Original Article
Loss of The Normal NF1 Allele from the Bone Marrow of Children with Type 1 Neurofibromatosis and Malignant Myeloid Disorders
N Engl J Med 1994; 330:597-601March 3, 1994
- Abstract
Background
Children with type 1 neurofibromatosis (NF-1) are at increased risk for malignant myeloid disorders. Analysis of the NF-1 gene (NF1) suggests that the function of its product, neurofibromin, is reduced in affected persons and that NF1 belongs to the tumor-suppressor class of recessive cancer genes. This model is consistent with evidence that neurofibromin accelerates the intrinsic guanosine triphosphate-hydrolyzing activity of the Ras family of regulatory proteins. Loss of constitutional heterozygosity has not been reported in the benign tumors associated with NF-1, however, and has only been detected in a few malignant neural-crest tumors and in some tumor-derived cell lines.
Methods
We studied DNA extracted from the bone marrow of 11 children with NF-1 in whom malignant myeloid disorders developed and from parental leukocytes. We used a series of polymorphic markers within and near NF1 to determine whether leukemogenesis was associated with structural alterations of the gene.
Results
Bone marrow samples from five patients showed loss of heterozygosity. In each case, the NF1 allele was inherited from a parent with NF-1 and the normal allele was deleted.
Conclusions
These data provide evidence that NF1 may function as a tumor-suppressor allele in malignant myeloid diseases in children with NF-1 and that neurofibromin is a regulator of Ras in early myelopoiesis.
Source Information
From the Department of Pediatrics, University of California, San Francisco (K.M.S., D.P., K.O.); the Department of Pathology, University of Texas Health Science Center, San Antonio (P.O.); Onyx Pharmaceuticals, Richmond, Calif. (G.A.M., F.M.); and the Division of Pediatric Oncology, Children's National Medical Center, Washington, D.C. (P.D.).
Address reprint requests to Dr. Shannon at the Department of Pediatrics, University of California, Rm. U-432, San Francisco, CA 94143-0724.
Media in This Article
Figure 1
Loss of Heterozygosity within and near NF1 in Bone Marrow Samples from the Patients.Article Activity
- Article
Proteins encoded by the RAS family of proto-oncogenes regulate cellular growth and differentiation by cycling between an active state in which they are bound to guanosine triphosphate (Ras-GTP) and an inactive state in which they are bound to guanosine diphosphate (Ras-GDP)1,2. During the development of cancer in humans, these genes commonly acquire activating point mutations that perturb the biochemical activity of Ras proteins by elevating the level of Ras-GTP3. Yeast and mammalian GTPase-activating proteins normally regulate the biologic activity of Ras proteins by accelerating the hydrolysis of GTP. Because it is Ras-GTP that actively transduces signals, GTPase-activating proteins act (at least in part) as negative regulators of Ras function.
Neurofibromin, the protein encoded by the gene that is mutated in patients with the autosomal dominant genetic disorder neurofibromatosis type 1 (NF-1), shows sequence homology with yeast and mammalian GTPase-activating proteins4-6. Moreover, the GTPase-activating protein domain of neurofibromin binds to Ras and accelerates the hydrolysis of GTP at physiologically relevant concentrations4,7,8. Patients with NF-1 are at increased risk for certain benign and malignant neoplasms; these tumors primarily arise in cells derived from the embryonic neural crest9. Taken together, the strong association of activating RAS mutations with oncogenesis, the increased risk of certain malignant conditions in patients with NF-1, and the biochemical activity of neurofibromin on Ras proteins suggest that NF1 belongs to the tumor-suppressor class of recessive cancer genes10. This model predicts that acquired genetic alterations that inactivate the single normal NF1 allele contribute to the formation of cancer in persons with NF-1. Recent data derived from structural and biochemical studies of malignant tumors removed from patients with NF-1 support the hypothesis that NF1 functions as a tumor suppressor in neural-crest cells11-17.
Children with NF-1 are predisposed to malignant myeloid diseases, particularly preleukemic myelodysplastic syndrome and myeloproliferative syndrome (MPS). These disorders are characterized by deregulated clonal proliferation of immature hematopoietic cells that show some myeloid differentiation in vivo18. Juvenile chronic myelogenous leukemia and monosomy 7 syndrome of the bone marrow account for most cases of MPS in children. These two disorders share many features, including a similar age of onset, a tendency to affect boys, prominent enlargement of liver and spleen, leukocytosis, the absence of the Philadelphia chromosome, and a poor prognosis, with either progression to acute myelogenous leukemia (AML) or death from intercurrent problems18. Although MPS is an uncommon complication of NF-1 in childhood, NF-1 constitutes as many as 10 percent of the spontaneous cases of MPS in children18-21. The association between NF-1 and MPS in childhood is particularly intriguing because these malignant conditions typically appear early in life and affect a cell line not derived from neural-crest cells, and because oncogenic RAS mutations occur frequently in MPS and AML but not in neural-crest tumors3,22. We have examined DNA samples from 11 families in which a malignant myeloid disorder developed in a child with NF-1 and present data implicating NF1 as a tumor suppressor in hematopoietic cells of the myeloid lineage.
Methods
We studied 10 boys and 1 girl with NF-1 and MPS (9 patients) or AML (2 patients) who were treated at pediatric referral centers. Parental DNA was used for comparison studies. The epidemiologic and clinical features of the patients are summarized in Table 1Table 1
Features of Children with NF-1 and Malignant Myeloid Disorders.. Bone marrow samples from the four patients with monosomy 7 (Patients 3, 4, 5, and 6) were studied previously with probes linked to NF1, and none showed loss of heterozygosity21. We examined bone marrow samples from all children with NF-1 and malignant myeloid disorders for whom parental DNA was available for comparison studies. The patients were referred by pediatric oncologists throughout North America between 1989 and 1993. The experimental procedures were approved by the institutional review board of the University of California, San Francisco, and informed consent was obtained from the families who participated.We prepared DNA from peripheral-blood samples from the parents and from bone marrow from the patients using standard methods, as described elsewhere21,23. Southern blotting and hybridization with complementary DNA probes were performed as previously described,21,23 except that we transferred digested DNA samples from agarose gels to nylon membranes (Hybond N+ membranes, Amersham) under alkaline conditions according to the manufacturer's instructions. The membranes were rinsed twice in 2 × saline sodium citrate buffer (0.3 M sodium chloride and 0.03 M sodium citrate) before they were hybridized.
