenesis of NIDDM,7 many patients with NIDDM in Japan have decreased insulin responses to glucose even during the preclinical period8; however, the prevalence of mutations in the glucokinase gene appears to be low9. Mitochondrial genes are plausible causative agents of both IDDM and NIDDM, since it has been suggested that oxidative phosphorylation in the mitochondria has a crucial role in the secretion of insulin by pancreatic β cells in response to glucose and other nutrients10. Normal mitochondrial DNA is a circular molecule of 16,569 base pairs (bp) that contains 37 genes encoding 22 types of transfer RNA (tRNA), 2 types of ribosomal RNA, and 13 enzymes involved in oxidative phosphorylation11.
Recently, several case reports12-15 suggested that mutations in mitochondrial DNA, especially one involving the substitution of guanine for adenine (A-to-G) at position 3243 of leucine tRNA,13-15 may cause diabetes and deafness. This mutation occurs within the mitochondrial DNA binding site for a protein factor that promotes the termination of transcription at the boundary between the 16S ribosomal RNA and tRNA Leu(UUR) genes. This mutation appears to interfere not only with the synthesis of tRNA Leu(UUR) but also with the binding of the transcription termination factor, thereby causing defects in the synthesis of mitochondrial proteins16. The prevalence, clinical characteristics, and pathophysiologic process of diabetes associated with the A-to-G mutation at position 3243 are largely unknown. In this study, we identified 22 families (52 patients) with the mutation and diabetes and examined the clinical features of this subtype of diabetes.
Methods
Families
We studied 55 patients with IDDM and a history of diabetes (either IDDM or NIDDM) in first-degree relatives (group 1), 85 patients with IDDM and no family history of diabetes (group 2), and 100 patients with NIDDM and a history of diabetes in first-degree relatives (group 3)9. The patients were recruited from the outpatient clinic of the Institute for Diabetes Care and Research of the Asahi Life Foundation. Five patients with diabetes and hearing loss (three of whom had a family history of these problems) were referred to us for testing for the mutation (group 4). The 245 patients were all unrelated. We studied 42 relatives of the patients in the four groups who were found to have the mutation. We also studied 39 unrelated patients with a syndrome consisting of mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) who were known to have the mutation and 127 of their relatives (group 5). Questionnaires or direct examination of the patients and their relatives was used to ascertain the presence of diabetes, the type of diabetes, the treatment regimen, and insulin secretory capacity, as well as to determine whether associated symptoms such as sensory hearing loss, muscle weakness, ophthalmoplegia, and mental retardation were present. The diagnosis of diabetes in these subjects was based on the criteria of the World Health Organization,1 and ketosis-prone patients were defined as having clinical IDDM. The study was approved by the appropriate institutional review committees, and all subjects gave informed consent.
Molecular Studies
DNA was prepared from peripheral-blood leukocytes. Fragments of mitochondrial DNA encompassing position 3243 were amplified with the polymerase chain reaction (PCR). The forward primer was 5'AGGACAAGAGAAATAAGGCC3', covering positions 3130 to 3149, and the reverse primer was 5'CACGTTGGGGCCTTTGCGTA3', covering positions 3423 through 340417. The resultant 294-bp fragments of mitochondrial DNA (3130 through 3423) were digested with a restriction endonuclease, ApaI, and analyzed by agarose-gel (0.8 percent) electrophoresis. The PCR products were either sequenced directly18 or subcloned into a plasmid vector and then sequenced.
Insulin Secretory Capacity and Euglycemic-Clamp Studies
Insulin secretory capacity was evaluated by measurements of plasma insulin or C-peptide concentrations during a 75-g oral glucose-tolerance test or after the intravenous administration of glucagon (1 mg) or by measurements of C peptide in a 24-hour urine sample. Peripheral uptake of glucose (mainly by skeletal muscle) was measured in one patient with IDDM and one patient with NIDDM, both of whom had the mutation, during a euglycemic-hyperinsulinemic clamp study19.
Statistical Analysis
Continuous variables were compared by Student's t-test, and categorical variables were compared by chi-square analysis. All P values are two-tailed.
Results
Identification of the Mutation
We identified an A-to-G mutation at position 3243 of mitochondrial leucine tRNA in 16 of the patients from groups 1 through 5 (Figure 1Figure 1
Identification of an A-to-G Mutation at Position 3243 of Mitochondrial Leucine tRNA.). Figure 1A shows the sequences encompassing position 3243 in normal and mutant mitochondrial DNA from one patient (Subject II-2 in Family 2). This means that the patient is heteroplasmic for the mutation. This A-to-G transition created a recognition site for the restriction endonuclease ApaI (GAGCCC to GGGCCC). Digestion of mitochondrial DNA with ApaI revealed that affected subjects are heteroplasmic for the mutation (Figure 1B). This mutation was not found in 200 normal subjects with no family history of diabetes. In group 1, 3 of the 55 patients (6 percent) had this mutation; in group 2, 0 of 85 patients; in group 3, 2 of 100 patients (2 percent); in group 4, 3 of 5 patients (60 percent); and in group 5, 8 of 39 patients (21 percent). We identified 16 additional subjects with diabetes and the mutation in our study of 42 relatives of the patients in groups 1, 2, 3, and 4, and 20 additional subjects with diabetes and the mutation in our study of 127 relatives of the patients in group 5. Thus, we identified 52 patients with diabetes mellitus in 22 unrelated families who had the mutation (Table 1Table 1
Characteristics of the Families with Diabetes Mellitus Associated with the A to G Mutation at Position 3243 of Mitochondrial Leucine tRNA.).Representative Families with Diabetes and the Mutation
The pedigrees of nine representative families with diabetes and the mutation are shown in Figure 2Figure 2
Pedigrees of Nine Families with Diabetes Mellitus and the A to G Mutation at Position 3243.. A preliminary description of Family 1 has been reported15.Family 2
The proband in Family 2 (Subject II-2) was identified during screening for the mutation in group 1. He was given a diagnosis of diabetes after an oral glucose-tolerance test at the age of 13 years, and he started taking insulin at the age of 17, when he became prone to ketoacidosis. His insulin secretory capacity was considered to be low on the basis of low urinary C-peptide excretion (7 to 13 μg per day [2.3 to 4.3 nmol per day]) and a low plasma C-peptide response to glucagon injection (Table 2Table 2
Insulin Secretory Capacity of Pancreatic β Cells in Patients with Diabetes Associated with the A to G Mutation at Position 3243 of Mitochondrial Leucine tRNA.). Although he was given a diagnosis of slowly progressive IDDM,20 a test for islet-cell antibodies was negative. He began to have sensory hearing loss at the age of 29 years. His mother (Subject I-2), sister (Subject II-1), and uncle (Subject I-3) had the mutation and insulin-requiring NIDDM with low insulin secretion (Table 2) and sensory hearing loss. The proband's father (Subject I-1), who did not have the mutation, had normal glucose tolerance.Family 3
The proband in Family 3 (Subject II-2) was also identified during screening for the mutation in group 1. He had been prone to ketosis since the age of 24 years unless treated with insulin and had recently had mild sensory hearing loss. His urinary C-peptide excretion was low (19 μg per day [6.3 nmol per day]) (Table 2). His mother (Subject I-2), who also had the mutation, had NIDDM and was being treated with an oral hypoglycemic agent but did not have a hearing loss. Neither of his sons (Subjects III-1 and III-2) had the mutation or diabetes.
Family 5
The proband in Family 5 (Subject III-1) was identified during screening for the mutation in group 3. She was given a diagnosis of NIDDM at the age of 36 years and was treated with an oral hypoglycemic agent until the age of 44, when she started taking insulin. She had no hearing loss. Her insulin secretory capacity was low (Table 2). Her mother (Subject II-3), two uncles (Subjects II-1 and II-5), and grandmother (Subject I-2) had diabetes, and her mother and one of her uncles had sensory hearing loss.
Family 10
The proband in Family 10 (Subject II-2) had the MELAS syndrome with the mutation (group 5) but did not have diabetes. His mother (Subject I-2) and sister (Subject II-1) had the mutation and diabetes and were being treated with insulin. Neither had the MELAS syndrome, but both had sensory hearing loss and short stature.
Family 13
The proband in Family 13 (Subject III-1) had the MELAS syndrome and the mutation (group 5) but not diabetes. His mother (Subject II-3) and his aunt (Subject II-1) had insulin-requiring NIDDM, and his mother also had sensory hearing loss. The proband's grandmother (Subject I-2) had NIDDM. The offspring (Subject II-4) of the proband's grandmother with a different partner (Subject I-3) also had insulin-requiring NIDDM. None of the family members except the proband had the MELAS syndrome.
Clinical Characteristics of Patients with Diabetes and the Mutation
In these families, diabetes is apparently transmitted maternally. Thus, diabetes and the A-to-G mutation at position 3243 were transmitted by the mother (for example, see Families 1, 2, 3, 4, 5, 10, 12, and 13 in Figure 2), not by the father. The men with diabetes and the mutation transmitted neither diabetes nor the mutation to their offspring (for example, see Families 3 and 12 in Figure 2). Twenty-seven of the 52 patients with diabetes and the mutation (52 percent) were treated with insulin. Among 44 patients with diabetes but not the MELAS syndrome, 24 (55 percent) were treated with insulin. Before the identification of the mutation, patients with diabetes and the mutation were often given a diagnosis of IDDM or insulin-deficient NIDDM on the basis of the development of ketoacidosis unless insulin was given and their endogenous insulin secretory capacity (Table 2). Some of these patients were given a diagnosis of slowly progressive IDDM20 because there was a lag (2 to 20 years) between the diagnosis of diabetes and the initiation of insulin therapy. However, tests for islet-cell antibodies were not positive in any of the four patients with IDDM with the mutation who were tested (Table 1). Thirty-three of the 52 patients with diabetes (63 percent), including 27 of 44 patients with diabetes who did not have the MELAS syndrome, had hearing loss. The hearing loss often developed after the onset of diabetes. However, only the probands of the families with a history of the MELAS syndrome had other neuromuscular symptoms.
