Original Article
The Clinical and Genetic Spectrum of the Holt-Oram Syndrome (Heart-Hand Syndrome)
N Engl J Med 1994; 330:885-891March 31, 1994
- Abstract
Background
The Holt-Oram syndrome is an autosomal dominant condition characterized by skeletal abnormalities that are frequently accompanied by congenital cardiac defects. The cause of these disparate clinical features is unknown. To identify the chromosomal location of the Holt-Oram syndrome gene, we performed clinical and genetic studies.
Methods
Two large families with the Holt-Oram syndrome were evaluated by radiography of the hands, electrocardiography, and transthoracic echocardiography. Genetic-linkage analyses were performed with polymorphic DNA loci dispersed throughout the genome to identify a locus that was inherited with the Holt-Oram syndrome in family members.
Results
A total of 19 members of Family A had Holt-Oram syndrome with mild-to-moderate skeletal deformities, including triphalangeal thumbs and carpal-bone dysmorphism. All affected members of Family A had moderate-to-severe congenital cardiac abnormalities, such as ventricular or atrial septal defects or atrioventricular-canal defects. Eighteen members of a second kindred (Family B) had Holt-Oram syndrome with moderate-to-severe skeletal deformities, including phocomelia. Twelve of the affected members had no cardiac defects; six had only atrial septal defects. Genetic analyses demonstrated linkage of the disease in each family to polymorphic loci on the long arm of chromosome 12 (combined multipoint lod score, 16.8). These data suggest odds greater than 1016:1 that the genetic defect for Holt-Oram syndrome is present on the long arm of chromosome 12 (12q2).
Conclusions
Mutations in a gene on chromosome 12q2 can produce a wide range of disease phenotypes characteristic of the Holt-Oram syndrome. This gene has an important role in both skeletal and cardiac development.
Media in This Article
Figure 1
Inheritance of Holt-Oram Syndrome in Families A and B.Figure 2
Clinical Manifestations of Holt-Oram Syndrome.Article Activity
- Article
The Holt-Oram syndrome (Mendelian Inheritance in Man number 142900),1 also called the heart-hand syndrome, is an inherited disorder that causes anomalies of the upper limbs and heart. The syndrome is transmitted as an autosomal dominant trait that is highly penetrant, although the clinical manifestations vary and range from subclinical radiographic findings to overt, life-threatening disease. Upper-limb anomalies are always present. These may be unilateral or bilateral and involve structures derived from the embryonic radial ray, typically the radial, carpal, and thenar bones. Aplasia, hypoplasia, fusion, and anomalous development of these structures produce a wide spectrum of phenotypes including triphalangeal or absent thumbs, foreshortened arms, and phocomelia. Cardiac abnormalities include single or multiple atrial and ventricular septal defects, or they may be absent. Disturbances of cardiac rhythm occur frequently in affected persons and include sinus bradycardia and variable degrees of atrioventricular block2-4.
Virtually nothing is known about the cause or pathogenetic processes that account for these varied manifestations of Holt-Oram syndrome. The prevalence of this disorder has been estimated to be 0.95 per 100,000 total births; 85 percent of cases are attributed to new mutations5. Whether intragenic or intergenic heterogeneity produces the diverse disease phenotypes in different families is unknown. To address these questions, we have performed clinical and genetic studies in two families with Holt-Oram syndrome. Affected members of Family A have severe cardiac manifestations, whereas skeletal manifestations of the disorder predominate in Family B. Using molecular genetic techniques we have found that the genetic defect in both families is located on the long arm of chromosome 12. We propose that the wide spectrum of clinical presentations of Holt-Oram syndrome is due to mutations in a single gene.
Methods
Clinical Status
Informed consent was obtained from all participants in accordance with the Brigham and Women's Hospital Committee for the Protection of Human Subjects from Research Risks. All family members were evaluated by a thorough history taking and physical examination by someone who had no knowledge of their genotypic status. If there was any evidence of skeletal or cardiac disease suggestive of Holt-Oram syndrome, the subjects were further evaluated by electrocardiography, transthoracic echocardiography, and radiographic studies of the upper limbs. Patients were given a diagnosis of Holt-Oram syndrome if they had gross or radiographic evidence of radial-ray defects with or without associated cardiac septal defects or conduction disease. Cardiac septal defects were diagnosed either by a review of cardiac-catheterization studies or by the presence of anomalies at the interatrial or interventricular septa on color-flow Doppler echocardiography.
Genotypic Analyses
For the genotypic analyses, 5 to 30 ml of peripheral blood was obtained from each family member, and lymphoblastoid lines were established by transformation with the Epstein-Barr virus, as previously described6. Genomic DNA was isolated from either cell lines or peripheral lymphocytes6. Polymorphic short tandem-repeat sequences (also termed microsatellites) were amplified with the polymerase chain reaction (PCR) with use of published nucleotide primer sequences7,8 and analyzed on denaturing polyacrylamide-urea gels as previously described6. In brief, 150 ng of genomic DNA was amplified in a volume of 10 microliters containing 40 ng of unlabeled oligonucleotide primer; 40 ng of primer end-labeled with phosphorus-32; 200 micro M each of deoxyadenosine triphosphate, deoxycytidine triphosphate, deoxyguanosine triphosphate, and deoxythymidine triphosphate; and 0.1 U of AmpliTaq DNA polymerase (Perkin-Elmer Cetus) with 1 × PCR buffer (10 mM TRIS, pH 8.3; 50 mM potassium chloride; 1.5 mM magnesium chloride; and 0.01 percent gelatin) (Perkin-Elmer Cetus). The samples were processed through 30 cycles including denaturation for 20 seconds at 94 °C, primer annealing for 30 seconds at 55 °C, and primer extension for 45 seconds at 72 °C, followed by another 10 minutes of extension at 72 °C. The amplified products were subjected to electrophoresis on 6 percent polyacrylamide sequencing gels and visualized by autoradiography.
Two dimeric polymorphisms within a 500-base-pair region of the d-amino acid oxidase (DAO) gene9 were amplified with the following primers: DAO-1 forward primer: 5'CCTGCTCCACACTTACACAGAC3', DAO-1 reverse primer: 5'GCAAGCTTGGAGTATGTATCCC3', DAO-2 forward primer: 5'GATTTTACCTAAGGCTGGATCTG3', and DAO-2 reverse primer: 5'GACACTGATTATAGCAACGTGTGT3'. The CA polymorphism amplified by the DAO-2 primers is also amplified by the published primers for the anonymous marker D12S1058.