We examined five sequence polymorphisms within NF1: probes AE2524 and EVI-2B25 identify restriction-fragment-length polymorphisms on Southern blots, whereas EVI-20 and the markers described by Xu and associates26 and Andersen et al.27 consist of variable numbers of short nucleotide repeats and are detected by oligonucleotide-directed amplification with the polymerase chain reaction (PCR), followed by gel electrophoresis. A sixth marker, UT172, is a polymorphic Alu repeat located approximately 1.5 Mb centromeric of NF1. We also used two markers from the short arm of chromosome 17 to examine blood and marrow samples from these families: probe YNZ22 is located near the p53 tumor-suppressor gene,28 and a pair of oligonucleotide primers detect an intragenic p53 polymorphism by PCR29. The investigation of these samples for loss of heterozygosity was complicated by the fact that very little DNA was available from some patients and by the fact that we had no source of normal tissues in most cases and therefore assessed loss of heterozygosity by comparing parental DNA with patient DNA obtained from bone marrow.
DNA samples were amplified in a DNA Thermocycle machine (Perkin-Elmer Cetus). We performed PCR in reaction mixtures that included 10 pM each of 3' and 5' primers, 100 ng of target genomic DNA, 1 unit of Taq polymerase (AmpliTaq, Cetus), and 100 micro M (final concentration) of deoxynucleotides in a final reaction volume of 50 microliters. We incorporated [33P]deoxy-ATP into the DNA fragments generated in the PCR procedure by adding 2 microliters (10 micro Ci) of [33P]deoxy-ATP per 500 microliters of the reaction mixtures and by decreasing the concentrations of unlabeled deoxy-ATP to 50 mM. In some experiments, we end-labeled the 5' oligonucleotide primer with [32P]γ-ATP before performing PCR instead of incorporating [33P]deoxy-ATP during the amplification process. Labeled PCR products were separated on sequencing gels (measuring 0.4 mm by 20 mm by 60 mm) run at 60 to 80 W of constant power for two to four hours. The gels were placed in plastic wrap and exposed to x-ray film for one to five days at room temperature.
The EVI-20 polymorphism was detected with forward primer 5'CCCATACCTAGTTCTTAAAGTCTGT3' and reverse primer 5'TAACAATTGTGGAACTGCAGCAATTATT3'. Amplification consisted of 26 cycles of denaturation at 94 °C for one minute, annealing at 67 °C for one minute, and extension at 72 °C for one minute; the magnesium chloride concentration was 2 mM, and the alleles were detected on a gel containing 5 percent acrylamide, 6 M urea, and 32 percent deionized formamide. We tested the amplification products on a 5 percent acrylamide minigel (measuring 1.0 mm by 10 cm by 10 cm) before loading the large gels and performed four to eight additional cycles of PCR if the products were not visualized. This procedure minimized the amplification of background products. EVI-20 detects four common alleles ranging from 200 to 210 base pairs (bp). The UT172 polymorphism was detected with forward primer 5'GGTGAAAGAGCAAGACTCTGTCAC3' and reverse primer 5'CCCCTTGATTGTAAGCNACAGAAAC3'. Amplification consisted of 32 cycles of denaturation at 94 °C for 45 seconds, annealing at 52 °C for 45 seconds, and extension at 72 °C for 45 seconds; the magnesium chloride concentration was 2.5 mM, and the alleles were detected on a gel containing 6 percent acrylamide, 6 M urea, and 10 percent deionized formamide. UT172 detects four common alleles ranging from 100 to 120 bp. To detect the other loci, we used amplification techniques described by Xu et al.,26 Andersen et al.,27 and Futreal et al.,29 as recommended by the authors.
Results
Analysis of DNA from all 11 families was informative at one or more polymorphic sites within NF1. Analysis of bone marrow showed that heterozygosity was retained in six patients (Patients 3, 4, 5, 7, 9, and 10) and that a parental NF1 allele was lost in five others (Patients 1, 2, 6, 8, and 11 in Table 1) (Figure 1Figure 1
Loss of Heterozygosity within and near NF1 in Bone Marrow Samples from the Patients.). All five children with loss of heterozygosity had familial NF-1, and in each case the bone marrow retained the NF1 allele inherited from the affected parent. The bone marrow of Patient 1 had loss of heterozygosity at all five intragenic loci (Figure 1A). The absence of the normal paternal AE25 fragment in the bone marrow from this patient with juvenile chronic myelogenous leukemia directly demonstrates a structural deletion affecting the NF1 coding region. Two of the five bone marrow samples showing loss of heterozygosity within NF1 (Patients 6 and 8) also showed loss of heterozygosity at UT172; analysis of the other three samples with this marker was uninformative.The p53 tumor-suppressor gene, located on the short arm of chromosome 17, is the most common target for loss-of-function mutations in human cancers30. NF1 is also on chromosome 17, at band q11.2. We therefore examined bone marrow samples from the patients with probe YNZ2228 (located near p53) and at a polymorphic site within p5329. As shown in Table 1, analysis of 9 of 11 bone marrow samples (including all 5 showing loss of heterozygosity at NF1) with one of these markers was informative, and all demonstrated heterozygosity.
These results in patients with NF-1 suggested that NF1 might be a target for acquired mutations in children with MPS and AML who do not have NF-1. To address this question, we used the four NF1 polymorphisms that can be detected by PCR to study 27 consecutive children with MPS and monosomy 7. Analysis of 25 of the samples was informative. All 25 bone marrow samples retained both parental alleles (data not shown).
Discussion
Our results provide evidence that NF1 acts as a tumor suppressor in myeloid cells in vivo, since bone marrow samples from children with NF-1 and malignant myeloid disorders showed a high frequency of loss of heterozygosity at NF1, consistently retained the mutant NF1 allele of a parent with clinical neurofibromatosis, and remained heterozygous in the p53 region. These data suggest that neurofibromin is essential for growth regulation in a cell line not derived from neural-crest cells. Our results provide a coherent model that accounts for three independent clinical and experimental observations in childhood MPS. First, data implicating NF1 as a tumor-suppressor allele in the pathogenesis of these leukemias readily explain the markedly increased incidence of MPS in children with NF-118-21. Second, activating RAS mutations are common in both AML and adult preleukemia3,22 and have been reported in some children with MPS31,32. Mutations of the NF1 and RAS genes might have the same biochemical consequences for cell growth (i.e., increased levels of Ras-GTP). Third, bone marrow cells from children with juvenile chronic myelogenous leukemia and monosomy 7 exhibit abnormal growth characteristics in culture systems that support the development of colonies derived from hematopoietic progenitors33-35. Cells obtained from patients with juvenile chronic myelogenous leukemia and monosomy 7 form colonies in the absence of exogenous growth factors. Recent data indicate that these cells also have pronounced and selective hypersensitivity to granulocyte-macrophage colony-stimulating factor34,35. Stimulation with this factor increases the level of Ras-GTP in hematopoietic cell lines36. We have not found loss of heterozygosity in the bone marrow of children with preleukemia and AML who do not have NF-1. However, our data are restricted to children with monosomy 7, and further investigation is required to ascertain whether somatic alterations of NF1 occur in the other malignant myeloid disorders.