We compared the clinical characteristics of the 44 patients with diabetes associated with the mutation who did not have the MELAS syndrome with those of the 52 patients with IDDM in group 1 without the mutation and the 98 patients with NIDDM in group 3 without the mutation (Table 3Table 3
Clinical Characteristics of Patients with Diabetes and the Mutation but Not the MELAS Syndrome, Patients with IDDM and a Family History of Diabetes but Not the Mutation, and Patients with NIDDM and a Family History of Diabetes but Not the Mutation.). As compared with the patients in group 1 who had diabetes without the mutation, the patients with diabetes and the mutation were more likely to have a hearing loss and a mother with diabetes and less likely to have a father with diabetes. Similarly, as compared with the patients in group 3 with NIDDM without the mutation, the patients with diabetes and the mutation were more likely to have a mother with diabetes, were younger at the time of diagnosis, had a lower frequency of obesity in the past, had a higher frequency of treatment with insulin, and had a higher frequency of hearing loss.Insulin Secretory Capacity and Peripheral Insulin Resistance
Insulin secretory capacity was studied in 13 families (19 patients) with the mutation (Table 2). Urinary C-peptide excretion in these patients was low (mean ±SD, 24 ±15 μg per day [7.9 ±5.0 nmol per day]; normal range, 60 to 120 μg per day [20 to 40 nmol per day]). In three patients studied repeatedly, urinary C-peptide excretion progressively decreased (data not shown). The plasma insulin and C-peptide concentrations were subnormal after the administration of glucagon, although the response was not abolished.
Euglycemic-clamp studies were performed in one patient with IDDM and one patient with NIDDM from Family 115. Peripheral uptake of glucose was not significantly impaired in these patients (9.9 mg per kilogram of body weight per minute [55.0 μmol per kilogram per minute] and 8.6 mg per kilogram per minute [47.7 μmol per kilogram per minute], respectively; normal value, 10.5 ±4.4 mg per kilogram per minute [58.3 ±24.4 μmol per kilogram per minute]).
Discussion
We found that the A-to-G mutation at position 3243 in mitochondrial DNA may be associated with either IDDM or NIDDM in Japan. The mutation appears to be the cause of diabetes in affected families, since the disease is inherited maternally and cosegregated with the mutation. Patients with diabetes and the mutation may have sensory hearing loss, which often develops after the onset of diabetes, and they are younger at diagnosis, have a lower frequency of obesity in the past, and more often need insulin than diabetic patients without the mutation.
Patients with diabetes and the mutation have impaired insulin secretion, and this impairment probably has an important role in the development of diabetes. One patient with IDDM and one patient with NIDDM who had the mutation had apparently normal glucose uptake. In findings consistent with our results, Reardon et al.14 described two patients with the mutation who had poor insulin secretory responses to glucose. In contrast, van den Ouweland et al.13 reported that insulin secretion was apparently normal in affected patients, suggesting the pathogenic importance of peripheral insulin resistance. It is likely that the mechanisms whereby the mutation causes diabetes are heterogeneous.
How might this mutation cause dysfunction of pancreatic β cells? Since oxidative phosphorylation in the mitochondria may have an important role in insulin secretion,10 mutant mitochondrial DNA in the pancreatic β cells may interfere with the normal process of insulin secretion.
The tRNA Leu(UUR) mutation at position 3243 was originally identified in heteroplasmic form in patients with the MELAS syndrome17. It is noteworthy that in the families we studied some of the patients who had the mutation had diabetes (and deafness) without the MELAS syndrome and other family members with the mutation had the MELAS syndrome without diabetes (Families 10, 12, and 13). In this respect, the degree of heteroplasmy is reported to differ in various tissues and various persons (even in a single family)11. Thus, it is tempting to speculate that the fraction of abnormal mitochondria with the mutation is relatively high in pancreatic β cells, liver cells, muscle cells, or some combination of these cells in patients with diabetes and in nerve and muscle cells in patients with the MELAS syndrome. It is also possible that patients with IDDM or insulin-deficient NIDDM have a higher fraction of abnormal mitochondria in pancreatic β cells than patients with NIDDM with apparently normal insulin secretion,13 even though they share the same mutation.
Although IDDM is generally thought to be an autoimmune disorder, the mutation in the mitochondrial gene may represent another cause of IDDM. Moreover, although IDDM and NIDDM were thought to be distinct clinical entities, our results suggest that a common diabetogenic gene such as the A-to-G mutation at position 3243 of mitochondrial leucine tRNA may cause either IDDM or NIDDM, indicating overlap between these two entities.
In summary, we have described a subtype of diabetes associated with a mutation in mitochondrial DNA in patients with either IDDM or NIDDM in Japan. Mutations in mitochondrial DNA such as the A-to-G mutation at position 3243 should be considered as a cause of (slowly progressive) IDDM and insulin-deficient NIDDM, especially in patients with sensory hearing loss or a mother with diabetes.
Supported by a grant from the Juvenile Diabetes Foundation International (192125), a grant from the Ministry of Health and Welfare of Japan, and a Diabetes Research Grant from Otsuka Pharmaceutical Company (to Dr. T. Kadowaki).
We are indebted to Drs. Kazuki Yasuda and Simeon I. Taylor for useful comments; to Dr. Masato Kasuga, Dr. Kinori Kosaka, Dr. Takeshi Kuzuya, Dr. Yasunori Kanazawa, Dr. Kimitaka Kaga, Dr. Makiko Kaga, and Ms. Teruko Yoshida for encouragement throughout the study; and to Drs. Nozomi Akashi, Takahiro Iizuka, Takashi Ichiki, Jin Kaneko, Tatsuro Sato, and Kazumasa Shindo for referring patients to the study or providing information about them.
Source Information
From the Third Department of Internal Medicine, Faculty of Medicine, University of Tokyo, Tokyo (T. Kadowaki, Y.M., K.T., H.S., T.H., Y.Y.); the Institute for Diabetes Care and Research, Asahi Life Foundation, Tokyo (H.K., R.H., Y.A.); the Division of Ultrastructural Research, National Institute of Neuroscience, Kodaira (R.S., Y.G., I.N.); Chiba Children's Hospital, Chiba (Y.T.); the Department of Endocrinology and Metabolism, Jichi Medical School, Minamikawachi (T.A.); Saiseikai Central Hospital, Tokyo (Y.S., K.M.); the First Department of Internal Medicine, Osaka University Medical School, Osaka (R.K., T. Kamada); and the National Institute of Genetics, Mishima (S.H.) -- all in Japan.
Address reprint requests to Dr. T. Kadowaki at the Third Department of Internal Medicine, Faculty of Medicine, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113, Japan.
- References
References
1
Diabetes mellitus: report of a WHO Study Group
Medline2
Taylor SI . Molecular mechanisms of insulin resistance: lessons from patients with mutations in the insulin-receptor gene. Diabetes 1992;41:1473-1490
CrossRef | Web of Science | Medline3
Kadowaki T ,Bevins CL ,Cama A , et al. Two mutant alleles of the insulin receptor gene in a patient with extreme insulin resistance. Science 1988;240:787-790
CrossRef | Web of Science | Medline4
Bell GI ,Xiang KS ,Newman MV , et al. Gene for non-insulin-dependent diabetes mellitus (maturity-onset diabetes of the young subtype) is linked to DNA polymorphism on human chromosome 20q. Proc Natl Acad Sci U S A 1991;88:1484-1488
CrossRef | Web of Science | Medline5
Froguel P ,Vaxillaire M ,Sun F , et al. Close linkage of glucokinase locus on chromosome 7p to early-onset non-insulin-dependent diabetes mellitus. Nature 1992;356:162-164[Erratum, Nature 1992;357:607.]
CrossRef | Web of Science | Medline6
Froguel P ,Zouali H ,Vionnet N , et al. Familial hyperglycemia due to mutations in glucokinase: definition of a subtype of diabetes mellitus. N Engl J Med 1993;328:697-702
Full Text | Web of Science | Medline7
DeFronzo RA ,Bonadonna RC ,Ferrannini E . Pathogenesis of NIDDM: a balanced overview. Diabetes Care 1992;15:318-368
CrossRef | Web of Science | Medline8
Kadowaki T ,Miyake Y ,Hagura R , et al. Risk factors for worsening to diabetes in subjects with impaired glucose tolerance. Diabetologia 1984;26:44-49
CrossRef | Web of Science | Medline9
Eto K ,Sakura H ,Shimokawa K , et al. Sequence variations of the glucokinase gene in Japanese subjects with NIDDM. Diabetes 1993;42:1133-1137
CrossRef | Web of Science | Medline10
Ashcroft FM, Ashcroft SJH. Mechanism of insulin secretion. In: Ashcroft FM, Ashcroft SJH, eds. Insulin: molecular biology to pathology. Oxford, England: Oxford University Press, 1992:97-150.