Linkage Analyses
Two-point analyses were performed with MLINK (version 5.1), and multipoint analyses were performed with LINKMAP6,10 to calculate the lod scores. The lod score indicates the statistical likelihood that two genetic loci are linked and is calculated from the ratio of the probability of inheriting two loci given a certain recombination fraction θ between the loci to the probability of inheriting both loci if they are not linked in the human genome (theta = 0.5). Lod scores vary as a function of the recombination fraction, which approximates the genetic distance between loci. Two loci are 1 centimorgan (approximately 1 million base pairs of DNA) apart if they recombine in 1 percent of all meioses. A lod score of more than 3 indicates a significant likelihood of linkage (odds in favor of linkage, 1000:1). A lod score of less than -2 is generally accepted as evidence against linkage between loci. Penetrance of Holt-Oram syndrome was set at a P level of 0.95 for all analyses. Allele frequencies were taken from published data when available and otherwise estimated independently from at least 30 chromosomes in the study population.
Statistical Analyses of Phenotypes
All family members who were studied clinically or for whom clinical records were available were considered for analyses. Data were analyzed with the chi-square test.
Results
Clinical Evaluations
Family A (Figure 1AFigure 1
Inheritance of Holt-Oram Syndrome in Families A and B.) is a North American kindred that was reported to have Holt-Oram syndrome in 196611. Of 49 family members in five generations at risk for inheriting the disorder, 26 family members (11 male and 15 female) were affected -- a pattern consistent with autosomal dominant inheritance. Clinical evaluation or an examination of historical records demonstrated that each affected family member was the offspring of an affected parent, thereby confirming the high penetrance of the disease gene. Clinical evaluations of family members (Figure 1A) identified 18 surviving members affected by the Holt-Oram syndrome.All affected family members had some skeletal abnormalities, many of which were subtle and detected only by radiography. Skeletal deformities generally manifested as deformities of the thenar and carpal bones (Figure 2AFigure 2
Clinical Manifestations of Holt-Oram Syndrome.), occasionally in association with mildly hypoplastic clavicles and shortened radii. Thenar abnormalities included distal displacement of the thenar eminence in the presence or absence of a triphalangeal digit. Only Subject V-7 had an aplastic thumb (unilateral); the contralateral thumb was triphalangeal. None of the subjects had either phocomelia or severe ectromelia.All affected members of Family A had cardiovascular disease (Table 1Table 1
Clinical Expression of the Holt-Oram Syndrome in Two Families.). Fifteen of the surviving family members had septal defects: four had atrial septal defects, nine had ventricular septal defects, and two had both. The atrial septal defects were all of the ostium secundum type except for one involving an ostium primum defect (Subject V-13). Subjects V-5, V-7, V-12, and V-13 required surgical correction of hemodynamically significant defects. Subject V-12 died of complications related to a complete atrioventricular-canal defect. At the time of the study, Subject III-3 was being evaluated for surgical correction of a ventricular septal defect. Subject IV-7 had Eisenmenger's syndrome resulting from an uncorrected ventricular septal defect (Figure 2A). Eleven of the surviving affected family members had cardiac-conduction disease, including bradycardia, atrioventricular block, atrial fibrillation, and sinus-node dysfunction, and six required permanent pacemakers.In addition to cardiac and conduction-system defects, three affected persons had congenital vascular disease: Subject V-12 had a patent ductus arteriosus, Subject V-5 had a patent ductus arteriosus and an anomalous left-coronary-artery ostium, and Subject IV-11 had a persistent left superior vena cava accompanied by increased right ventricular trabeculation.
One family member, Subject III-5, was considered to have an indeterminate diagnosis for the purposes of linkage analysis. Although a small, hemodynamically insignificant inferoposterior muscular ventricular septal defect was noted incidentally on cardiac catheterization, no skeletal abnormalities were evident either on physical examination or radiography. Clinical evaluations of Subject IV-25, who was initially reported as affected,11 demonstrated neither skeletal nor cardiac abnormalities. He was considered unaffected for these analyses.
Family B is a North American kindred, unrelated to Family A, with 31 members in three generations at risk for inheriting Holt-Oram syndrome (Figure 1B). Clinical evaluations identified 18 surviving members (10 male and 8 female) with the syndrome. Four affected family members elected not to participate in genetic studies.
All affected family members had skeletal abnormalities, which were typically more severe than those found in Family A. Seven had bilateral frank phocomelia or severe ectromelia characterized by hypoplastic humeri, radii, and clavicles, with thenar aplasia and carpal and digital deformities (Figure 2C and Figure 2D). The incidence of severe skeletal deformities (phocomelia or severe ectromelia) was significantly more frequent in affected family members of Family B (P<0.001) than in affected members of Family A.
Congenital cardiovascular disease in affected members of Family B was more mild and less frequent (P<0.001) than in Family A. Six affected family members had cardiac disease, all consisting of atrial septal defects of the ostium secundum type. Subjects II-2, III-9, and IV-9 all required surgery for their septal defects. Only Subject III-9 had conduction disease (incomplete right bundle-branch block). Congenital vascular disease was not found in any affected family members.