Investigation of neurofibrosarcomas and neurofibrosarcoma cell lines derived from patients with NF-1 has shown loss of constitutional heterozygosity, decreased in vitro activity of GTPase-activating proteins, and elevated levels of Ras-GTP11-13. Legius et al.17 identified a 200-kb deletion of NF1 in a fibrosarcoma with loss of heterozygosity at all chromosome 17 alleles tested. Loss of heterozygosity with retention of the mutant NF1 allele has also been reported in pheochromocytomas from a few patients with NF-114. Finally, recent data indicating that cultured neuroblastoma37 and melanoma38 cell lines frequently show homozygous inactivation of NF1 provide further evidence that loss of neurofibromin function confers a growth advantage in cells derived from the neural crest. Although these data are consistent with our results in childhood MPS and AML, there are important differences between neural-crest tumors and myeloid leukemia. In contrast to our findings, when loss of heterozygosity occurs in neural-crest tumors it usually affects both p53 and NF112,13,17. In addition, point mutations were detected in the single p53 allele retained in two neurofibrosarcomas,12 and it is likely that alterations of both p53 and NF1 contribute to the loss of growth control in neurofibrosarcomas. Our data suggest that loss of heterozygosity at NF1, but not at p53, is involved in the pathogenesis of MPS and AML in children with NF-1. Activating RAS mutations are common in malignant myeloid disorders but are infrequent in neural-crest tumors3,22,32. Moreover, there is evidence that signaling through Ras proteins promotes differentiation, rather than proliferation, of neural-crest cells39-41. Taken together, these results suggest that the cellular context (neural crest or hematopoietic) in which the loss of NF1 function occurs influences the way in which these mutations alter growth regulation.
The association of NF-1 with preleukemia is highly specific with respect to cell lineage and age. It is striking that adults with NF-1 are not at increased risk for preleukemia or AML, particularly given the lifelong self-renewing capacity of hematopoietic cells. These observations suggest that neurofibromin activity is not required to control the proliferation of myeloid cells beyond early childhood. It is possible that a critical growth-limiting activity of neurofibromin could be overcome by maturation to a more differentiated “adult type” of myeloid progenitor, by a progressive increase in the activity of p120 GTPase-activating protein or other related proteins, or by developmental changes in the extracellular signals that stimulate or inhibit growth. The dramatic and usually transient MPS seen in some infants with Down's syndrome provides clinical evidence that the balance between the proliferation and differentiation of hematopoietic cells is tenuous early in life42. Characterization of the role of neurofibromin in fetal and neonatal hematopoiesis should provide insights into the way in which this process is developmentally regulated.
The incidence of preleukemia is much lower in children with NF-1 than is the risk of cancer in patients who carry germ-line mutations that predispose them to Wilms' tumor and retinoblastoma10. It is possible that the loss of the normal NF1 allele is necessary but not sufficient for leukemic transformation in children with NF-1. The presence of nonrandom cytogenetic abnormalities such as monosomy 7 in the bone marrow of some children with NF-1 and MPS provides evidence that leukemogenesis is a multistep process. In addition, epidemiologic data implicate epigenetic mechanisms in the pathogenesis of these disorders. Childhood MPS shows a strong male preponderance, particularly during the first year of life. We observed loss of heterozygosity at NF1 in the only girl in our series. This finding suggests that the mechanism by which germ-line NF1 mutations predispose children to leukemia is the same in boys and girls, although the risk is much higher in boys. Our finding that either mutant maternal or paternal NF-1 alleles were retained in the bone marrow of children with familial NF-1 provides evidence that NF1 is not imprinted in hematopoietic cells.
Germ-line NF1 mutations are associated with a variety of malignant neoplasms of neural-crest origin. This observation and biochemical data from studies of cultured cell lines derived from tumor cells implicate neurofibromin as a major regulator of Ras proteins in these tissues. Our data suggest that neurofibromin has an important role in controlling the growth of myeloid cells and suggest that hyperactive Ras proteins contribute to the abnormal cellular proliferation seen in childhood MPS.
Supported in part by grants from the National Neurofibromatosis Foundation and the Children's Cancer Research Fund, by the U.S. Navy Clinical Investigation Center Program (protocols 90-48-2807 and 90-018), by an American Cancer Society Junior Faculty Research Award (JFRA-471, to Dr. Shannon), and by a grant from the National Cancer Institute to the Children's Cancer Group. The opinions and assertions expressed in this work are those of the authors and do not necessarily reflect the views of the Children's Cancer Research Fund or the Department of the Navy.
Source Information
From the Department of Pediatrics, University of California, San Francisco (K.M.S., D.P., K.O.); the Department of Pathology, University of Texas Health Science Center, San Antonio (P.O.); Onyx Pharmaceuticals, Richmond, Calif. (G.A.M., F.M.); and the Division of Pediatric Oncology, Children's National Medical Center, Washington, D.C. (P.D.).
Address reprint requests to Dr. Shannon at the Department of Pediatrics, University of California, Rm. U-432, San Francisco, CA 94143-0724.
We are indebted to Dr. Y.W. Kan for ongoing advice and support; to Drs. Irwin Bernstein and Franklin Smith, who direct the Children's Cancer Group Acute Myelogenous Leukemia Reference Laboratory; to Drs. Beverly J. Lange and Greg Thomas for encouragement and samples from patients; to Dr. Robert Weiss for the primer sequences for EVI-20; to Dr. Ray White for the primer sequences for UT172; to Susan Tarle, Dr. Francis Collins, and Dr. Lone Andersen for oligonucleotide primer sequences and for their gift of probes AE25 and EVI-2B; to Drs. Gideon Bollag, Simon Cook, and Marc Hansen for helpful conversations; to Drs. Sarah Chaffee, L.C. Chan, Peter Emanuel, Steve Feig, Carolyn Felix, Jack Kelleher, Margaret Masterson, Jack Priest, Narayan Shah, Eric Sievers, Peter Steinherz, Brian Wickland, and Jan Watterson for providing samples from patients; and to the families who participated.