11
Wallace DC . Mitochondrial genetics: a paradigm for aging and degenerative diseases? Science 1992;256:628-632
CrossRef | Web of Science | Medline12
Ballinger SW ,Shoffner JM ,Hedaya EV , et al. Maternally transmitted diabetes and deafness associated with a 10.4 kb mitochondrial DNA deletion. Nat Genet 1992;1:11-15
CrossRef | Web of Science | Medline13
van den Ouweland JMW ,Lemkes HHPJ ,Ruitenbeek W , et al. Mutation in mitochondrial tRNALeu(UUR) gene in a large pedigree with maternally transmitted type II diabetes mellitus and deafness. Nat Genet 1992;1:368-371
CrossRef | Web of Science | Medline14
Reardon W ,Ross RJM ,Sweeney MG , et al. Diabetes mellitus associated with a pathogenic point mutation in mitochondrial DNA. Lancet 1992;340:1376-1379
CrossRef | Web of Science | Medline15
Kadowaki H ,Tobe K ,Mori Y , et al. Mitochondrial gene mutation and insulin-deficient type of diabetes mellitus. Lancet 1993;341:893-894
CrossRef | Web of Science | Medline16
Chomyn A ,Martinuzzi A ,Yoneda M , et al. MELAS mutation in mtDNA binding site for transcription termination factor causes defects in protein synthesis and in respiration but no change in levels of upstream and downstream mature transcripts. Proc Natl Acad Sci U S A 1992;89:4221-4225
CrossRef | Web of Science | Medline17
Goto Y ,Nonaka I ,Horai S . A mutation in the tRNALeu(UUR) gene associated with the MELAS subgroup of mitochondrial encephalomyopathies. Nature 1990;348:651-653
CrossRef | Web of Science | Medline18
Kadowaki T ,Kadowaki H ,Taylor SI . A nonsense mutation causing decreased levels of insulin receptor mRNA: detection by a simplified technique for direct sequencing of genomic DNA amplified by the polymerase chain reaction. Proc Natl Acad Sci U S A 1990;87:658-662
CrossRef | Web of Science | Medline19
Kawamori R ,Kubota M ,Ikeda M , et al. Quantitative determination of hepatic glucose uptake using an innovative approach: effect of strict glycemic regulation and exercise in diabetic subjects. J Nutr Sci Vitaminol (Tokyo) 1991;37:Suppl:S35-S42
CrossRef | Web of Science | Medline20
Kobayashi T ,Itoh T ,Kosaka K ,Sato K ,Tsuji K . Time course of islet cell antibodies and β-cell function in non-insulin-dependent stage of type I diabetes. Diabetes 1987;36:510-517
CrossRef | Web of Science | Medline
- Citing Articles (191)
Citing Articles
1
Megu Yamaguchi Baden, Yuya Yamada, Yasumitsu Takahi, Yoshinari Obata, Kenji Saisho, Sachiko Tamba, Koji Yamamoto, Jun Muratsu, Atsuyuki Morishima, Katsuhiko Sakaguchi, Yuji Matsuzawa. (2011) A case of mitochondrial kidney disease with insulin resistance and hypoadiponectinemia. Diabetology International
CrossRef2
Yun Yong Lee, Hwa-Jung Lee, Seung-Sook Lee, Jae Soo Koh, Cheng Ji Jin, Sung-Hye Park, Ka Hi Yi, Kyong Soo Park, Hong Kyu Lee. (2011) Taurine supplementation restored the changes in pancreatic islet mitochondria in the fetal protein-malnourished rat. British Journal of Nutrition 106:08, 1198-1206
CrossRef3
Carmelina Gurrieri, Jonathon E. Kivela, Katarina Bojanić, Ralitza H. Gavrilova, Randall P. Flick, Juraj Sprung, Toby N. Weingarten. (2011) Anesthetic considerations in mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes syndrome: a case series. Canadian Journal of Anesthesia/Journal canadien d'anesthésie 58:8, 751-763
CrossRef4
Octavian Savu, Vivekananda Gupta Sunkari, Ileana Ruxandra Botusan, Jacob Grünler, Andrej Nikoshkov, Sergiu-Bogdan Catrina. (2011) Stability of mitochondrial DNA against reactive oxygen species (ROS) generated in diabetes. Diabetes/Metabolism Research and Reviews 27:5, 470-479
CrossRef5
Sebastian Preißl, Inga Bick, Petr Obrdlik, Kerstin Diekert, Sheraz Gul, Philip Gribbon. (2011) Development of an Assay for Complex I/Complex III of the Respiratory Chain Using Solid Supported Membranes and Its Application in Mitochondrial Toxicity Screening in Drug Discovery. ASSAY and Drug Development Technologies 9:2, 147-156
CrossRef6
Salvatore DiMauro. (2011) A history of mitochondrial diseases. Journal of Inherited Metabolic Disease 34:2, 261-276
CrossRef7
Kristin M Santa. (2010) Treatment Options for Mitochondrial Myopathy, Encephalopathy, Lactic Acidosis, and Stroke-Like Episodes (MELAS) Syndrome. Pharmacotherapy 30:11, 1179-1196
CrossRef8
Soo Heon Kwak, Kyong Soo Park, Ki-Up Lee, Hong Kyu Lee. (2010) Mitochondrial metabolism and diabetes. Journal of Diabetes Investigation 1:5, 161-169
CrossRef9
Salvatore DiMauro, Caterina Garone. (2010) Historical perspective on mitochondrial medicine. Developmental Disabilities Research Reviews 16:2, 106-113
CrossRef10
Elena García, Jesús Luis Macarrón, Laura de la Maza, Sara Jiménez, Ana Cabello, Miguel Angel Martín, Enrique Ruíz. (2010) Diabetes and Mitochondrial Encephalomyopathy. The Endocrinologist 20:3, 105-108
CrossRef11
I. Fromont, F. Nicoli, R. Valéro, O. Felician, B. Lebail, Y. Lefur, J. Mancini, V. Paquis-Flucklinger, P. J. Cozzone, Bernard Vialettes. (2009) Brain anomalies in maternally inherited diabetes and deafness syndrome. Journal of Neurology 256:10, 1696-1704
CrossRef12
Nóra Hosszúfalusi, Veronika Karcagi, Rita Horváth, Éva Palik, Judit Várkonyi, Katalin Rajczy, Zoltán Prohászka, Csaba Szentirmai, István Karádi, László Romics, Pál Pánczél. (2009) A detailed investigation of maternally inherited diabetes and deafness (MIDD) including clinical characteristics, C-peptide secretion, HLA-DR and -DQ status and autoantibody pattern. Diabetes/Metabolism Research and Reviews 25:2, 127-135
CrossRef13
Tae Su Han, Jee-Hye Choi, Jina Park, Kwang-Ho Lee, Ae Ja Park. (2009) Genetic Association of Mitochondrial DNA Polymorphisms with Type 2 Diabetes Mellitus. Korean Diabetes Journal 33:5, 382
CrossRef14
Maciej T. Malecki, Wojciech Mlynarski, Jan Skupien. (2008) Can geneticists help clinicians to understand and treat non-autoimmune diabetes?. Diabetes Research and Clinical Practice 82, S83-S93
CrossRef15
J.-F. Louet, S. B. Smith, J.-F. Gautier, M. Molokhia, M.-L. Virally, J.-P. Kevorkian, P.-J. Guillausseau, P. Vexiau, G. Charpentier, M. S. German, C. Vaisse, M. Urbanek, F. Mauvais-Jarvis. (2008) Gender and neurogenin3 influence the pathogenesis of ketosis-prone diabetes. Diabetes, Obesity and Metabolism 10:10, 912-920
CrossRef16
F. Sasarman, H. Antonicka, E. A. Shoubridge. (2008) The A3243G tRNALeu(UUR) MELAS mutation causes amino acid misincorporation and a combined respiratory chain assembly defect partially suppressed by overexpression of EFTu and EFG2. Human Molecular Genetics 17:23, 3697-3707
CrossRef17
Maciej T. Malecki, Wojciech Mlynarski. (2008) Monogenic diabetes: implications for therapy of rare types of disease. Diabetes, Obesity and Metabolism 10:8, 607-616
CrossRef18
R. Murphy, D. M. Turnbull, M. Walker, A. T. Hattersley. (2008) Clinical features, diagnosis and management of maternally inherited diabetes and deafness (MIDD) associated with the 3243A>G mitochondrial point mutation. Diabetic Medicine 25:4, 383-399
CrossRef19
Jun Takeuchi, Jun Tashiro, Osamu Nakagaki, Masahiro Yoshida, Hikaru Kamoshima, Kenji Oku, Narihito Yoshioka. (2008) A case of maternally inherited diabetes with deafness (MIDD) occurring at an advanced age. Nippon Ronen Igakkai Zasshi. Japanese Journal of Geriatrics 45:1, 95-99
CrossRef20
Andrew M. Schaefer, Robert McFarland, Emma L. Blakely, Langping He, Roger G. Whittaker, Robert W. Taylor, Patrick F. Chinnery, Douglass M. Turnbull. (2008) Prevalence of mitochondrial DNA disease in adults. Annals of Neurology 63:1, 35-39
CrossRef21
K. G. Bensch, W. deGraaf, P. A. Hansen, H. P. Zassenhaus, J. A. Corbett. (2007) A transgenic model to study the pathogenesis of somatic mtDNA mutation accumulation in ?-cells. Diabetes, Obesity and Metabolism 9:s2, 74-80
CrossRef22
Seung Y. Park, Wan Lee. (2007) The depletion of cellular mitochondrial DNA causes insulin resistance through the alteration of insulin receptor substrate-1 in rat myocytes. Diabetes Research and Clinical Practice 77:3, S165-S171
CrossRef23
Johanna Uusimaa, Jukka S. Moilanen, Leena Vainionpää, Päivi Tapanainen, Päivi Lindholm, Matti Nuutinen, Tuija Löppönen, Elina Mäki-Torkko, Heikki Rantala, Kari Majamaa. (2007) Prevalence, segregation, and phenotype of the mitochondrial DNA 3243A>G mutation in children. Annals of Neurology 62:3, 278-287
CrossRef24
Cabot, Richard C.Harris, Nancy Lee, Shepard, Jo-Anne O., Rosenberg, Eric S., Cort, Alice M., Ebeling, Sally H.Peters, Christine C., Greer, David M., Cagliero, Enrico, Krakauer, Eric L., Gonzalez, R. Gilberto, Hedley-Whyte, E. Tessa, . (2007) Case 21-2007. New England Journal of Medicine 357:2, 164-173
Full Text25
Amit Kochhar, Michael S. Hildebrand, Richard J. H. Smith. (2007) Clinical aspects of hereditary hearing loss. Genetics in Medicine 9:7, 393-408
CrossRef26
H Kokotas, MB Petersen, PJ Willems. (2007) Mitochondrial deafness. Clinical Genetics 71:5, 379-391
CrossRef27
Enikő Sáfrány, Veronika Csöngei, Luca Járomi, Anita Maász, Lili Magyari, Csilla Sipeky, Béla Melegh. (2007) A mitokondriális DNS és mutációi: újabb ismeretek egy új területen. Orvosi Hetilap 148:21, 971-978
CrossRef28
Takeshi Nishikawa, Eiichi Araki. (2007) Impact of Mitochondrial ROS Production in the Pathogenesis of Diabetes Mellitus and Its Complications. Antioxidants & Redox Signaling 9:3, 343-353