Genetic Analyses
Highly polymorphic short tandem-repeat sequences7,8 dispersed throughout the genome were analyzed for linkage to the Holt-Oram syndrome locus in Family A. Because two reports had described cytogenetic abnormalities on chromosomes 1412 and 2013 in patients with the syndrome, markers from these regions were selected for initial analyses. Linkage to both genomic regions was excluded (calculated lod scores, <-2.0; data not shown). Short tandem-repeat sequences were then randomly screened, and approximately 60 percent of the human genome was excluded before linkage was detected between the insulin-like growth factor I (IGF1) locus, on the long arm of chromosome 12, and the Holt-Oram syndrome locus (lod scores, >4.0; theta = 0.15). One recombination event occurred between IGF1 and the disease locus. Therefore, additional short tandem-repeat markers (PLA2, D12S76, D12S86, D12S79, DAO, D12S84, D12S78, D12S58, and D12S101) in this region were tested. The maximal two-point lod scores achieved with markers D12S79, DAO-2, and D12S84 were each greater than 6.0 (theta = 0.05) (Table 2Table 2
Two-Point Lod Scores between Chromosome 12q2 Loci and the Holt-Oram Syndrome in Families A and B.), providing odds of more than 3,000,000:1 that the gene responsible for Holt-Oram syndrome in Family A is located on chromosome 12q2.The genotypes of three family members (Subjects IV-7, IV-17, and IV-24) suggested that a recombination event had occurred between locus D12S79 and the Holt-Oram syndrome gene. Analyses also identified recombination between the DAO locus and the disease gene in Subject IV-18. Collectively, these data mapped the gene responsible for Holt-Oram syndrome to a region between D12S79 and DAO (Figure 3Figure 3
Idiogram of Chromosome 12.). With the use of loci D12S79, DAO, and D12S84, the maximal multipoint lod score was 10.1.To determine whether the gene responsible for Holt-Oram syndrome in Family A could also be mutated to produce the various clinical features found in affected members of Family B, linkage studies were performed. Two-point lod scores (Table 2) were calculated between polymorphic loci linked to Holt-Oram syndrome in Family A and the disease gene in Family B. These data, multipoint linkage analyses, and haplotype analyses of recombination events between the flanking loci mapped the disease locus in Family B to an area between D12S79 and DAO (maximal lod score, 7.3).
The maximal multipoint lod score obtained when data from both families were combined was calculated to be 16.8 in the interval between D12S79 and DAO, signifying odds of 6 × 1016:1 in favor of linkage of Holt-Oram syndrome to the chromosome 12q2 locus (Figure 3).
Discussion
These analyses demonstrate that the gene responsible for Holt-Oram syndrome (heart-hand syndrome) in two unrelated families is located on the long arm of chromosome 12 (12q2). The mutated gene segregating in Family A causes moderate-to-severe cardiac disease with relatively mild skeletal deformities. Genetic-linkage analyses demonstrate that a mutation at the same locus accounts for the mild cardiac disease and severe skeletal deformities found in Family B. We hypothesize that the disparate clinical manifestations in affected members of these families occur because of different mutations within a single gene or because of mutations in two closely linked genes. Although studies of two families cannot exclude genetic heterogeneity, these data demonstrate that the mutations within the 12q gene can account for the diverse clinical features found in patients with the Holt-Oram syndrome.
As has been noted in previous studies,2-4 there was substantial variability in the clinical expression of the disease phenotype within each family. Skeletal findings were present in every affected family member, but ranged from subtle carpal-bone abnormalities to triphalangeal or absent thumbs and frank phocomelia. Cardiac disease, when present, included dysrhythmias, mild-to-severe cardiac septal defects, or both. Interestingly, the skeletal and cardiac manifestations of disease within nuclear families in these two kindreds were frequently more severe in the offspring than in their affected parents (Table 1). Analyses of more families and precise definition of the gene defect will help to determine whether genetic anticipation accounts in part for the variable disease expression that typifies Holt-Oram syndrome.
Given the contribution of the Holt-Oram syndrome gene product to both cardiac and skeletal differentiation, candidate genes that could be mutated to cause this condition might include a wide variety of proteins. Cytokines, extracellular-matrix proteins, cytoskeletal elements, and transcription factors are all represented on chromosome 12q1. In experiments in animals, retinoic acid has been found to be involved in producing developmental limb deformities,14 and the retinoic acid-receptor gamma-subunit gene has been mapped to chromosome 12q1315. The homeotic genes (containing HOX sequences) encode proteins that appear to determine a variety of processes throughout fetal development16 and have been implicated in conduction-pathway differentiation17. The human HOX C gene also maps to chromosome 12q137. Since genetic-linkage analyses localized the disease gene to chromosome 12q2, mutations in the retinoic acid-receptor gamma-subunit and HOX C genes can be excluded as the cause of Holt-Oram syndrome.
In families with Holt-Oram syndrome linked to the chromosome 12q2 locus, prenatal genetic diagnosis will be feasible. DNA-based diagnoses will inevitably need to be coupled with noninvasive fetal imaging techniques to define phenotypic manifestations. We expect that the eventual identification of the Holt-Oram syndrome gene and disease-causing mutations will further enhance the diagnosis and management of this complex congenital disease. In addition, the identification of the genetic cause of the syndrome should expand our knowledge of molecular mechanisms that regulate limb and cardiac development.
Supported by grants from the Howard Hughes Medical Institute (to Dr. J.G. Seidman) and the Bristol-Myers Squibb Company (to Drs. J.G. Seidman and Christine Seidman). Dr. Basson is the recipient of a Bugher Fellowship from the American Heart Association. Dr. Christine Seidman is an Established Investigator of the American Heart Association.
We are indebted to the members of the two families, without whose generous assistance these studies would not have been possible; to Dr. Aaron Stern and Dr. John Gall; to Dr. Jeffrey Leiden and Dr. Elizabeth Nabel for assistance with the evaluation of the patients; and to Mr. Mohammed Miri for technical help.
Source Information
From the Cardiovascular Division, Department of Medicine (C.T.B., S.D.S., C.E.S.), and the Department of Radiology (B.W.), Brigham and Women's Hospital, Boston; Harvard Medical School, Boston (C.T.B., S.D.S., C.E.S.); the Department of Genetics and Howard Hughes Medical Institute, Harvard Medical School, Boston (G.S.C., J.G.S.); the Department of Radiology, Children's Memorial Hospital, Chicago (A.K.P.); and the Cardiovascular Division, Department of Medicine, Johns Hopkins Hospital, Baltimore (T.A.T.).
Address reprint requests to Dr. Christine Seidman at the Department of Genetics, Harvard Medical School, Alpert Bldg., Rm. 533, 200 Longwood Ave., Boston, MA 02115.
- References
References
1
McKusick VA. Mendelian inheritance in man: catalogs of autosomal dominant, autosomal recessive, and X-linked phenotypes. 10th ed. Vol. 1. Baltimore: Johns Hopkins University Press, 1992:542-3.