- References
References
1
Bourne HR ,Sanders DA ,McCormick F . The GTPase superfamily: a conserved switch for diverse cell functions. Nature 1990;348:125-132
CrossRef | Web of Science | Medline2
Hall A . The cellular functions of small GTP-binding proteins. Science 1990;249:635-640
CrossRef | Web of Science | Medline3
Rodenhuis S . ras And human tumors. Semin Cancer Biol 1992;3:241-247
Medline4
Ballester R ,Marchuk D ,Boguski M , et al. The NF1 locus encodes a protein functionally related to mammalian GAP and yeast IRA proteins. Cell 1990;63:851-859
CrossRef | Web of Science | Medline5
Buchberg AM ,Cleveland LS ,Jenkins NA ,Copeland NG . Sequence homology shared by neurofibromatosis type-1 gene and IRA-1 and IRA-2 negative regulators of the RAS cyclic AMP pathway. Nature 1990;347:291-294
CrossRef | Web of Science | Medline6
Xu GF ,O'Connell P ,Viskochil D , et al. The neurofibromatosis type 1 gene encodes a protein related to GAP. Cell 1990;62:599-608
CrossRef | Web of Science | Medline7
Martin GA ,Viskochil D ,Bollag G , et al. The GAP-related domain of the neurofibromatosis type 1 gene product interacts with ras p21. Cell 1990;63:843-849
CrossRef | Web of Science | Medline8
Xu GF ,Lin B ,Tanaka K , et al. The catalytic domain of the neurofibromatosis type 1 gene product stimulates ras GTPase and complements ira mutants of S. cerevisiae. Cell 1990;63:835-841
CrossRef | Web of Science | Medline9
Riccardi VM, Eichner JE. Neurofibromatosis: phenotype, natural history, and pathogenesis. Baltimore: Johns Hopkins University Press, 1986.
10
Weinberg RA . Tumor suppressor genes. Science 1991;254:1138-1146
CrossRef | Web of Science | Medline11
Skuse GR ,Kosciolek BA ,Rowley PT . Molecular genetic analysis of tumors in von Recklinghausen neurofibromatosis: loss of heterozygosity for chromosome 17. Genes Chromosomes Cancer 1989;1:36-41
CrossRef | Web of Science | Medline12
Menon AG ,Anderson KM ,Riccardi VM , et al. Chromosome 17p deletions and p53 gene mutations associated with the formation of malignant neurofibrosarcomas in von Recklinghausen neurofibromatosis. Proc Natl Acad Sci U S A 1990;87:5435-5439
CrossRef | Web of Science | Medline13
Glover TW ,Stein CK ,Legius E ,Andersen LB ,Brereton A ,Johnson S . Molecular and cytogenetic analysis of tumors in von Recklinghausen neurofibromatosis. Genes Chromosomes Cancer 1991;3:62-70
CrossRef | Web of Science | Medline14
Xu W ,Mulligan LM ,Ponder MA , et al. Loss of NF1 alleles in phaeochromocytomas from patients with type 1 neurofibromatosis. Genes Chromosomes Cancer 1992;4:337-342
CrossRef | Web of Science | Medline15
Basu TN ,Gutmann DH ,Fletcher JA ,Glover TW ,Collins FS ,Downward J . Aberrant regulation of ras proteins in malignant tumour cells from type 1 neurofibromatosis patients. Nature 1992;356:713-715
CrossRef | Web of Science | Medline16
DeClue JE ,Papageorge AG ,Fletcher JA , et al. Abnormal regulation of mammalian p21ras contributes to malignant tumor growth in von Recklinghausen (type 1) neurofibromatosis. Cell 1992;69:265-273
CrossRef | Web of Science | Medline17
Legius E ,Marchuk DA ,Collins FS ,Glover TW . Somatic deletion of the neurofibromatosis type 1 gene in a neurofibrosarcoma supports a tumour suppressor gene hypothesis. Nat Genet 1993;3:122-126
CrossRef | Web of Science | Medline18
Gadner H ,Haas OA . Experience in pediatric myelodysplastic syndromes. Hematol Oncol Clin North Am 1992;6:655-672
Web of Science | Medline19
Bader JL ,Miller RW . Neurofibromatosis and childhood leukemia. J Pediatr 1978;92:925-929
CrossRef | Web of Science | Medline20
Castro-Malaspina H ,Schaison G ,Passe S , et al. Subacute and chronic myelomonocytic leukemia in children (juvenile CML): clinical and hematologic observations, and identification of prognostic factors. Cancer 1984;54:675-686
CrossRef | Medline21
Shannon KM ,Watterson J ,Johnson P , et al. Monosomy 7 myeloproliferative disease in children with neurofibromatosis, type 1: epidemiology and molecular analysis. Blood 1992;79:1311-1318
Web of Science | Medline22
Vogelstein B ,Civin CI ,Preisinger AC , et al. RAS gene mutations in childhood acute myeloid leukemia: a Pediatric Oncology Group study. Genes Chromosomes Cancer 1990;2:159-162
CrossRef | Web of Science | Medline23
Shannon KM ,Turhan AG ,Chang SSY , et al. Familial bone marrow monosomy 7: evidence that the predisposing locus is not on the long arm of chromosome 7. J Clin Invest 1989;84:984-989
CrossRef | Web of Science | Medline24
Andersen LB ,Wallace MR ,Marchuk DA , et al. A highly polymorphic cDNA probe in the NF1 gene. Nucleic Acids Res 1991;19:3754-3754 abstract.
CrossRef | Web of Science | Medline25
Andersen LB ,Wallace MR ,Marchuk DA , et al. A polymorphic cDNA probe on chromosome 17q11.2 located within the NF1 gene [D17S376]. Nucleic Acids Res 1991;19:197-197 abstract.
CrossRef | Web of Science | Medline26
Xu GF ,Nelson L ,O'Connell P ,White R . An Alu polymorphism intragenic to the neurofibromatosis type 1 gene (NF1). Nucleic Acids Res 1991;19:3764-3764
CrossRef | Web of Science | Medline27
Andersen LB ,Tarle SA ,Marchuk DA ,Legius E ,Collins FS . A compound nucleotide repeat in the neurofibromatosis (NF1) gene. Hum Mol Genet 1993;2:1083-1083 abstract.
CrossRef | Web of Science | Medline28
Nakamura Y ,Ballard L ,Leppert M , et al. Isolation and mapping of a polymorphic DNA sequence (pYNZ22) on chromosome 17p [D17S30]. Nucleic Acids Res 1988;16:5707-5707 abstract.
CrossRef | Web of Science | Medline29
Futreal PA ,Barrett JC ,Wiseman RW . An Alu polymorphism intragenic to the TP53 gene. Nucleic Acids Res 1991;19:6977-6977 abstract.