CrossRef29
Eiichi Araki, Jun-Ichi Miyazaki. (2007) Metabolic Disorders in Diabetes Mellitus: Impact of Mitochondrial Function and Oxidative Stress on Diabetes and Its Complications. Antioxidants & Redox Signaling 9:3, 289-291
CrossRef30
Tadafumi Kato, Mie Kubota, Takaoki Kasahara. (2007) Animal models of bipolar disorder. Neuroscience & Biobehavioral Reviews 31:6, 832-842
CrossRef31
Fumiko Kojima, Madoka Saitou, Mio Ueda, Masako Yasuda, Osamu Tomonaga, Yoshiko Tanaka, Kousaku Nitta, Takashi Akiba. (2007) Acetate-free biofiltration was effective for the control of lactic acidosis in hemodialysis patient with mitochondrial disease. Nihon Toseki Igakkai Zasshi 40:3, 287-293
CrossRef32
Jo??o Eduardo Salles, Teresa S. Kasamatsu, S??rgio A. Dib, Regina S. Mois??s. (2007) ??-Cell Function in Individuals Carrying the Mitochondrial tRNA Leu (UUR) Mutation. Pancreas 34:1, 133-137
CrossRef33
Eiichi Araki, Jun-Ichi Miyazaki. (2006) Metabolic Disorders in Diabetes Mellitus: Impact of Mitochondrial Function and Oxidative Stress on Diabetes and Its Complications. Antioxidants & Redox Signaling 0:0, 061221112325005
CrossRef34
Takeshi Nishikawa, Eiichi Araki. (2006) Impact of Mitochondrial ROS Production in the Pathogenesis of Diabetes Mellitus and Its Complications. Antioxidants & Redox Signaling 0:0, 061221112325010
CrossRef35
Guy A. Rutter, Takashi Tsuboi, Magalie A. Ravier. (2006) Ca2+ microdomains and the control of insulin secretion. Cell Calcium 40:5-6, 539-551
CrossRef36
Fernando Scaglia, Chang-Hung Hsu, Haeyoung Kwon, Ren-Kui Bai, Cherng-Lih Perng, Hua-Mei Chang, Pu Dai, E O??Brian Smith, David A. H. Whiteman, Annette Feigenbaum, Andrea Gropman, Lee-Jun C. Wong. (2006) Molecular bases of hearing loss in multi-systemic mitochondrial cytopathy. Genetics in Medicine 8:10, 641-652
CrossRef37
Jianxin Lu, Dawang Wang, Ronghua Li, Weixing Li, Jingzhang Ji, Jing Zhao, Wei Ye, Li Yang, Yaping Qian, Yi Zhu, Min-Xin Guan. (2006) Maternally transmitted diabetes mellitus associated with the mitochondrial tRNALeu(UUR) A3243G mutation in a four-generation Han Chinese family. Biochemical and Biophysical Research Communications 348:1, 115-119
CrossRef38
Sakae Nohara, Masanori Iwase, Hirofumi Imoto, Nobuhiro Sasaki, Udai Nakamura, Yuji Uchizono, Saori Abe, Yasufumi Doi, Mitsuo Iida. (2006) Gastric emptying in patients with Type 2 diabetes mellitus and diabetes associated with mitochondrial DNA 3243 mutation using 13C-octanoic acid breath test. Journal of Diabetes and its Complications 20:5, 295-301
CrossRef39
P. B. M. Andrade, B. Rubi, F. Frigerio, J. M. W. Ouweland, J. A. Maassen, P. Maechler. (2006) Diabetes-associated mitochondrial DNA mutation A3243G impairs cellular metabolic pathways necessary for beta cell function. Diabetologia 49:8, 1816-1826
CrossRef40
D. Crispim, L. H. Canani, J. L. Gross, B. Tschiedel, K. E. P. Souto, I. Roisenberg. (2006) The European-Specific Mitochondrial Cluster J/T Could Confer an Increased Risk of Insulin-Resistance and Type 2 Diabetes: An Analysis of the m.4216T > C and m.4917A > G Variants. Annals of Human Genetics 0:0, 060721082338043
CrossRef41
Dong-Ling Tang, Xin Zhou, Xia Li, Lei Zhao, Fang Liu. (2006) Variation of mitochondrial gene and the association with type 2 diabetes mellitus in a Chinese population. Diabetes Research and Clinical Practice 73:1, 77-82
CrossRef42
D. Crispim, L. H. Canani, J. L. Gross, B. Tschiedel, K. E. P. Souto, I. Roisenberg. (2006) The European-Specific Mitochondrial Cluster J/T Could Confer an Increased Risk of Insulin-Resistance and Type 2 Diabetes: An Analysis of the m.4216T > C and m.4917A > G Variants. Annals of Human Genetics 70:4, 488-495
CrossRef43
João Eduardo Salles, Valdir A. Moisés, Dirceu R. Almeida, Antonio R. Chacra, Regina S. Moisés. (2006) Myocardial dysfunction in mitochondrial diabetes treated with Coenzyme Q10. Diabetes Research and Clinical Practice 72:1, 100-103
CrossRef44
Leif Groop. 2006. Metabolism: Hereditary Errors. .
CrossRef45
Fernando Scaglia, Jennifer L Northrop. (2006) The Mitochondrial Myopathy Encephalopathy, Lactic Acidosis with??Stroke-Like Episodes (MELAS) Syndrome. CNS Drugs 20:6, 443-464
CrossRef46
D. Crispim, L. H. Canani, J. L. Gross, R. M. Carlessi, B. Tschiedel, K. E. P. Souto, I. Roisenberg. (2005) The G1888A variant in the mitochondrial 16S rRNA gene may be associated with Type 2 diabetes in Caucasian-Brazilian patients from southern Brazil. Diabetic Medicine 22:12, 1683-1689
CrossRef47
Dongchon Kang, Naotaka Hamasaki. (2005) Mitochondrial DNA in somatic cells: A promising target of routine clinical tests. Clinical Biochemistry 38:8, 685-695
CrossRef48
AN-A KAZUNO, KAE MUNAKATA, KANAKO MORI, MASASHI TANAKA, SHINICHIRO NANKO, HIROSHI KUNUGI, TADASHI UMEKAGE, MAMORU TOCHIGI, KAZUHISA KOHDA, TSUKASA SASAKI, TSUYOSHI AKIYAMA, SHINSUKE WASHIZUKA, NOBUMASA KATO, TADAFUMI KATO. (2005) Mitochondrial DNA sequence analysis of patients with 'atypical psychosis'. Psychiatry and Clinical Neurosciences 59:4, 497-503
CrossRef49
A. Kanazawa, Y. Kawamura, A. Sekine, A. Iida, T. Tsunoda, A. Kashiwagi, Y. Tanaka, T. Babazono, M. Matsuda, K. Kawai, T. Iiizumi, T. Fujioka, M. Imanishi, K. Kaku, Y. Iwamoto, R. Kawamori, R. Kikkawa, Y. Nakamura, S. Maeda. (2005) Single nucleotide polymorphisms in the gene encoding Krüppel-like factor 7 are associated with type 2 diabetes. Diabetologia 48:7, 1315-1322
CrossRef50
Hong Kyu Lee. 2005. Mitochondria in Diabetes Mellitus. , 377-454.
CrossRef51
Shiro Maeda, Shuichi Tsukada, Akio Kanazawa, Akihiro Sekine, Tatsuhiko Tsunoda, Daisuke Koya, Hiroshi Maegawa, Atsunori Kashiwagi, Tetsuya Babazono, Masafumi Matsuda, Yasushi Tanaka, Tomoaki Fujioka, Hiroshi Hirose, Takashi Eguchi, Yoichi Ohno, Christopher J. Groves, Andrew T. Hattersley, Graham A. Hitman, Mark Walker, Kohei Kaku, Yasuhiko Iwamoto, Ryuzo Kawamori, Ryuichi Kikkawa, Naoyuki Kamatani, Mark I. McCarthy, Yusuke Nakamura. (2005) Genetic variations in the gene encoding TFAP2B are associated with type 2 diabetes mellitus. Journal of Human Genetics 50:6, 283-292
CrossRef52
A. Tejerizo-García, L. Hernández-Hernández, A. Henríquez, S.P. González-Rodríguez, M.A. Ruiz, R. Alcántara, M.P. Martínez del Val, J.L. Lanchares, L.C. Tejerizo-López. (2005) Enfermedades mitocondriales y gestación. Clínica e Investigación en Ginecología y Obstetricia 32:2, 61-77
CrossRef53
Kazunobu Ishikawa, Satoshi Kimura, Atsushi Kobayashi, Takamasa Sato, Hayato Matsumoto, Yuichi Ujiie, Kazuhiko Nakazato, Minoru Mitsugi, Yukio Maruyama. (2005) Increased Reactive Oxygen Species and Anti-Oxidative Response in Mitochondrial Cardiomyopathy. Circulation Journal 69:5, 617-620
CrossRef54
Tomomi Fujisawa, Hiroshi Ikegami, Yoshihiko Kawaguchi, Koji Nojima, Yumiko Kawabata, Masaya Ono, Masanori Nishino, Shinsuke Noso, Hidenori Taniguchi, Mayumi Horiki, Michiko Itoi-Babaya, Naru Babaya, Kaori Inoue, Toshio Ogihara. (2004) Common genetic basis between type 1 and type 2 diabetes mellitus indicated by interview-based assessment of family history. Diabetes Research and Clinical Practice 66, S91-S95
CrossRef55
Thomas B. Knudsen, Maia L. Green. (2004) Response characteristics of the mitochondrial DNA genome in developmental health and disease. Birth Defects Research Part C: Embryo Today: Reviews 72:4, 313-329
CrossRef56
Andrew M. Schaefer, Robert W. Taylor, Douglass M. Turnbull, Patrick F. Chinnery. (2004) The epidemiology of mitochondrial disorders—past, present and future. Biochimica et Biophysica Acta (BBA) - Bioenergetics 1659:2-3, 115-120
CrossRef57
Alan R. Shuldiner, John C. McLenithan. (2004) Genes and pathophysiology of type 2 diabetes: more than just the Randle cycle all over again. Journal of Clinical Investigation 114:10, 1414-1417
CrossRef58
Kazuto Nakada, Akitsugu Sato, Hideyuki Sone, Atsuko Kasahara, Katsuhisa Ikeda, Yasuo Kagawa, Hiromichi Yonekawa, Jun-Ichi Hayashi. (2004) Accumulation of pathogenic ΔmtDNA induced deafness but not diabetic phenotypes in mito-mice. Biochemical and Biophysical Research Communications 323:1, 175-184
CrossRef59
Sara Shanske, Jacklyn Pancrudo, Petra Kaufmann, Kristin Engelstad, Sarah Jhung, Jiesheng Lu, Ali Naini, Salvatore DiMauro, Darryl C. De Vivo. (2004) Varying loads of the mitochondrial DNA A3243G mutation in different tissues: Implications for diagnosis. American Journal of Medical Genetics 130A:2, 134-137
CrossRef60
Madhav Thambisetty, Nancy J Newman. (2004) Diagnosis and management of MELAS. Expert Review of Molecular Diagnostics 4:5, 631-644
CrossRef61
SUSUMU SUZUKI. (2004) Diabetes Mellitus with Mitochondrial Gene Mutations in Japan. Annals of the New York Academy of Sciences 1011:1, 185-192
CrossRef62
TAKASHI NOMIYAMA, YASUSHI TANAKA, LIANSHAN PIAO, NOBUTAKA HATTORI, HIROSHI UCHINO, HIROTAKA WATADA, RYUZO KAWAMORI, SHIGEO OHTA. (2004) Accumulation of Somatic Mutation in Mitochondrial DNA and Atherosclerosis in Diabetic Patients. Annals of the New York Academy of Sciences 1011:1, 193-204
CrossRef63
HONG KYU LEE. (2004) Overview. Annals of the New York Academy of Sciences 1011:1, 1-6
CrossRef64
Ewan R. Pearson, Andrew T. Hattersley. 2003. Monogenic Disorders of the ��-Cell. .