2
Holt M ,Oram S . Familial heart disease with skeletal malformations. Br Heart J 1960;22:236-242
CrossRef | Web of Science | Medline3
Poznanski AK ,Gall JC Jr ,Stern AM . Skeletal manifestations of the Holt-Oram syndrome. Radiology 1970;94:45-53
Web of Science | Medline4
Smith AT ,Sack GH Jr ,Taylor GJ . Holt-Oram syndrome. J Pediatr 1979;95:538-543
CrossRef | Web of Science | Medline5
Csaba E, Marta V, Endre C. Holt-Oram-syndroma. Orv Hetil 1991;132:73-8. (In Hungarian).
6
Chou YHW ,Brown EM ,Levi T , et al. The gene responsible for familial hypocalciuric hypercalcemia maps to chromosome 3q in four unrelated families. Nat Genet 1992;1:295-300
CrossRef | Web of Science | Medline7
NIH/CEPH Collaborative Mapping Group
CrossRef | Web of Science8
Weissenbach J ,Gyapay G ,Dib C , et al. A second-generation linkage map of the human genome. Nature 1992;359:794-801
CrossRef | Web of Science | Medline9
Fukui K ,Miyake Y . Molecular cloning and chromosomal localization of a human gene encoding d-amino-acid oxidase. J Biol Chem 1992;267:18631-18638
Web of Science | Medline10
Lathrop GM ,Lalouel JM ,Julier C ,Ott J . Strategies for multilocus linkage analysis in humans. Proc Natl Acad Sci U S A 1984;81:3443-3446
CrossRef | Web of Science | Medline11
Gall JC Jr ,Stern AM ,Cohen MM ,Adams MS ,Davidson RT . Holt-Oram syndrome: clinical and genetic study of a large family. Am J Hum Genet 1966;18:187-200
Web of Science | Medline12
Turleau C ,de Grouchy J ,Chavin-Colin F , et al. Two patients with interstitial del (14q), one with features of Holt-Oram syndrome: exclusion mapping of PI (alpha-1-antitrypsin). Ann Genet 1984;27:237-240
Medline13
Yang SP ,Sherman S ,Derstine JB ,Schonberg SA . Holt-Oram syndrome gene may be on chromosome 20. Pediatr Res 1990;27:Suppl:137A-137A abstract.
Web of Science14
Mendelsohn C ,Ruberte E ,Chambon P . Retinoid receptors in vertebrate limb development. Dev Biol 1992;152:50-61
CrossRef | Web of Science | Medline15
Mattei MG ,Riviere M ,Krust A , et al. Chromosomal assignment of retinoic acid receptor (RAR) genes in the human, mouse, and rat genomes. Genomics 1991;10:1061-1069
CrossRef | Web of Science | Medline16
McGinnis W ,Krumlauf R . Homeobox genes and axial patterning. Cell 1992;68:283-302
CrossRef | Web of Science | Medline17
Chan-Thomas PS ,Thompson RP ,Robert B ,Yacoub MH ,Barton PJR . Expression of homeobox genes Msx-1 (Hox-7) and Msx-2 (Hox-8) during cardiac development in the chick. J Cell Biochem Suppl 1993;17:209-209 abstract.
- Citing Articles (98)
Citing Articles
1
Masahito Oyamada, Kumiko Takebe, Yumiko Oyamada. (2012) Regulation of connexin expression by transcription factors and epigenetic mechanisms. Biochimica et Biophysica Acta (BBA) - Biomembranes
CrossRef2
A. V. Postma, V. M. Christoffels, C. R. Bezzina. (2011) Developmental aspects of cardiac arrhythmogenesis. Cardiovascular Research 91:2, 243-251
CrossRef3
Nekane Murga-Eizagaechevarria, Maria Garcia-Barcina, Esther Sarasola Diez. (2011) Holt-Oram Syndrome: Family Affected Without TBX5 Mutation and Without Phenotype Manifestations in a Probable Mutation Carrier. Revista Española de Cardiología (English Edition)
CrossRef4
Nekane Murga-Eizagaechevarria, Maria Garcia-Barcina, Esther Sarasola Diez. (2011) Síndrome de Holt Oram. Descripción de una familia afectada sin mutación del gen TBX5 ni manifestaciones en un probable transmisor. Revista Española de Cardiología
CrossRef5
Erin Kaltenbrun, Panna Tandon, Nirav M. Amin, Lauren Waldron, Chris Showell, Frank L. Conlon. (2011) Xenopus: An emerging model for studying congenital heart disease. Birth Defects Research Part A: Clinical and Molecular Teratology 91:6, 495-510
CrossRef6
David E. Arnolds, Alison Chu, Elizabeth M. McNally, Marcelo A. Nobrega, Ivan P. Moskowitz. (2011) The emerging genetic landscape underlying cardiac conduction system function. Birth Defects Research Part A: Clinical and Molecular Teratology 91:6, 578-585
CrossRef7
Kim L. McBride, Vidu Garg. (2010) Impact of Mendelian inheritance in cardiovascular disease. Annals of the New York Academy of Sciences 1214:1, 122-137
CrossRef8
Mónica Martínez-García, Isabel Lorda-Sanchez, Maria García-Hoyos, Carmen Ramos, Carmen Ayuso, María José Trujillo-Tiebas. (2010) Síndrome de Holt-Oram: descripción de 7 casos. Medicina Clínica 135:14, 653-657
CrossRef9
Epstein, Jonathan A., . (2010) Cardiac Development and Implications for Heart Disease. New England Journal of Medicine 363:17, 1638-1647
Full Text10
C. J. J. Boogerd, D. Dooijes, A. Ilgun, I. B. Mathijssen, R. Hordijk, I. M. B. H. van de Laar, P. Rump, H. E. Veenstra-Knol, A. F. M. Moorman, P. Barnett, A. V. Postma. (2010) Functional analysis of novel TBX5 T-box mutations associated with Holt-Oram syndrome. Cardiovascular Research 88:1, 130-139
CrossRef11