CrossRef | Web of Science | Medline30
Hollstein M ,Sidransky D ,Vogelstein B ,Harris CC . p53 Mutations in human cancers. Science 1991;253:49-53
CrossRef | Web of Science | Medline31
Lubbert M ,Mirro J ,Kitchingman G , et al. Prevalence of N-ras mutations in children with myelodysplastic syndromes and acute myeloid leukemia. Oncogene 1992;7:263-268
Web of Science | Medline32
Neubauer A ,Shannon K ,Liu E . Mutations of the ras proto-oncogenes in childhood monosomy 7. Blood 1991;77:594-598
Web of Science | Medline33
Weiss K ,Stass S ,Williams D , et al. Childhood monosomy 7 syndrome: clinical and in vitro studies. Leukemia 1987;1:97-104
Web of Science | Medline34
Freedman MH ,Cohen A ,Grunberger T , et al. Central role of tumor necrosis factor, GM-CSF, and interleukin 1 in the pathogenesis of juvenile chronic myelogenous leukaemia. Br J Haematol 1992;80:40-48
CrossRef | Web of Science | Medline35
Emanuel PD ,Bates LJ ,Castleberry RP ,Gualtieri RJ ,Zuckerman KS . Selective hypersensitivity to granulocyte-macrophage colony-stimulating factor by juvenile chronic myeloid leukemia hematopoietic progenitors. Blood 1991;77:925-929
Web of Science | Medline36
Satoh T ,Nakafuku M ,Miyajima A ,Kaziro Y . Involvement of ras p21 protein in signal-transduction pathways from interleukin 2, interleukin 3, and granulocyte/macrophage colony-stimulating factor, but not from interleukin 4. Proc Natl Acad Sci U S A 1991;88:3314-3318
CrossRef | Web of Science | Medline37
The I ,Murthy AE ,Hannigan GE , et al. Neurofibromatosis type 1 gene mutations in neuroblastoma. Nat Genet 1993;3:62-66
CrossRef | Web of Science | Medline38
Andersen LB ,Fountain JW ,Gutmann DH , et al. Mutations in the neurofibromatosis 1 gene in sporadic malignant melanoma cell lines. Nat Genet 1993;3:118-121
CrossRef | Web of Science | Medline39
Noda M ,Ko M ,Ogura A , et al. Sarcoma viruses carrying ras oncogenes induce differentiation-associated properties in a neuronal cell line. Nature 1985;318:73-75
CrossRef | Web of Science | Medline40
Bar-Sagi D ,Feramisco JR . Microinjection of the ras oncogene protein into PC12 cells induces morphological differentiation. Cell 1985;42:841-848
CrossRef | Medline41
Qui MS ,Green SH . PC12 cell neuronal differentiation is associated with prolonged p21ras activity and consequent prolonged ERK activity. Neuron 1992;9:705-717
CrossRef | Medline42
Fong C-t,
Brodeur GM . Down's syndrome and leukemia: epidemiology, genetics, cytogenetics and mechanisms of leukemogenesis. Cancer Genet Cytogenet 1987;28:55-76
CrossRef | Web of Science | Medline
- Citing Articles (80)
Citing Articles
1
Charlotte M Niemeyer, Michelle W Kang, Danielle H Shin, Ingrid Furlan, Miriam Erlacher, Nancy J Bunin, Severa Bunda, Jerry Z Finklestein, Kathleen M Sakamoto, Thomas A Gorr, Parinda Mehta, Irene Schmid, Gabriele Kropshofer, Selim Corbacioglu, Peter J Lang, Christoph Klein, Paul-Gerhard Schlegel, Andrea Heinzmann, Michaela Schneider, Jan Starý, Marry M van den Heuvel-Eibrink, Henrik Hasle, Franco Locatelli, Debbie Sakai, Sophie Archambeault, Leslie Chen, Ryan C Russell, Stephanie S Sybingco, Michael Ohh, Benjamin S Braun, Christian Flotho, Mignon L Loh. (2010) Germline CBL mutations cause developmental abnormalities and predispose to juvenile myelomonocytic leukemia. Nature Genetics 42:9, 794-800
CrossRef2
Ayami Yoshimi, Seiji Kojima, Naoto Hirano. (2010) Juvenile Myelomonocytic Leukemia. Pediatric Drugs 12:1, 11-21
CrossRef3
Sabrina Titze, Hartmut Peters, Sandra Währisch, Thomas Harder, Katrin Guse, Annegret Buske, Sigrid Tinschert, Anja Harder. (2010) Differential MSH2 promoter methylation in blood cells of Neurofibromatosis type 1 (NF1) patients. European Journal of Human Genetics 18:1, 81-87
CrossRef4
Jennifer O. Lauchle, Doris Kim, Doan T. Le, Keiko Akagi, Michael Crone, Kimberly Krisman, Kegan Warner, Jeannette M. Bonifas, Qing Li, Kristen M. Coakley, Ernesto Diaz-Flores, Matthew Gorman, Sally Przybranowski, Mary Tran, Scott C. Kogan, Jeroen P. Roose, Neal G. Copeland, Nancy A. Jenkins, Luis Parada, Linda Wolff, Judith Sebolt-Leopold, Kevin Shannon. (2009) Response and resistance to MEK inhibition in leukaemias initiated by hyperactive Ras. Nature 461:7262, 411-414
CrossRef5
J. Koenigsmann, C. Rudolph, S. Sander, O. Kershaw, A. D. Gruber, L. Bullinger, B. Schlegelberger, D. Carstanjen. (2009) Nf1 haploinsufficiency and Icsbp deficiency synergize in the development of leukemias. Blood 113:19, 4690-4701
CrossRef6
Vincent Michael Riccardi. (2009) Neurofibromatosis type 1 is a disorder of dysplasia: The importance of distinguishing features, consequences, and complications. Birth Defects Research Part A: Clinical and Molecular Teratology NA-NA
CrossRef7
James M. Allan. (2008) GENETIC SUSCEPTIBILITY TO RADIOGENIC CANCER IN HUMANS. Health Physics 95:5, 677-686
CrossRef8
Katharina Wimmer, Julia Etzler. (2008) Constitutional mismatch repair-deficiency syndrome: have we so far seen only the tip of an iceberg?. Human Genetics 124:2, 105-122
CrossRef9
P D Emanuel. (2008) Juvenile myelomonocytic leukemia and chronic myelomonocytic leukemia. Leukemia 22:7, 1335-1342
CrossRef10
Charlotte Marie Niemeyer, Christian Peter Kratz. (2008) Paediatric myelodysplastic syndromes and juvenile myelomonocytic leukaemia: molecular classification and treatment options. British Journal of Haematology 140:6, 610-624
CrossRef11
Ayalew Tefferi. (2008) Mutant Molecules of Interest in Myeloproliferative Neoplasms: Introduction. Acta Haematologica 119:4, 192-193
CrossRef12
A Tefferi, J W Vardiman. (2008) Classification and diagnosis of myeloproliferative neoplasms: The 2008 World Health Organization criteria and point-of-care diagnostic algorithms. Leukemia 22:1, 14-22
CrossRef13
Peter D. Emanuel. (2008) RAS Pathway Mutations in Juvenile Myelomonocytic Leukemia. Acta Haematologica 119:4, 207-211
CrossRef14
Ellen Denayer, Eric Legius. (2007) What’s new in the neuro-cardio-facial-cutaneous syndromes?. European Journal of Pediatrics 166:11, 1091-1098
CrossRef15
Ming-Jen Lee, Dennis A Stephenson. (2007) Recent developments in neurofibromatosis type 1. Current Opinion in Neurology 20:2, 135-141
CrossRef16
Christian P. Kratz, Charlotte M. Niemeyer, Martin Zenker. (2007) An unexpected new role of mutant Ras: perturbation of human embryonic development. Journal of Molecular Medicine 85:3, 227-235
CrossRef17
Andrea I. McClatchey. (2007) Neurofibromatosis. Annual Review of Pathology: Mechanisms of Disease 2:1, 191-216
CrossRef18
C-C Chiou, P-N Wang, L-C Yang, T-T Kuo, H-S Hong. (2007) Disseminated xanthogranulomas associated with adult T-cell leukaemia/lymphoma: a case report and review the association of haematologic malignancies. Journal of the European Academy of Dermatology and Venereology 0:0, 070209222700038-???