CrossRef65
Nathan Fischel-Ghodsian. 2003. Mitochondrial Hearing Loss. .
CrossRef66
Gregory M Enns. (2003) The contribution of mitochondria to common disorders. Molecular Genetics and Metabolism 80:1-2, 11-26
CrossRef67
Dongchon Kang, Naotaka Hamasaki. (2003) Mitochondrial Oxidative Stress and Mitochondrial DNA. Clinical Chemistry and Laboratory Medicine 41:10, 1281-1288
CrossRef68
Nathan Fischel-Ghodsian. (2003) Mitochondrial Deafness. Ear and Hearing 24:4, 303-313
CrossRef69
Daisuke Ogawa, Kenichi Shikata, Mitsuhiro Matsuda, Jun Wada, Haruhito Uchida, Maki Asada, Hirofumi Makino. (2003) Pelvic lymphocyst infection associated with maternally inherited diabetes mellitus. Diabetes Research and Clinical Practice 61:2, 137-141
CrossRef70
A. Clark. 2003. Morphology of the Pancreas in Normal and Diabetic States. .
CrossRef71
DiMauro, Salvatore, Schon, Eric A., . (2003) Mitochondrial Respiratory-Chain Diseases. New England Journal of Medicine 348:26, 2656-2668
Full Text72
Fengzhu Sun, Jing Cui, Haralambos Gavras, Faina Schwartz. (2003) A Novel Class of Tests for the Detection of Mitochondrial DNA–Mutation Involvement in Diseases. The American Journal of Human Genetics 72:6, 1515-1526
CrossRef73
Yoshihiko Suzuki, N. Matsuura, S. Suzuki, T. Muramatsu, M. Taniyama, S. Ohta, S. Higuchi, M. Tsukahara, Y. Atusmi, K. Matsuoka. (2003) Aldehyde dehydrogenase 2 genotype in type 1 diabetes mellitus. Diabetes Research and Clinical Practice 60:2, 139-141
CrossRef74
Venkata Kakarlapudi, Robert Sawyer, Hinrich Staecker. (2003) The Effect of Diabetes on Sensorineural Hearing Loss. Otology & Neurotology 24:3, 382-386
CrossRef75
A. R. Sinnathuray, V. Raut, A. Awa, A. Magee, J. G. Toner. (2003) A Review of Cochlear Implantation in Mitochondrial Sensorineural Hearing Loss. Otology & Neurotology 24:3, 418-426
CrossRef76
Anna L Gloyn. (2003) The search for type 2 diabetes genes. Ageing Research Reviews 2:2, 111-127
CrossRef77
Susumu Suzuki, Yoshitomo Oka, Takashi Kadowaki, Azuma Kanatsuka, Takeshi Kuzuya, Masashi Kobayashi, Tokio Sanke, Yutaka Seino, Kishio Nanjo. (2003) Clinical features of diabetes mellitus with the mitochondrial DNA 3243 (A–G) mutation in Japanese: Maternal inheritance and mitochondria-related complications. Diabetes Research and Clinical Practice 59:3, 207-217
CrossRef78
Wahyu Danawati, M Sakaue, H Taniguchi. (2002) Low prevalence of the substitution of adenine to guanine at the 3243 nucleotide position of mitochondrial DNA (MtDNA) among Indonesian diabetic subjects. Diabetes Research and Clinical Practice 58:3, 201-202
CrossRef79
Y. Kato, Y. Miura, A. Inagaki, T. Itatsu, Y. Oiso. (2002) Age of onset possibly associated with the degree of heteroplasmy in two male siblings with diabetes mellitus having an A to G transition at 3243 of mitochondrial DNA. Diabetic Medicine 19:9, 784-786
CrossRef80
Madhav Thambisetty, Nancy J. Newman, Jonathan D. Glass, Michael R. Frankel. (2002) A Practical Approach to the Diagnosis and Management of MELAS: Case Report and Review. The Neurologist 8:5, 302-312
CrossRef81
Arnold Munnich, Pierre Rustin. (2002) Clinical spectrum and diagnosis of mitochondrial disorders. American Journal of Medical Genetics 106:1, 4-17
CrossRef82
Patrick F. Chinnery, Douglass M. Turnbull. (2002) Epidemiology and treatment of mitochondrial disorders. American Journal of Medical Genetics 106:1, 94-101
CrossRef83
J. H. Kim, K. S. Park, Y. M. Cho, B. S. Kang, S. K. Kim, H. J. Jeon, S. Y. Kim, H. K. Lee. (2002) The prevalence of the mitochondrial DNA 16189 variant in non-diabetic Korean adults and its association with higher fasting glucose and body mass index. Diabetic Medicine 19:8, 681-684
CrossRef84
J. Antonie Maassen. (2002) Mitochondrial diabetes: Pathophysiology, clinical presentation, and genetic analysis. American Journal of Medical Genetics 115:1, 66-70
CrossRef85
J. C. Alcolado, K. Laji, R. Gill-Randall. (2002) Maternal transmission of diabetes. Diabetic Medicine 19:2, 89-98
CrossRef86
SHINJI SAKAUE, JUNKO OHMURO, TAKAYUKI MISHINA, HIROKI MIYAZAKI, ETSURO YAMAGUCHI, MASAHARU NISHIMURA, MIRI FUJITA, KAZUO NAGASHIMA, SEIICHI TAGAMI, YOSHIKAZU KAWAKAMI. (2002) A Case of Diabetes, Deafness, Cardiomyopathy, and Central Sleep Apnea: Novel Mitochondrial DNA Polymorphisms.. The Tohoku Journal of Experimental Medicine 196:3, 203-211
CrossRef87
Cheng-Yoong Pang, Hsin-Chen Lee, Yau-Huei Wei. (2001) Enhanced oxidative damage in human cells harboring A3243G mutation of mitochondrial DNA: implication of oxidative stress in the pathogenesis of mitochondrial diabetes. Diabetes Research and Clinical Practice 54, S45-S56
CrossRef88
Chia-Wei Liou, Chin-Chang Huang, Yau-Huei Wei. (2001) Molecular analysis of diabetes mellitus-associated A3243G mitochondrial DNA mutation in Taiwanese cases. Diabetes Research and Clinical Practice 54, S39-S43
CrossRef89
Steven Wiltshire, Andrew T. Hattersley, Graham A. Hitman, Mark Walker, Jonathan C. Levy, Michael Sampson, Stephen O’Rahilly, Timothy M. Frayling, John I. Bell, G. Mark Lathrop, Amanda Bennett, Ranjit Dhillon, Christopher Fletcher, Christopher J. Groves, Elizabeth Jones, Philip Prestwich, Nikol Simecek, Pamidighantam V. Subba Rao, Marie Wishart, Richard Foxon, Simon Howell, Damian Smedley, Lon R. Cardon, Stephan Menzel, Mark I. McCarthy. (2001) A Genomewide Scan for Loci Predisposing to Type 2 Diabetes in a U.K. Population (The Diabetes UK Warren 2 Repository): Analysis of 573 Pedigrees Provides Independent Replication of a Susceptibility Locus on Chromosome 1q. The American Journal of Human Genetics 69:3, 553-569
CrossRef90
Timothy Geoffrey Barrett. (2001) Mitochondrial diabetes, DIDMOAD and other inherited diabetes syndromes. Best Practice & Research Clinical Endocrinology & Metabolism 15:3, 325-343
CrossRef91
Anna L. Gloyn, Mark I. McCarthy. (2001) The genetics of type 2 diabetes. Best Practice & Research Clinical Endocrinology & Metabolism 15:3, 293-308
CrossRef92
Rong-Hong Hsieh, Jei-Yuan Li, Cheng-Yoong Pang, Yau-Huei Wei. (2001) A novel mutation in the mitochondrial 16S rRNA gene in a patient with MELAS syndrome, diabetes mellitus, hyperthyroidism and cardiomyopathy. Journal of Biomedical Science 8:4, 328-335
CrossRef93
(2001) Biomedical vignette. Journal of Biomedical Science 8:4, 297-298
CrossRef94
Helen Everts, Carolyn Berdanier. 2001. Vitamin A and Mitochondrial Gene Expression. , 321-348.