MW Wessels, PJ Willems. (2010) Genetic factors in non-syndromic congenital heart malformations. Clinical Genetics 78:2, 103-123
CrossRef12
Antonella Cecchetto, Alessandra Rampazzo, Annalisa Angelini, Lucia Dal Bianco, Massimo Padalino, Giovanni Stellin, Luciano Daliento. (2010) From molecular mechanisms of cardiac development to genetic substrate of congenital heart diseases. Future Cardiology 6:3, 373-393
CrossRef13
Jan Vseticka, Zuzana Gattnarova, Ivo Marik, Kazimierz Kozlowski. (2010) Ultrasound diagnosis of severe mesomelic dysplasia in two fetuses, associated with increased neck translucency and tetralogy of Fallot in one and cystic hygroma in the other. American Journal of Medical Genetics Part A 152A:4, 815-818
CrossRef14
Scott H. Kozin. (2010) Embryology of Congenital Differences. Journal of Pediatric Orthopaedics 30, S31-S34
CrossRef15
Hilma Holm, Daniel F Gudbjartsson, David O Arnar, Gudmar Thorleifsson, Gudmundur Thorgeirsson, Hrafnhildur Stefansdottir, Sigurjon A Gudjonsson, Aslaug Jonasdottir, Ellisiv B Mathiesen, Inger Njølstad, Audhild Nyrnes, Tom Wilsgaard, Erin M Hald, Kristian Hveem, Camilla Stoltenberg, Maja-Lisa Løchen, Augustine Kong, Unnur Thorsteinsdottir, Kari Stefansson. (2010) Several common variants modulate heart rate, PR interval and QRS duration. Nature Genetics 42:2, 117-122
CrossRef16
Na XIN, Guang-Rong QIU, Li-Guo GONG, Xiao-Yan XU, Kai-Lai SUN. (2009) The mechanism of TBX5 abnormal expression in simple con-genital heart disease. Hereditas (Beijing) 31:4, 374-380
CrossRef17
B. Saccomanni. (2009) Fracture of the Proximal Pole of the Bipartite Carpal Scaphoid: A Probable Holt–Oram-like Syndrome. HAND 4:2, 140-144
CrossRef18
Alex V. Postma, Lukas R.C. Dekker, Alexandre T. Soufan, Antoon F.M. Moorman. (2009) Developmental and Genetic Aspects of Atrial Fibrillation. Trends in Cardiovascular Medicine 19:4, 123-130
CrossRef19
Sorahiro Sunagawa, Akihiko Kikuchi, Yoko Sano, Mariko Kita, Kyoko Ono, Tsuguhiro Horikoshi, Kimiyo Takagi, Hiroshi Kawame. (2009) Prenatal diagnosis of Holt-Oram syndrome: Role of 3-D ultrasonography. Congenital Anomalies 49:1, 38-41
CrossRef20
Paweł Stańczak, Joanna Witecka, Anna Szydło, Ewa Gutmajster, Małgorzata Lisik, Aleksandra Auguściak-Duma, Maciej Tarnowski, Tomasz Czekaj, Hanna Czekaj, Aleksander L Sieroń. (2009) Mutations in mammalian tolloid-like 1 gene detected in adult patients with ASD. European Journal of Human Genetics 17:3, 344-351
CrossRef21
Meenakshi Maitra, Marie K. Schluterman, Haley A. Nichols, James A. Richardson, Cecilia W. Lo, Deepak Srivastava, Vidu Garg. (2009) Interaction of Gata4 and Gata6 with Tbx5 is critical for normal cardiac development. Developmental Biology 326:2, 368-377
CrossRef22
Mário Henrique Girão Faria, Silvia Helena Barem Rabenhorst, Alexandre da Costa Pereira, José Eduardo Krieger. (2008) A novel TBX5 missense mutation (V263M) in a family with atrial septal defects and postaxial hexodactyly. International Journal of Cardiology 130:1, 30-35
CrossRef23
Gerda Hofstetter, Nicole Concin, Christian Marth, Tuula Rinne, Martin Erdel, Andreas Janecke. (2008) Genetic analyses in a variant of Mayer-Rokitansky-Kuster-Hauser syndrome (MURCS association). Wiener klinische Wochenschrift 120:13-14, 435-439
CrossRef24
Angela E Lin, Craig T Basson, Elizabeth Goldmuntz, Pilar L Magoulas, Deborah A McDermott, Donna M McDonald-McGinn, Elspeth McPherson, Colleen A Morris, Jacqueline Noonan, Catherine Nowak, Mary Ella Pierpont, Reed E Pyeritz, Alan F Rope, Elaine Zackai, Barbara R Pober. (2008) Adults with genetic syndromes and cardiovascular abnormalities: clinical history and management. Genetics in Medicine 10:7, 469-494
CrossRef25
L. Garavelli, D. De Brasi, R. Verri, E. Guareschi, F. Cariola, D. Melis, G. Calcagno, F. Salvatore, S. Unger, G. Sebastio, G. Albertini, F. Rivieri, F. Soli, A. Superti-Furga, M. Gentile. (2008) Holt–Oram syndrome associated with anomalies of the feet. American Journal of Medical Genetics Part A 146A:9, 1185-1189
CrossRef26
Jan Nemec, Steven Heifetz. (2008) Persistence of Left Supracardinal Vein in an Adult Patient with Heart–Hand Syndrome and Cardiac Pacemaker. Congenital Heart Disease 3:3, 219-222
CrossRef27
2008. References. , 103-109.
CrossRef28
Ai YOSHIHARA, Akiyo TANABE, Hiroshi SAITO, Naomi HIZUKA, Akira ISHIZAWA, Reiko HORIKAWA, Kazue TAKANO. (2008) A Case of Malignant Pheochromocytoma with Holt-Oram Syndrome. Endocrine Journal 55:1, 153-159
CrossRef29
Benoit G. Bruneau. 2007. Deciphering the Basis for Congenital Heart Defects Using a Mouse Model of Holt-oram Syndrome. , 121-124.
CrossRef30
Cathy J. Hatcher, Min-Su Kim, David Pennisi, Yan Song, Nata Diman, Marsha M. Goldstein, Takashi Mikawa, Craig T. Basson. 2007. TBX5 Regulates Cardiac Cell Behavior During Cardiogenesis. , 27-30.