CrossRef19
Feng-Chun Yang, Shi Chen, Alexander G. Robling, Xijie Yu, Todd D. Nebesio, Jincheng Yan, Trent Morgan, Xiaohong Li, Jin Yuan, Janet Hock, David A. Ingram, D. Wade Clapp. (2006) Hyperactivation of p21ras and PI3K cooperate to alter murine and human neurofibromatosis type 1–haploinsufficient osteoclast functions. Journal of Clinical Investigation 116:11, 2880-2891
CrossRef20
Ophélia Maertens, Hilde Brems, Jo Vandesompele, Thomas De Raedt, Ine Heyns, Thorsten Rosenbaum, Sofie De Schepper, Anne De Paepe, Geert Mortier, Sandra Janssens, Frank Speleman, Eric Legius, Ludwine Messiaen. (2006) ComprehensiveNF1 screening on cultured Schwann cells from neurofibromas. Human Mutation 27:10, 1030-1040
CrossRef21
Deepak S. Gill, Shelley L. Hyman, Adam Steinberg, Kathryn N. North. (2006) Age-related findings on MRI in neurofibromatosis type 1. Pediatric Radiology 36:10, 1048-1056
CrossRef22
Jennifer O. Lauchle, Benjamin S. Braun, Mignon L. Loh, Kevin Shannon. (2006) Inherited predispositions and hyperactive Ras in myeloid leukemogenesis. Pediatric Blood & Cancer 46:5, 579-585
CrossRef23
Vassiliki Danilatou, Demetra Liapi, Maria Psyllaki, Aria Chatzivasili, Irini Chronaki, Polyvios Heliakis. (2006) Neurofibromatosis type I and smoldering multiple myeloma: A case report. Hematology 11:1, 45-48
CrossRef24
A DELUCA, I BOTTILLO, A SARKOZY, C CARTA, C NERI, E BELLACCHIO, A SCHIRINZI, E CONTI, G ZAMPINO, A BATTAGLIA. (2005) NF1 Gene Mutations Represent the Major Molecular Event Underlying Neurofibromatosis-Noonan Syndrome. The American Journal of Human Genetics 77:6, 1092-1101
CrossRef25
David A. Sweetser, Andrew J. Peniket, Christina Haaland, Adam A. Blomberg, Yuntian Zhang, Syed Tanweer Zaidi, Farshid Dayyani, Zheng Zhao, Nyla A. Heerema, Jacqueline Boultwood, Gordon W. Dewald, Elisabeth Paietta, Marilyn L. Slovak, Cheryl L. Willman, James S. Wainscoat, Irwin D. Bernstein, Sarah B. Daly. (2005) Delineation of the minimal commonly deleted segment and identification of candidate tumor-suppressor genes in del(9q) acute myeloid leukemia. Genes, Chromosomes and Cancer 44:3, 279-291
CrossRef26
Agnes Fütterer, Miguel R. Campanero, Esther Leonardo, Luis M. Criado, Juana M. Flores, Jesús M. Hernández, Jesús F. San Miguel, Carlos Martínez-A. (2005) Dido gene expression alterations are implicated in the induction of hematological myeloid neoplasms. Journal of Clinical Investigation 115:9, 2351-2362
CrossRef27
James M Allan, Charles S Rabkin. (2005) Genetic susceptibility to iatrogenic malignancy. Pharmacogenomics 6:6, 615-628
CrossRef28
Sharon E. Plon, Katherine Nathanson. (2005) Inherited Susceptibility for Pediatric Cancer. The Cancer Journal 11:4, 255-267
CrossRef29
Seth J Corey, Marily Elopre, Steve Weitman, Michael E Rytting, Lisa J Robinson, Stephen Rumelhart, Frederick D Goldman. (2005) Complete Remission Following Clofarabine Treatment in Refractory Juvenile Myelomonocytic Leukemia. Journal of Pediatric Hematology/Oncology 27:3, 166-168
CrossRef30
Helen T Shin, Michael B Harris, Seth J Orlow. (2004) Juvenile Myelomonocytic Leukemia Presenting With Features of Hemophagocytic Lymphohistiocytosis in Association With Neurofibromatosis and Juvenile Xanthogranulomas. Journal of Pediatric Hematology/Oncology 26:9, 591-595
CrossRef31
Lucy E. Side, Nicole P. Curtiss, Kathryn Teel, Christian Kratz, Pauline W. Wang, Richard A. Larson, Michelle M. Le Beau, Kevin M. Shannon. (2004) RAS,FLT3, andTP53 mutations in therapy-related myeloid malignancies with abnormalities of chromosomes 5 and 7. Genes, Chromosomes and Cancer 39:3, 217-223
CrossRef32
Iris T. Chan, Jeffery L. Kutok, Ifor R. Williams, Sarah Cohen, Lauren Kelly, Hirokazu Shigematsu, Leisa Johnson, Koichi Akashi, David A. Tuveson, Tyler Jacks, D. Gary Gilliland. (2004) Conditional expression of oncogenic K-ras from its endogenous promoter induces a myeloproliferative disease. Journal of Clinical Investigation 113:4, 528-538
CrossRef33
Marco Tartaglia, Charlotte M. Niemeyer, Kevin M. Shannon, Mignon L. Loh. (2004) SHP-2 and myeloid malignancies. Current Opinion in Hematology 11:1, 44-50
CrossRef34
Elaine Leung, Wilma Vanek, Mohamed Abdelhaleem, Melvin Freedman, Yigal Dror. (2003) Journal of Pediatric Hematology/Oncology 25:2, 145-147
CrossRef35
Di Lu, Randa Nounou, Miloslav Beran, Elihu Estey, Taghi Manshouri, Hagop Kantarjian, Michael J. Keating, Maher Albitar. (2003) The prognostic significance of bone marrow levels of neurofibromatosis-1 protein and ras oncogene mutations in patients with acute myeloid leukemia and myelodysplastic syndrome. Cancer 97:2, 441-449
CrossRef36
Kathryn North. (2001) Neurofibromatosis Type 1. American Journal of Medical Genetics 97:2, 119-127
CrossRef37
Youyan Zhang, Brigit R. Taylor, Kevin Shannon, D. Wade Clapp. (2001) Quantitative effects of Nf1 inactivation on in vivo hematopoiesis. Journal of Clinical Investigation 108:5, 709-715
CrossRef38
David Tuveson, Jonathan Fletcher. (2001) Current Opinion in Oncology 13:4, 249-255
CrossRef39
Pierre Fenaux. (2001) Chromosome and Molecular Abnormalities in Myelodysplastic Syndromes. International Journal of Hematology 73:4, 429-437