CrossRef95
Kyong Soo Park, Ki-Up Lee, Ji Hyun Song, Cheol Soo Choi, Chan Soo Shin, Do Joon Park, Suk Kyeong Kim, Jae Joon Koh, Hong Kyu Lee. (2001) Peripheral blood mitochondrial DNA content is inversely correlated with insulin secretion during hyperglycemic clamp studies in healthy young men. Diabetes Research and Clinical Practice 52:2, 97-102
CrossRef96
D. J. Holmes-Walker, G. M. Ward, S. C. Boyages. (2001) Insulin secretion and insulin sensitivity are normal in non-diabetic subjects from maternal inheritance diabetes and deafness families. Diabetic Medicine 18:5, 381-387
CrossRef97
M Toyono, K Nakano, M Kiuchi, K Imai, H Suzuki, K Shishikura, M Osawa, K Shiratori, Y Goto, I Nonaka, H Sugie. (2001) A case of MERRF associated with chronic pancreatitis. Neuromuscular Disorders 11:3, 300-304
CrossRef98
Mark McCarthy, Stephan Menzel. (2001) The genetics of type 2 diabetes. British Journal of Clinical Pharmacology 51:3, 195-199
CrossRef99
Luc Moulonguet Doleris, Gary S. Hill, Pierre Chedin, Dominique Nochy, Christine Bellanne-Chantelot, Thomas Hanslik, Janine Bedrossian, Sophie Caillat-Zucman, Juliette Cahen-Varsaux, Jean Bariety. (2000) Focal segmental glomerulosclerosis associated with mitochondrial cytopathy. Kidney International 58:5, 1851-1858
CrossRef100
Steven C. Elbein. (2000) Genetics of Type 2 Diabetes: An Overview for the Millennium. Diabetes Technology & Therapeutics 2:3, 391-400
CrossRef101
Francesco S. Celi, Carlo Negri, Keith Tanner, Nina Raben, Flora De Pablo, Adela Rovira, Luis F. Pallardo, Pilar Martin-Vaquero, Michael P. Stern, Braxton D. Mitchell, Alan R. Shuldiner. (2000) Molecular scanning for mutations in the insulin receptor substrate-1 (IRS-1) gene in Mexican Americans with Type 2 diabetes mellitus. Diabetes/Metabolism Research and Reviews 16:5, 370-377
CrossRef102
Guy Van Camp, Richard Jh Smith. (2000) Maternally inherited hearing impairment. Clinical Genetics 57:6, 409-414
CrossRef103
M. C. Y. Ng, V. T. F. Yeung, C. C. Chow, J. K. Y. Li, P. R. Smith, C. H. Mijovic, J. A. J. H. Critchley, A. H. Barnett, C. S. Cockram, J. C. N. Chan. (2000) Mitochondrial DNA A3243G mutation in patients with early- or late-onset type 2 diabetes mellitus in Hong Kong Chinese. Clinical Endocrinology 52:5, 557-564
CrossRef104
Fran
ois Dubeau, Nicola De Stefano, Benjamin G. Zifkin, Douglas L. Arnold, Eric A. Shoubridge. (2000) Oxidative phosphorylation defect in the brains of carriers of the tRNAleu(UUR) A3243G mutation in a MELAS pedigree. Annals of Neurology 47:2, 179-185
CrossRef105
Kyong Soo Park, Ji Hyun Song, Ki-Up Lee, Cheol Soo Choi, Jae Joon Koh, Chan Soo Shin, Hong Kyu Lee. (1999) Peripheral blood mitochondrial DNA content correlates with lipid oxidation rate during euglycemic clamps in healthy young men. Diabetes Research and Clinical Practice 46:2, 149-154
CrossRef106
Schapira, Cock. (1999) Mitochondrial myopathies and encephalomyopathies. European Journal of Clinical Investigation 29:10, 886-898
CrossRef107
Pascale Massin, Marie Virally-Monod, Bernard Vialettes, Michel Paques, Henri Gin, Béatrice Porokhov, Sophie Caillat-Zucman, Philippe Froguel, Véronique Paquis-Fluckinger, Alain Gaudric, Pierre-Jean Guillausseau. (1999) Prevalence of macular pattern dystrophy in maternally inherited diabetes and deafness. Ophthalmology 106:9, 1821-1827
CrossRef108
Masataka Fukuda, Shigeru Nakano, Noriko Imaizumi, Mitsutaka Kitazawa, Makoto Nishizawa, Toshikazu Kigoshi, Kenzo Uchida. (1999) Mitochondrial DNA Mutations Are Associated with Both Decreased Insulin Secretion and Advanced Microvascular Complications in Japanese Diabetic Subjects. Journal of Diabetes and its Complications 13:5-6, 277-283
CrossRef109
Yasunori Sera, Eiji Kawasaki, Norio Abiru, Masako Ozaki, Takahiro Abe, Hirofumi Takino, Hideaki Kondo, Hironori Yamasaki, Yoshihiko Yamaguchi, Shoichi Akazawa, Shigenobu Nagataki, Yasuko Uchigata, Nobuo Matsuura, Katsumi Eguchi. (1999) Autoantibodies to Multiple Islet Autoantigens in Patients with Abrupt Onset Type 1 Diabetes and Diabetes Diagnosed with Urinary Glucose Screening. Journal of Autoimmunity 13:2, 257-265
CrossRef110
S. Nakamura, M. Yoshinari, Y. Doi, H. Yoshizumi, R. Katafuchi, Y. Yokomizo, K. Nishiyama, M. Wakisaka, M. Fujishima. (1999) Renal complications in patients with diabetes mellitus associated with an A to G mutation of mitochondrial DNA at the 3243 position of leucine tRNA. Diabetes Research and Clinical Practice 44:3, 183-189
CrossRef111
Shuichi Otabe, Kazuki Yasuda, Yasumichi Mori, Kotaro Shimokawa, Hiroko Kadowaki, Atsuo Jimi, Kyohei Nonaka, Yasuo Akanuma, Yoshio Yazaki, Takashi Kadowaki. (1999) Molecular and Histological Evaluation of Pancreata from Patients with a Mitochondrial Gene Mutation Associated with Impaired Insulin Secretion. Biochemical and Biophysical Research Communications 259:1, 149-156
CrossRef112
Yukihiko Momiyama, Yoshihiko Suzuki, Fumitaka Ohsuzu, Yoshihito Atsumi, Kempei Matsuoka, Mitsuru Kimura. (1999) Maternally transmitted susceptibility to non–insulin-dependent diabetes mellitus and left ventricular hypertrophy. Journal of the American College of Cardiology 33:5, 1372-1378
CrossRef113
TATEO KUNO, KATSUYA TASHIRO, TADASH Sato, HAKARU TASAKI and SUMIO Miyazaki. (1999) Continuous subcutaneous insulin injection for a case of mitochondrial cytopathy with diabetes mellitus requiring a large amount of insulin. Pediatrics International 41:1, 97-100
CrossRef114
Takeshi Oshima, Narihisa Ueda, Katsuhisa Ikeda, Koji Abe, Tomonori Takasaka. (1999) Hearing Loss With a Mitochondrial Gene Mutation Is Highly Prevalent in Japan. The Laryngoscope 109:2, 334-338
CrossRef115
K Sankaranarayanan, R Chakraborty, E.A Boerwinkle. (1999) Ionizing radiation and genetic risks. Mutation Research/Reviews in Mutation Research 436:1, 21-57
CrossRef116
Hiroshi Ueno, Hideyuki Shiotani. (1999) Cardiac Abnormalities in Diabetic Patients With Mutation in the Mitochondrial tRNALeu(UUR) Gene. Japanese Circulation Journal 63:11, 877-880
CrossRef117
Yukihiko Momiyama, Yoshihito Atsumi, Fumitaka Ohsuzu, Susumu Ui, Shojirou Morinaga, Kempei Matsuoka, Mitsuru Kimura. (1999) Rapid Progression of Cardiomyopathy in Mitochondrial Diabetes. Japanese Circulation Journal 63:2, 130-132
CrossRef118
Nathan Fischel-Ghodsian. (1999) Mitochondrial deafness mutations reviewed. Human Mutation 13:4, 261-270
CrossRef119
H.K Lee, J.H Song, C.S Shin, D.J Park, K.S Park, K.U Lee, C.-S Koh. (1998) Decreased mitochondrial DNA content in peripheral blood precedes the development of non-insulin-dependent diabetes mellitus. Diabetes Research and Clinical Practice 42:3, 161-167
CrossRef120
M Nigou, B Parfait, E Clauser, J.L Olivier. (1998) Detection and quantification of the A3243G mutation of mitochondrial DNA by ligation detection reaction. Molecular and Cellular Probes 12:5, 273-282
CrossRef121
Kari Majamaa, Jukka S. Moilanen, Seija Uimonen, Anne M. Remes, Pasi I. Salmela, Mikko Kärppä, Kirsi A.M. Majamaa-Voltti, Harri Rusanen, Martti Sorri, Keijo J. Peuhkurinen, Ilmo E. Hassinen. (1998) Epidemiology of A3243G, the Mutation for Mitochondrial Encephalomyopathy, Lactic Acidosis, and Strokelike Episodes: Prevalence of the Mutation in an Adult Population. The American Journal of Human Genetics 63:2, 447-454
CrossRef122
Chien-Ning Huang, Shiou-Hwa Jee, Juey-Jen Hwang, Yea-Fhey Kuo, Lee-Ming Chuang. (1998) Autoimmune IDDM in a sporadic MELAS patient with mitochondrial tRNALeu(UUR) mutation. Clinical Endocrinology 49:2, 265-270
CrossRef123
Matsuko Ozawa, Ikuya Nonaka, Yu-ichi Goto. (1998) Single muscle fiber analysis in patients with 3243 mutation in mitochondrial DNA: Comparison with the phenotype and the proportion of mutant genome. Journal of the Neurological Sciences 159:2, 170-175
CrossRef124