CrossRef31
Philippe Debeer, Valerie Race, Marc Gewillig, Koen Devriendt, Jean-Pierre Frijns. (2007) Novel TBX5 Mutations in Patients with Holt-Oram Syndrome. Clinical Orthopaedics and Related Research 462, 20-26
CrossRef32
Ivan P.G. Moskowitz, Jae B. Kim, Meredith L. Moore, Cordula M. Wolf, Michael A. Peterson, Jay Shendure, Marcelo A. Nobrega, Yoshifumi Yokota, Charles Berul, Seigo Izumo, J.G. Seidman, Christine E. Seidman. (2007) A Molecular Pathway Including Id2, Tbx5, and Nkx2-5 Required for Cardiac Conduction System Development. Cell 129:7, 1365-1376
CrossRef33
Yu-Ru Tseng, Yi-Ning Su, Frank Leigh Lu, Suh-Fang Jeng, Wu-Shiun Hsieh, Chien-Yi Chen, Hung-Chieh Chou, Steven Shinn-Forng Peng. (2007) Holt–Oram syndrome with right lung agenesis caused by a de novo mutation in theTBX5 gene. American Journal of Medical Genetics Part A 143A:9, 1012-1014
CrossRef34
Kate Montgomery, Raju Kucherlapati. 2007. Chromosome 12. .
CrossRef35
Cathy J. Hatcher, Deborah A. McDermott. (2006) Using the TBX5 transcription factor to grow and sculpt the heart. American Journal of Medical Genetics Part A 140A:13, 1414-1418
CrossRef36
Kazuko Koshiba-Takeuchi, Jun K Takeuchi, Eric P Arruda, Irfan S Kathiriya, Rong Mo, Chi-chung Hui, Deepak Srivastava, Benoit G Bruneau. (2006) Cooperative and antagonistic interactions between Sall4 and Tbx5 pattern the mouse limb and heart. Nature Genetics 38:2, 175-183
CrossRef37
Krista L. Clark, Katherine E. Yutzey, D. Woodrow Benson. (2006) TRANSCRIPTION FACTORS AND CONGENITAL HEART DEFECTS. Annual Review of Physiology 68:1, 97-121
CrossRef38
Koenraad Smets, Geert Mortier, Aleksandra Zecic. (2005) Unexpected Severe Respiratory Insufficiency in a Newborn with Holt–Oram Syndrome. Journal of Perinatology 25:11, 745-746
CrossRef39
DEBORAH A. MCDERMOTT, MICHAEL C. BRESSAN, JIE HE, JOSEPH S. LEE, SALIM AFTIMOS, MARTINA BRUECKNER, FRED GILBERT, GAIL E. GRAHAM, MARK C. HANNIBAL, JEFFREY W. INNIS, MARY ELLA PIERPONT, ANNICK RAAS-ROTHSCHILD, ALAN L. SHANSKE, WENDY E. SMITH, ROBERT H. SPENCER, MARTIN G. ST. JOHN-SUTTON, LIONEL VAN MALDERGEM, DARREL J. WAGGONER, MATTHEW WEBER, CRAIG T. BASSON. (2005) TBX5 Genetic Testing Validates Strict Clinical Criteria for Holt-Oram Syndrome. Pediatric Research 58:5, 981-986
CrossRef40
Deborah A. McDermott, Jie He, Yan S. Song, Isaac Kligman, Craig T. Basson. (2005) Update: PGD and Holt-Oram syndrome. American Journal of Medical Genetics Part A 136A:2, 223-223
CrossRef41
Nathalie Le Meur, Alice Goldenberg, Christine Michel-Adde, Val
rie Drouin-Garraud, G
CrossRef42
Claudia Gruenauer-Kloevekorn, Martin B. Reichel, G.I. W. Duncker, Ursula G. Froster. (2005) Molecular Genetic and Ocular Findings in Patients with Holt-Oram Syndrome. Ophthalmic Genetics 26:1, 1-8
CrossRef43
S. White, M. Parry, K. Henderson. (2005) Anaesthesia for total hip replacement in a patient with Holt–Oram syndrome. European Journal of Anaesthesiology 20:4, 336
CrossRef44
Timothy F. Plageman, Katherine E. Yutzey. (2005) T-box genes and heart development: Putting the ?T? in heart. Developmental Dynamics 232:1, 11-20
CrossRef45
Eva Pajkrt, Boaz Weisz, Helen V. Firth, Lyn S. Chitty. (2004) Fetal cardiac anomalies and genetic syndromes. Prenatal Diagnosis 24:13, 1104-1115
CrossRef46
Brett S. Harris, Patrick Y. Jay, Mary S. Rackley, Seigo Izumo, Terrence X. O'Brien, Robert G. Gourdie. (2004) Transcriptional regulation of cardiac conduction system development: 2004 FASEB cardiac conduction system minimeeting, Washington, DC. The Anatomical Record 280A:2, 1036-1045
CrossRef47
Vinciane Gaussin. (2004) Offbeat mice. The Anatomical Record 280A:2, 1022-1026
CrossRef48
Guifeng Sun, Lisa E. Lewis, Xu Huang, Quang Nguyen, Christopher Price, Taosheng Huang. (2004) TBX5, a gene mutated in Holt-Oram syndrome, is regulated through a GC box and T-box binding elements (TBEs). Journal of Cellular Biochemistry 92:1, 189-199
CrossRef49
Alessandro D. Mori, Benoit G. Bruneau. (2004) TBX5 mutations and congenital heart disease: Holt-Oram syndrome revealed. Current Opinion in Cardiology 19:3, 211-215
CrossRef50
Michael V. Zaragoza, Lisa E. Lewis, Guifeng Sun, Eric Wang, Ling Li, Ilham Said-Salman, Laura Feucht, Taosheng Huang. (2004) Identification of the TBX5 transactivating domain and the nuclear localization signal. Gene 330, 9-18
CrossRef51
Jie He, Deborah A. McDermott, Yan Song, Fred Gilbert, Isaac Kligman, Craig T. Basson. (2004) Preimplantation genetic diagnosis of human congenital heart malformation and Holt-Oram syndrome. American Journal of Medical Genetics 126A:1, 93-98
CrossRef52
Ronny I. Drapkin, David R. Genest, Lewis B. Holmes, Taosheng Huang, Sara O. Vargas. (2003) Unilateral Transverse Arm Defect with Subterminal Digital Nubbins. Pediatric and Developmental Pathology 6:4, 348-354
CrossRef53
A BRASSINGTON, S SUNG, R TOYDEMIR, T LE, A ROEDER, A RUTHERFORD, F WHITBY, L JORDE, M BAMSHAD. (2003) Expressivity of Holt-Oram Syndrome Is Not Predicted by TBX5 Genotype. The American Journal of Human Genetics 73:1, 74-85
CrossRef54