CrossRef40
Kimberly Sippel. (2001) International Ophthalmology Clinics 41:1, 25-40
CrossRef41
Maha M. Lakkis, Gihan I. Tennekoon. (2000) Neurofibromatosis type 1 I. General overview. Journal of Neuroscience Research 62:6, 755-763
CrossRef42
Sonja A. Rasmussen, Jennifer Overman, Susanne A.M. Thomson, Steven D. Colman, Corinne R. Abernathy, Rachael E. Trimpert, Rebecca Moose, Gurinder Virdi, Kyle Roux, Mislen Bauer, Amyn M. Rojiani, Bernard L. Maria, David Muir, Margaret R. Wallace. (2000) Chromosome 17 loss-of-heterozygosity studies in benign and malignant tumors in neurofibromatosis type 1. Genes, Chromosomes and Cancer 28:4, 425-431
CrossRef43
R FAHSOLD, S HOFFMEYER, C MISCHUNG, C GILLE, C EHLERS, N KUCUKCEYLAN, M ABDELNOUR, A GEWIES, H PETERS, D KAUFMANN. (2000) Minor Lesion Mutational Spectrum of the Entire NF1 Gene Does Not Explain Its High Mutability but Points to a Functional Domain Upstream of the GAP-Related Domain. The American Journal of Human Genetics 66:3, 790-818
CrossRef44
I EISENBARTH, K BEYER, W KRONE, G ASSUM. (2000) Toward a Survey of Somatic Mutation of the NF1 Gene in Benign Neurofibromas of Patients with Neurofibromatosis Type 1. The American Journal of Human Genetics 66:2, 393-401
CrossRef45
Margaret R. Wallace, Sonja A. Rasmussen, Ingrid T. Lim, Brian A. Gray, Roberto T. Zori, David Muir. (2000) Culture of cytogenetically abnormal Schwann cells from benign and malignant NF1 tumors. Genes, Chromosomes and Cancer 27:2, 117-123
CrossRef46
Franklin Smith, Jean Sanders. (1999) Journal of Pediatric Hematology/Oncology 21:6, 461-463
CrossRef47
Jun Miyauchi, Minoru Asada, Yukiko Tsunematsu, Yasuhiko Kaneko, Seiji Kojima, Shuki Mizutani. (1999) Abnormalities of the p53 gene in juvenile myelomonocytic leukaemia. British Journal of Haematology 106:4, 980-986
CrossRef48
Peter D. Emanuel. (1999) Myelodysplasia and myeloproliferative disorders in childhood: an update. British Journal of Haematology 105:4, 852-863
CrossRef49
John C. Carey, David H. Viskochil. (1999) Neurofibromatosis type 1: A model condition for the study of the molecular basis of variable expressivity in human disorders. American Journal of Medical Genetics 89:1, 7-13
CrossRef50
Brian Weiss, Gideon Bollag, Kevin Shannon. (1999) Hyperactive Ras as a therapeutic target in neurofibromatosis type 1. American Journal of Medical Genetics 89:1, 14-22
CrossRef51
Judith E Karp, Clarence Sarkodee-Adoo. (1999) Molecular therapeutics of myelodysplasia and myelodysplasia-related leukaemias. Expert Opinion on Therapeutic Targets 3:1, 151-163
CrossRef52
Kathryn Klopfenstein, Annemarie Sommer, Frederick Ruymann. (1999) Journal of Pediatric Hematology/Oncology 21:2, 158-160
CrossRef53
George R. Honig, Carlos R. Suarez, Loyda N. Vida, Shi-Jiang Lu, Edison T. Liu. (1998) Juvenile myelomonocytic leukemia (JMML) with the hematologic phenotype of severe β thalassemia. American Journal of Hematology 58:1, 67-71
CrossRef54
E ARS, H KRUYER, A GAONA, P CASQUERO, J ROSELL, V VOLPINI, E SERRA, C LAZARO, X ESTIVILL. (1998) A Clinical Variant of Neurofibromatosis Type 1: Familial Spinal Neurofibromatosis with a Frameshift Mutation in the NF1 Gene. The American Journal of Human Genetics 62:4, 834-841
CrossRef55
Nidal Mahgoub, Robert I. Parker, Matthew R. Hosler, Pamelyn Close, Naomi J. Winick, Margaret Masterson, Kevin M. Shannon, Carolyn A. Felix. (1998) RAS mutations in pediatric leukemias withMLL gene rearrangements. Genes, Chromosomes and Cancer 21:3, 270-275
CrossRef56
Kathleen A. Leppig, Paige Kaplan, David Viskochil, Molly Weaver, June Ortenberg, Karen Stephens. (1997) Familial neurofibromatosis 1 microdeletions: Cosegregation with distinct facial phenotype and early onset of cutaneous neurofibromata. American Journal of Medical Genetics 73:2, 197-204
CrossRef57
HENRY T. LYNCH, RAMON M. FUSARO, JANE F. LYNCH. (1997) Cancer Genetics in the New Era of Molecular Biology. Annals of the New York Academy of Sciences 833:1 Cancer, 1-28
CrossRef58
Drorit Luria, Smadar Avigad, Ian J. Cohen, Batia Stark, Raphael Weitz, Rina Zaizov. (1997) p53 mutation as the second event in juvenile chronic myelogenous leukemia in a patient with neurofibromatosis type 1. Cancer 80:10, 2013-2018
CrossRef59
Aengus O'Marcaigh, Kevin Shannon. (1997) Journal of Pediatric Hematology/Oncology 19:6, 551-554
CrossRef60
A. Luz. (1997) Abschätzung des Krebsrisikos durch genetische Analyse?. Strahlentherapie und Onkologie 173:9, 444-456
CrossRef61
Henry T. Lynch, Ramon M. Fusaro, Stephen J. Lemon, Thomas Smyrk, Jane Lynch. (1997) Survey of cancer genetics. Cancer 80:S3, 523-532
CrossRef62
Side, Lucy, Taylor, Brigit, Cayouette, Matthew, Conner, Edward, Thompson, Patricia, Luce, Michael, Shannon, Kevin, . (1997) Homozygous Inactivation of the NF1 Gene in Bone Marrow Cells from Children with Neurofibromatosis Type 1 and Malignant Myeloid Disorders. New England Journal of Medicine 336:24, 1713-1720
Full Text63
John M. Maris, Susan R. Wiersma, Nidal Mahgoub, Patricia Thompson, Russell J. Geyer, Carole G.