Keiichi Kameoka, Haruhiko Isotani, Koji Tanaka, Kanako Azukari, Yukari Fujimura, Yasushi Shiota, Eun Sasaki, Motoko Majima, Keizo Furukawa, Shinichi Haginomori, Haruko Kitaoka, Nakaaki Ohsawa. (1998) Novel Mitochondrial DNA Mutation in tRNALys(8296A → G) Associated with Diabetes. Biochemical and Biophysical Research Communications 245:2, 523-527
CrossRef125
Maria-Luisa Mart
CrossRef126
Salvatore Dimauro. (1998) Mitochondrial diseases: Clinical considerations. BioFactors 7:3, 277-285
CrossRef127
Charlotta Olsson, Björn Zethelius, Maria Lagerström-Fermér, Johan Asplund, Christian Berne, Ulf Landegren. (1998) Level of heteroplasmy for the mitochondrial mutation A3243G correlates with age at onset of diabetes and deafness. Human Mutation 12:1, 52-58
CrossRef128
Atsushi Takeda, Satoru Chiba, Iwai Takaaki, Akira Tanamura, Yutaka Yamaguchi, Nobuakira Takeda. (1998) Cell Cycle of Myocytes of Cardiac and Skeletal Muscle in Mitochondrial Myopathy. Japanese Circulation Journal 62:9, 695-699
CrossRef129
Nathan Fischel-Ghodsian. (1998) Mitochondrial Mutations and Hearing Loss: Paradigm for Mitochondrial Genetics. The American Journal of Human Genetics 62:1, 15-19
CrossRef130
Takuji Inagaki, Hiroshi Ishino, Haruo Seno, Satoshi Ohguni, Junko Tanaka, Yuzuru Kato. (1997) Psychiatric Symptoms in a Patient with Diabetes Mellitus Associated with Point Mutation in Mitochondrial DNA. Biological Psychiatry 42:11, 1067-1069
CrossRef131
Yoshihiko Suzuki, Takashi Iizuka, Tetsuro Kobayashi, Tetsuo Nishikawa, Yoshihito Atsumi, Takashi Kadowaki, Yoshitomo Oka, Hiroko Kadowaki, Matsuo Taniyama, Kazuhiro Hosokawa, Takayuki Asahina, Kempei Matsuoka. (1997) Diabetes mellitus associated with the 3243 mitochondrial tRNALeu(UUR) mutation: Insulin secretion and sensitivity. Metabolism 46:9, 1019-1023
CrossRef132
Hitoshi Miyaoka, Yoshihiko Suzuki, Matsuo Taniyama, Yoshiko Miyaoka, Kurie Shishikura, Kunitoshi Kamijima, Yoshito Atsumi, Kempei Matsuoka. (1997) Mental disorders in diabetic patients with mitochondrial transfer RNALeu (UUR) mutation at position 3243. Biological Psychiatry 42:6, 524-526
CrossRef133
M. Fukui, K. Nakano, H. Obayashi, Y. Kitagawa, N. Nakamura, H. Mori, S. Kajiyama, S. Wada, M. Fujii, K. Yoshimori, T. Kanaitsuka, H. Shigeta, M. Kondo. (1997) High prevalence of mitochondrial diabetes mellitus in Japanese patients with major risk factors. Metabolism 46:7, 793-795
CrossRef134
Yong-ih Kim, Yoshihiro Sawada, Go Fujiwara, Hiroshi Chiba, Tsunehiko Nishimura. (1997) Therapeutic effect of co-enzyme Q10 on idiopathic dilated cardiomyopathy: assessment by iodine-123 labelled 15-(p-iodophenyl)-3(R, S)-methylpentadecanoic acid myocardial single-photon mission tomography. European Journal of Nuclear Medicine 24:6, 629-634
CrossRef135
Maria Mylene Abad, Philip D. Cotter, Flora H. Fodor, Signe Larson, Fredda Ginsberg-Fellner, Robert J. Desnick, Jose E. Abdenur. (1997) Screening for the mitochondrial DNA A3243G mutation in children with insulin-dependent diabetes mellitus. Metabolism 46:4, 445-449
CrossRef136
Patrick Niaudet, Agnès Rötig. (1997) The kidney in mitochondrial cytopathies. Kidney International 51:4, 1000-1007
CrossRef137
Shoji Fujitani, Kyoko Okazaki, Toshihiko Yada. (1997) The ability of a new hypoglycaemic agent, A-4166, compared to sulphonylureas, to increase cytosolic Ca 2+ in pancreatic β-cells under metabolic inhibition. British Journal of Pharmacology 120:7, 1191-1198
CrossRef138
Y. Suzuki, T. Kobayashi, M. Taniyama, Y. Astumi, Y. Oka, T. Kadowaki, H. Kadowaki, K. Hosokawa, T. Asahina, A. Shimada, K. Matsuoka. (1997) Islet cell antibody in mitochondrial diabetes. Diabetes Research and Clinical Practice 35:2-3, 163-165
CrossRef139
Peter W. Stacpoole. (1997) Lactic acidosis and other mitochondrial disorders. Metabolism 46:3, 306-321
CrossRef140
Y. Suzuki, M. Taniyama, T. Muramatsu, Y. Atsumi, K. Hosokawa, T. Asahina, A. Shimada, C. Murata, K. Matsuoka. (1997) Diabetes mellitus associated with 3243 mitochondrial tRNALeu(UUR) mutation: Clinical features and coenzyme Q10 treatment. Molecular Aspects of Medicine 18, 181-188
CrossRef141
Yoshihiko Suzuki, Yu-ichi Goto, Matsuo Taniyama, Ikuya Nonaka, Nobuyuki Murakami, Kazuhiro Hosokawa, Takayuki Asahina, Yoshihito Atsumi, Kempei Matsuoka. (1997) Muscle histopathology in diabetes mellitus associated with mitochondrial tRNALeu(UUR) mutation at position 3243. Journal of the Neurological Sciences 145:1, 49-53
CrossRef142
Leif C. Groop, Tiinamaija Tuomi. (1997) Non-insulin-dependent Diabetes Mellitus - A Collision between Thrifty Genes and an Affluent Society. Annals of Medicine 29:1, 37-53
CrossRef143
F. Barbetti. (1996) Pathophysiology of non-insulin-dependent diabetes and the search for candidate genes: dangerous liaisons?. Acta Diabetologica 33:4, 257-262
CrossRef144
P. S. Kishnani, J. L. K. Hove, J. S. Shoffner, A. Kaufman, E. H. Bossen, S. G. Kahler. (1996) Acute pancreatitis in an infant with lactic acidosis and a mutation at nucleotide 3243 in the mitochondrial DNA tRNALeu[UUR] gene. European Journal of Pediatrics 155:10, 898-903
CrossRef145
T. Kobayashi, Y. Oka, H. Katagiri, A. Falorni, A. Kasuga, I. Takei, K. Nakanishi, T. Murase, K. Kosaka, Å. Lernmark. (1996) Association between HLA and islet cell antibodies in diabetic patients with a mitochondrial DNA mutation at base pair 3243. Diabetologia 39:10, 1196-1200
CrossRef146
Nobuakira Takeda. (1996) Mitochondrial DNA mutations in diabetic heart. Diabetes Research and Clinical Practice 31, S123-S126
CrossRef147
T. Kasperska-Czyzyk, K. Jedynasty, R. R. Bowsher, D. L. Holloway, I. Stradowska, K. Stepień, R. Nowaczyk, W. Szymczak, A. Czyzyk. (1996) Difference in the influence of maternal and paternal NIDDM on pancreatic beta-cell activity and blood lipids in normoglycaemic non-diabetic adult offspring. Diabetologia 39:7, 831-837
CrossRef148
Patrick Niaudet, Agnès Rötig. (1996) Renal involvement in mitochondrial cytopathies. Pediatric Nephrology 10:3, 368-373
CrossRef149
Michael Ristow, Kay Busch, Helmut Schatz, Andreas Pfeiffer. (1996) Restricted geographical extension of the association of a glucagon receptor gene mutation (Gly40Ser) with non-insulin-dependent diabetes mellitus. Diabetes Research and Clinical Practice 32:3, 183-185
CrossRef150
M. S. Damian, P. Seibel, W. Schachenmayr, H. Reichmann, W. Dorndorf. (1996) VACTERL with the mitochondrial NP 3243 point mutation. American Journal of Medical Genetics 62:4, 398-403
CrossRef151
Annette Feigenbaum, David Chitayat, Brian Robinson, Daune MacGregor, Tomoko Myint, Gerald Arbus, Margaret J. M. Nowaczyk. (1996) The expanding clinical phenotype of the tRNALeu(UUR) A→G mutation at np 3243 of mitochondrial DNA: Diabetic embryopathy associated with mitochondrial cytopathy. American Journal of Medical Genetics 62:4, 404-409
CrossRef152
Suzanne S.P. Gebhart, John M. Shoffner, Deborah Koontz, Allan Kaufman, Douglas Wallace. (1996) Insulin resistance associated with maternally inherited diabetes and deafness. Metabolism 45:4, 526-531
CrossRef153
J. A. Maassen, T. Kadowaki. (1996) Maternally inherited diabetes and deafness: a new diabetes subtype. Diabetologia 39:4, 375-382
CrossRef154
J.C.N. Chan, V.T.F. Yeung, C.C. Chow, G.T.C. Ko, I.R. Mackay, M.J. Rowley, P.Z. Zimmet, C.S. Cockram. (1996) Pancreatic β cell function and antibodies to glutamic acid decarboxylase (anti-GAD) in Chinese patients with clinical diagnosis of insulin-dependent diabetes mellitus. Diabetes Research and Clinical Practice 32:1-2, 27-34
CrossRef155
T. Fujisawa, H. Ikegami, E. Yamato, K. Takekawa, Y. Nakagawa, Y. Hamada, T. Oga, H. Ueda, M. Shintani, M. Fukuda, T. Ogihara. (1996) Association of Trp64Arg mutation of the ?3-adrenergic-receptor with NIDDM and body weight gain. Diabetologia 39:3, 349-352
CrossRef156
C. Ronald Kahn, M.D, David Vicent, M.D, Alessandro Doria, M.D., Ph.D. (1996) GENETICS OF NON-INSULIN-DEPENDENT (TYPE-II) DIABETES MELLITUS. Annual Review of Medicine 47:1, 509-531
CrossRef157