A. P. Klockgether-Radke, A. Thudium, A. Frerichs, D. Kettler, G. Hellige. (2003) High-dose midazolam and the attenuation of the contractile response to vasoconstrictors in coronary artery segments. European Journal of Anaesthesiology 20:4, 289-293
CrossRef55
S. White, M. Parry, K. Henderson. (2003) Anaesthesia for total hip replacement in a patient with Holt-Oram syndrome. European Journal of Anaesthesiology 20:4, 336-338
CrossRef56
J.-P. Estebe, P. Le Corre, R. Clément, L. Du Plessis, F. Chevanne, R. Le Verge, C. Ecoffey. (2003) Effect of dexamethasone on motor brachial plexus block with bupivacaine and with bupivacaine-loaded microspheres in a sheep model. European Journal of Anaesthesiology 20:4, 305-310
CrossRef57
N. W. F. Linton, R. A. F. Linton. (2003) Haemodynamic response to a small intravenous bolus injection of epinephrine in cardiac surgical patients. European Journal of Anaesthesiology 20:4, 298-304
CrossRef58
D. W. Green. (2003) The Massachusetts General Hospital Handbook of Pain Management, 2nd edition: Jane Ballantyne (ed). Lippincott, Williams & Wilkins: Philadelphia, USA, 2002, 597 pp; indexed, illustrated. ISBN: 0-7817-2377-9; Price US $39.95, £30.00. European Journal of Anaesthesiology 20:4, 341-342
CrossRef59
M. Kaya, O. Sariyildiz, D. Karakus, G. Özalp, D. N. Kadiogullari. (2003) Tramadol versus meperidine in the treatment of shivering during spinal anaesthesia. European Journal of Anaesthesiology 20:4, 332-333
CrossRef60
J. Dahn, K. F. Waschke, B. A. Stuck, K. Hörmann. (2003) Fluid shifts in anaphylaxis. European Journal of Anaesthesiology 20:4, 331-331
CrossRef61
M. Fattorutto, O. Pradier, J. L. Jansens, B. Ickx, L. Barvais. (2003) Plateletpheresis the day before cardiac surgery and the impairment of platelet function. European Journal of Anaesthesiology 20:4, 338-340
CrossRef62
K. Payne, E. W. Moore, R. A. Elliott, J. K. Moore, G. A. McHugh. (2003) Anaesthesia for day case surgery: a survey of paediatric clinical practice in the UK. European Journal of Anaesthesiology 20:4, 325-330
CrossRef63
A. Manohin, M. Manohin. (2003) Important physical principles in anaesthesiology. European Journal of Anaesthesiology 20:4, 259-281
CrossRef64
S. M. White. (2003) Clinical Data Interpretation in Anaesthesia and Intensive Care: S. Bonner, C. Dodds (eds). Churchill Livingston: London, UK, 2002, 278 pp; indexed, illustrated. ISBN: 0-443-06453-9; Price £24.99. European Journal of Anaesthesiology 20:4, 342-342
CrossRef65
K. Hellwagner, A. Holzer, B. Gustorf, K. Schroegendorfer, M. Greher, M. Weindlmayr-Goettel, B. Saletu, F. X. Lackner. (2003) Recollection of dreams after short general anaesthesia: influence on patient anxiety and satisfaction. European Journal of Anaesthesiology 20:4, 282-288
CrossRef66
S. Goel, N. Bhardwaj, V. K. Grover. (2003) Intrathecal fentanyl added to intrathecal bupivacaine for day case surgery: a randomized study. European Journal of Anaesthesiology 20:4, 294-297
CrossRef67
K. Payne, E. W. Moore, R. A. Elliott, B. J. Pollard, G. A. McHugh. (2003) Anaesthesia for day case surgery: a survey of adult clinical practice in the UK. European Journal of Anaesthesiology 20:4, 311-324
CrossRef68
T. P. Weber, H. Van Aken, B. E. Kehrel, A. Meiβner, T. Brüssel, V. Bullmann, W. Winkelmann, W. Heindel, N. Rolf. (2003) Epidural bleed and quadriplegia due to acquired platelet dysfunction unrelated to multiple spinal and epidural puncture. European Journal of Anaesthesiology 20:4, 333-336
CrossRef69
T. HUANG, J.E LOCK, A.C MARSHALL, C. BASSON, J.G. SEIDMAN, C.E. SEIDMAN. (2002) Causes of Clinical Diversity in Human TBX5 Mutations. Cold Spring Harbor Symposia on Quantitative Biology 67:1, 115-120
CrossRef70
Carl J. Vaughan, Craig T. Basson. (2001) Molecular determinants of atrial and ventricular septal defects and patent ductus arteriosus. American Journal of Medical Genetics 97:4, 304-309
CrossRef71
Mary Ella M. Pierpont, Roger R. Markwald, Angela E. Lin. (2001) Genetic aspects of atrioventricular septal defects. American Journal of Medical Genetics 97:4, 289-296
CrossRef72
Bruce D. Gelb. (2001) Genetic basis of syndromes associated with congenital heart disease. Current Opinion in Cardiology 16:3, 188-194
CrossRef73
Victor A Ferrari, Craig H Scott, George A Holland, Leon Axel, Martin St. John Sutton. (2001) Ultrafast three-dimensional contrast-enhanced magnetic resonance angiography and imaging in the diagnosis of partial anomalous pulmonary venous drainage. Journal of the American College of Cardiology 37:4, 1120-1128
CrossRef74
Bjorn R. Olsen, Anthony M. Reginato, Wenfang Wang. (2000) B
ONE DEVELOPMENT . Annual Review of Cell and Developmental Biology 16:1, 191-220
CrossRef75
Jinfu Yang, Dongxu Hu, Jiahui Xia, Yifeng Yang, Bangliang Ying, Jianguo Hu, Xinmin Zhou. (2000) Three novel TBX5 mutations in Chinese patients with Holt-Oram syndrome. American Journal of Medical Genetics 92:4, 237-240
CrossRef76
Mamta N. Muranjan, Late B. A. Bharucha. (2000) Unusual hand malformations with cardiac defects—A variant of heart-hand syndrome IV. The Indian Journal of Pediatrics 67:5, 392-394
CrossRef77
Azra Alizad, James B Seward. (2000) Echocardiographic features of genetic diseases: Part 3. Shunts. Journal of the American Society of Echocardiography 13:3, 248-253
CrossRef78
Giuseppe Cocco, Thierry Ettlin, Hans Ruedi Baumeler. (2000) The effect of amlodipine and enalapril on blood pressure and neurohumoral activation in hypertensive patients with ribbing's disease (multiple epiphysal dystrophy). Clinical Cardiology 23:2, 109-114
CrossRef79
Brickner, M. Elizabeth, Hillis, L. David, Lange, Richard A., . (2000) Congenital Heart Disease in Adults. New England Journal of Medicine 342:4, 256-263
Full Text80
Bruce D. Gelb, Jian Zhang, Robert J. Sommer, Jared M. Wasserman, Milton J. Reitman, Judith P. Willner. (1999) Familial patent ductus arteriosus and bicuspid aortic valve with hand anomalies: A novel heart-hand syndrome. American Journal of Medical Genetics 87:2, 175-179
CrossRef81
M BAMSHAD, T LE, W WATKINS, M DIXON, B KRAMER, A ROEDER, J CAREY, S ROOT, A SCHINZEL, L VANMALDERGEM. (1999) The Spectrum of Mutations in TBX3: Genotype/Phenotype Relationship in Ulnar-Mammary Syndrome. The American Journal of Human Genetics 64:6, 1550-1562
CrossRef82
JACK MCKEE, THOMAS D. CONLEY, J. DAVID TALLEY. (1999) IT FITS! (Intelligence Transfer: From Images to Solutions) The Holt-Oram Syndrome. Journal of Interventional Cardiology 12:2, 163-163
CrossRef83
CAROLINE S. MAH, CARL J. VAUGHAN, CRAIG T. BASSON. (1999) Advances in the Molecular Genetics of Congenital Structural Heart Disease. Genetic Testing 3:2, 157-172
CrossRef84
Rolf G. Bennhagen, Samuel Menahem. (1998) Holt-Oram syndrome and multiple ventricular septal defects: an association suggesting a possible genetic marker?. Cardiology in the Young 8:01,
CrossRef85
V. Sansone, R. C. Griggs, G. Meola, L. J. Pt
CrossRef86
Michael Bamshad, Robert C. Lin, David J. Law, W. Scott Watkins, Patrycja A. Krakowiak, Mary E. Moore, Piergiorgio Franceschini, Roberto Lala, Lewis B. Holmes, Tom C. Gebuhr, Benoit G. Bruneau, Albert Schinzel, J. G. Seidman, Christine E. Seidman, Lynn B. Jorde. (1997) Mutations in human TBX3 alter limb, apocrine and genital development in ulnar-mammary syndrome. Nature Genetics 16:3, 311-315
CrossRef87
Quan Yi Li, Ruth A. Newbury-Ecob, Jonathan A. Terrett, David I. Wilson, Andrew R.J. Curtis, Cheong Ho Yi, Tom Gebuhr, Philip J. Bullen, Stephen C. Robson, Tom Strachan, Damien Bonnet, Stanislas Lyonnet, Ian D. Young, J. Alexander Raeburn, Alan J. Buckler, David J. Law, J. David Brook. (1997) Holt-Oram syndrome is caused by mutations in TBX5, a member of the Brachyury (T) gene family. Nature Genetics 15:1, 21-29
CrossRef88
Craig T. Basson1, David R. Bachinsky, Robert C. Lin, Tatjana Levi, Jacob A. Elkins, Johann Soults, David Grayzel, Elena Kroumpouzou, Thomas A. Traill, Janine Leblanc-Straceski, Beatrice Renault, Raju Kucherlapati, Seidman J.G, Christine E. Seidman. (1997) Mutations in human cause limb and cardiac malformation in Holt-Oram syndrome. Nature Genetics 15:1, 30-35
CrossRef89
Arnold W. Strauss, Mark C. Johnson. (1996) The genetic basis of pediatric cardiovascular disease. Seminars in Perinatology 20:6, 564-576
CrossRef90
Michael Bamshad, Susan Root, John C. Carey. (1996) Clinical analysis of a large kindred with the Pallister ulnar-mammary syndrome. American Journal of Medical Genetics 65:4, 325-331
CrossRef91
Lisa J. Sletten, Mary Ella M. Pierpont. (1996) Variation in severity of cardiac disease in Holt-Oram syndrome. American Journal of Medical Genetics 65:2, 128-132
CrossRef92
Bruno Dallapiccola, Bruno Marino, Maria Cristina Digilio, Rita Mingarelli, Giuseppe Novelli, Aldo Giannotti. (1996) The mendelian basis of congenital heart defects. Cardiology in the Young 6:04,
CrossRef93
DAVID F. GORDON, JEANETTE WAGNER, BRENT L. ATKINSON, MATT CHIONO, REBECCA BERRY, JAMES SIKELA, ARTHUR GUTIERREZ-HARTMANN. (1996) Human Cart-1: Structural Organization, Chromosomal Localization, and Functional Analysis of a Cartilage-Specific Homeodomain cDNA. DNA and Cell Biology 15:7, 531-541
CrossRef94
Britz-Cunningham, Scott H., Shah, Maithili M., Zuppan, Craig W., Fletcher, William H., . (1995) Mutations of the Connexin43 Gap-Junction Gene in Patients with Heart Malformations and Defects of Laterality. New England Journal of Medicine 332:20, 1323-1330
Full Text95
Mark C. Johnson, R. Mark Payne, James W. Grant, Arnold W. Strauss. (1995) The Genetic Basis of Paediatric Heart Disease. Annals of Medicine 27:3, 289-300
CrossRef96
Melinda L Marks, Sandra L Whisler, Carol Clericuzio, Mark Keating. (1995) A new form of long QT syndrome associated with syndactyly. Journal of the American College of Cardiology 25:1, 59-64
CrossRef97
C. Ruth Jamieson, Ineke van der Burgt, Angela F. Brady, Margo van Reen, Madiha M. Elsawi, Frans Hol, Steve Jeffery, Michael A. Patton, Edwin Mariman. (1994) Mapping a gene for Noonan syndrome to the long arm of chromosome 12. Nature Genetics 8:4, 357-360
CrossRef98
Dietz, Harry C., , Pyeritz, Reed E., . (1994) Molecular Biology -- To the Heart of the Matter. New England Journal of Medicine 330:13, 930-932
Full Text