SETH LOVE, DAVID A. HILTON. (1996) ASSESSMENT OF THE DISTRIBUTION OF MITOCHONDRIAL RIBOSOMAL RNA IN MELAS AND IN THROMBOTIC CEREBRAL INFARCTS BYIN SITU HYBRIDIZATION. The Journal of Pathology 178:2, 182-189
CrossRef158
Takeshi Oshima, Narihisa Ueda, Katsuhisa Ikeda, Koji Abe, Tomonori Takasaka. (1996) Bilateral Sensorineural Hearing Loss Associated With the Point Mutation in Mitochondrial Genome. The Laryngoscope 106:1, 43-48
CrossRef159
Leen M. 't Hart, Janna J. Jansen, Herman H.P.J. Lemkes, Peter de Knijff, J. Antonie Maassen. (1996) Heteroplasmy levels of a mitochondrial gene mutation associated with diabetes mellitus decrease in leucocyte DNA upon aging. Human Mutation 7:3, 193-197
CrossRef160
B. Vialettes. (1995) Could coenzyme Q10 and l-carnitine be a treatment for diabetes secondary to 3243 mutation of mtDNA?. Diabetologia 38:12, 1485-1486
CrossRef161
M. Odawara, M. Hashiramoto. (1995) Are MELAS and diabetes mellitus caused solely by the same mutation at np 3243 of the mitochondrial gene?. Diabetologia 38:12, 1488-1490
CrossRef162
M. Sano, K. Ishii, Y. Momose, M. Uchigata, M. Senda. (1995) Cerebral metabolism of oxygen and glucose in a patient with MELAS syndrome. Acta Neurologica Scandinavica 92:6, 497-502
CrossRef163
Akihisa Imagawa, Hiromu Nakajima, Naoto Itoh, Jun-ichiro Miyagawa, Masako Waguri, Yukio Horikawa, Masami Inada, Shinji Tamura, Sumio Kawata, Masamichi Kuwajima, Mitsuyoshi Namba, Toshiaki Hanafusa, Yuji Matsuzawa. (1995) Mitochondrial DNA mutations in pancreatic biopsy specimens from IDDM patients. Diabetes Research and Clinical Practice 30:2, 79-87
CrossRef164
M.S. Damian, P. Seibel, H. Reichmann, W. Schachenmayr, H. Laube, G. Bachmann, K. H. Wassill, W. Dorndorf. (1995) Clinical spectrum of the MELAS mutation in a large pedigree. Acta Neurologica Scandinavica 92:5, 409-415
CrossRef165
Lee-Ming Chuang, Huey-Peir Wu, Ken C. Chiu, Chuen-Shiang Lai, Tong-Yuan Tai, Boniface J. Lin. (1995) Mitochondrial gene mutations in familial non-insulin-dependent diabetes mellitus in Taiwan. Clinical Genetics 48:5, 251-254
CrossRef166
Masanori Iwanishi, Toshiyuki Obata, Schu Yamada, Hiroshi Maegawa, Rie Tachikawa-Ide, Satoshi Ugi, Masaaki Hasegawa, Hideto Kojima, Tatsuya Oguni, Ryuhei Toudo, Yukio Shigeta, Atsunori Kashiwagi. (1995) Clinical and laboratory characteristics in the families with diabetes and a mitochondrial tRNALEU(UUR) gene mutation. Diabetes Research and Clinical Practice 29:2, 75-82
CrossRef167
T. Fujisawa, H. Ikegami, E. Yamato, K. Takekawa, Y. Nakagawa, Y. Hamada, H. Ueda, M. Fukuda, T. Ogihara. (1995) A mutation in the glucagon receptor gene (Gly40Ser): heterogeneity in the association with diabetes mellitus. Diabetologia 38:8, 983-985
CrossRef168
Yoshihiko Suzuki, Katsuhiko Motogi, Soroku Yagihashi, Ryu-ichi Wada, Yoshihito Atsumi, Kempei Matsuoka. (1995) Macroangiopathy in a case of diabetes mellitus with mitochondrial tRNALeu(UUR) mutation at position 3243. Diabetes Research and Clinical Practice 29:1, 69-71
CrossRef169
Timothy J. Aitman, John A. Todd. (1995) Molecular genetics of diabetes mellitus. Baillière's Clinical Endocrinology and Metabolism 9:3, 631-656
CrossRef170
J. Poulton, S. O’Rahilly, K. J. Morten, A. Clark. (1995) Mitochondrial DNA, diabetes and pancreatic pathology in Kearns-Sayre syndrome. Diabetologia 38:7, 868-871
CrossRef171
K. Yanagisawa, Y. Uchigata, M. Sanaka, H. Sakura, S. Minei, M. Shimizu, R. Kanamuro, T. Kadowaki, Y. Omori. (1995) Mutation in the mitochondrial tRNAleu at position 3243 and spontaneous abortions in Japanese women attending a clinic for diabetic pregnancies. Diabetologia 38:7, 809-815
CrossRef172
Haruko Kitaoka, Keiichi Kameoka, Yuri Suzuki, Eun Sasaki, Motoko Majima, Kiyoshi Takada, Hideki Katagiri, Yoshitomo Oka, Nakaaki Ohsawa. (1995) A patient with diabetes mellitus, cardiomyopathy, and a mitochondrial gene mutation: confirmation of a gene mutation in cardiac muscle. Diabetes Research and Clinical Practice 28:3, 207-212
CrossRef173
D Wallace. (1995) Mitochondrial DNA mutations in human degenerative diseases and aging. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease 1271:1, 141-151
CrossRef174
K Gerbitz. (1995) Mitochondrial diabetes mellitus: a review. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease 1271:1, 253-260
CrossRef175
J Morgan-Hughes. (1995) Mitochondrial DNA (mtDNA) diseases: correlation of genotype to phenotype. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease 1271:1, 135-140
CrossRef176
(1995) Idiopathic Dilated Cardiomyopathy. New England Journal of Medicine 332:20, 1384-1386
Full Text177
Masato Odawara, Kamejiro Yamashita. (1995) Diagnosis of maturity onset diabetes of the young (MODY). The Lancet 345:8960, 1313
CrossRef178
Bahman Sepehrnia, Toni R. Prezant, Jerome I. Rotter, David J. Pettitt, William C. Knowler, Nathan Fischel-Ghodsian. (1995) Screening for mtDNA diabetes mutations in Pima Indians with NIDDM. American Journal of Medical Genetics 56:2, 198-202
CrossRef179
D. SIMMONS, B. A. GATLAND, L. LEAKEHE, C. FLEMING. (1995) Frequency of diabetes in family members of probands with non-insulin-dependent diabetes mellitus. Journal of Internal Medicine 237:3, 315-321
CrossRef180
J. Müller-Höcker. (1995) Critical Commentary. Pathology - Research and Practice 191:1, 70-75
CrossRef181
M. Kishimoto, M. Hashiramoto, S. Araki, Y. Ishida, T. Kazumi, F. Kanda, M. Kasuga. (1995) Diabetes mellitus carrying a mutation in the mitochondrial tRNALeu(UUR) gene. Diabetologia 38:2, 193-200
CrossRef182
J.C. Alcolado, A.W. Thomas. (1995) Maternally Inherited Diabetes Mellitus: the Role of Mitochondrial DNA Defects. Diabetic Medicine 12:2, 102-108
CrossRef183
Már H. Tulinius, Anders Oldfors, Elisabeth Holme, Nils-Göran Larsson, Massoud Houshmand, Per Fahleson, Lars Sigström, Bengt Kristiansson. (1995) Atypical presentation of multisystem disorders in two girls with mitochondrial DNA deletions. European Journal of Pediatrics 154:1, 35-42
CrossRef184
J. M. W. van den Ouweland, H. H. P. J. Lemkes, K.-D. Gerbitz, J. A. Maassen. (1995) Maternally inherited diabetes and deafness (MIDD): A distinct subtype of diabetes associated with a mitochondrial tRNALeu(UUR) gene point mutation. Muscle & Nerve 18:S14, S124-S130
CrossRef185
T. Kadowaki, H. Sakura, S. Otabe, K. Yasuda, H. Kadowaki, Y. Mori, R. Hagura, Y. Akanuma, Y. Yazaki. (1995) A subtype of diabetes mellitus associated with a mutation in the mitochondrial gene. Muscle & Nerve 18:S14, S137-S141
CrossRef186
Caterina Mariotti, Nicola Savarese, Anu Suomalainen, Marco Rimoldi, Giacomo Comi, Alessandro Prelle, Carlo Antozzi, Serena Servidei, Laura Jarre, Stefano DiDonato, Massimo Zeviani. (1995) Genotype to phenotype correlations in mitochondrial encephalomyopathies associated with the A3243G mutation of mitochondrial DNA. Journal of Neurology 242:5, 304-312
CrossRef187
Yu-Ichi Goto. (1995) Clinical features of melas and mitochondrial DNA mutations. Muscle & Nerve 18:S14, S107-S112
CrossRef188
N. Iwasaki, H. Ohgawara, H. Nagahara, M. Kawamura, G. I. Bell, Y. Omori. (1995) Characterization of Japanese families with early-onset type 2 (non-insulin dependent) diabetes mellitus and screening for mutations in the glucokinase and mitochondrial tRNALeu(UUR) genes. Acta Diabetologica 32:1, 17-22
CrossRef189
J. A. Maassen. (1994) Prevalence of maternally inherited diabetes and deafness in diabetic populations in the Netherlands. Diabetologia 37:11, 1169-1170
CrossRef190
T. Awata, C. Matsumoto, T. Urakami, R. Hagura, S. Amemiya, Y. Kanazawa. (1994) Association of polymorphism in the interferon ? gene with IDDM. Diabetologia 37:11, 1159-1162
CrossRef191
Masato Odawara, Kayoko Sasaki, Shigeo Nagafuchi, Ayako Tanae, Kamejiro Yamashita. (1994) Lack of association between mitochondrial gene mutation np 3243 and type 1 diabetes mellitus and autoimmune thyroid diseases. The Lancet 344:8929, 1086
CrossRef