H. Hurwitz, Beverly J. Lange, Kevin M. Shannon. (1997) Monosomy 7 myelodysplastic syndrome and other second malignant neoplasms in children with neurofibromatosis type 1. Cancer 79:7, 1438-1446
CrossRef64
Minoru Fukuda, Keizo Horibe, Yuji Miyajima, Kimikazu Matsumoto, Masami Nagashima. (1997) Journal of Pediatric Hematology/Oncology 19:2, 177-179
CrossRef65
Shun'ichi Sawada, Scott Florell, Smita M. Purandare, Mayumi Ota, Karen Stephens, David Viskochil. (1996) Identification of NF1 mutations in both alleles of a dermal neurofibroma. Nature Genetics 14:1, 110-112
CrossRef66
Inge Olsson, Gösta Bergh, Mats Ehinger, Urban Gullberg. (1996) Cell differentiation in acute myeloid leukemia. European Journal of Haematology 57:1, 1-16
CrossRef67
S. A. Rasmussen, V. T. Ho, S. D. Colman, C. R. Abernathy, M. R. Wallace. (1996) A multiplex-PCR test for EVI2A and EVI2B polymorphisms within the human NF1 gene. Mammalian Genome 7:3, 233-234
CrossRef68
Godfrey C.F. Chan, John M. Nicholls, Anselm C.W. Lee, Li Chong Chan, Yu Lung Lau. (1996) Malignant peripheral neuroectodermal tumor in an infant with neurofibromatosis type 1. Medical and Pediatric Oncology 26:3, 215-219
CrossRef69
David A. Largaespada, Camilynn I. Brannan, Nancy A. Jenkins, Neal G. Copeland. (1996) Nf1 deficiency causes Ras-Dediated granulocyte/macrophage colony stimulating factor hypersensitivity and chronic myeloid leukaemia. Nature Genetics 12:2, 137-143
CrossRef70
Gideon Bollag, D. Wade Clapp, Shane Shih, Felix Adler, You Yan Zhang, Patricia Thompson, Beverly J. Lange, Melvin H. Freedman, Frank McCormick, Tyler Jacks, Kevin Shannon. (1996) Loss of NF1 results in activation of the Ras signaling pathway and leads to aberrant growth in haematopoietic cells. Nature Genetics 12:2, 144-148
CrossRef71
Juha Peltonen, Seija-Liisa Karvonen, Heli Yla-Outinen, Outi Hirvonen, Jaakko Karvonen. (1995) Lesional Psoriatic Epidermis Displays Reduced Neurofibromin Immunoreactivity.. Journal of Investigative Dermatology 105:5, 664-667
CrossRef72
Sanford Jensen, Dorothy C. Paderanga, Pengchin Chen, Kristin Olson, Michael Edwards, Antonio Iavorone, Mark A. Israel, Kevin Shannon. (1995) Molecular analysis at theNF1 locus in astrocytic brain tumors. Cancer 76:4, 674-677
CrossRef73
Raimund Fahsold, Thomas Habash, Udo Trautmann, Armin Haustein, Rudolf A. Pfeiffer. (1995) Familial reciprocal translocation t(17;19) (q11.2;q13.2) associated with neurofibromatosis type 1, including one patient with non-Hodgkin lymphoma and an additional t(14;20) in B lymphocytes. Human Genetics 96:1, 65-69
CrossRef74
Pui, Ching-Hon, . (1995) Childhood Leukemias. New England Journal of Medicine 332:24, 1618-1630
Full Text75
Benedikt L. Ziegler, Melanie Weiss, Stefan Thoma, Christa Lamping, Theodor M. Fliedner. (1995) Chapter 8: Perspectives for the use of biological indicators for the assessment of radiation induced responses and impairments: Biologic indicators of exposure: Are markers associated with oncogenesis useful as biologic markers of effect?. Stem Cells 13:S1, 326-338
CrossRef76
Andreas Deimling, Winfrid Krone, Anil G. Menon. (1995) Neurofibromatosis Type 1: Pathology, Clinical Features and Molecular Genetics. Brain Pathology 5:2, 153-162
CrossRef77
Xiang Gao, Kenneth V. Honn. (1995) Recessive oncogenes: Current status. Pathology & Oncology Research 1:1, 7-22
CrossRef78
Mark Butcher, Robert Frenck, John Emperor, Dorothy Paderanga, David Maybee, Kristin Olson, Kevin Shannon. (1995) Molecular evidence that childhood monosomy 7 syndrome is distinct from juvenile chronic myelogenous leukemia and other childhood myeloproliferative disorders. Genes, Chromosomes and Cancer 12:1, 50-57
CrossRef79
Tyler Jacks, T. Shane Shih, Earlene M. Schmitt, Roderick T. Bronson, Andre Bernards, Robert A. Weinberg. (1994) Tumour predisposition in mice heterozygous for a targeted mutation in Nf1. Nature Genetics 7:3, 353-361
CrossRef80
Brodeur, Garrett M., . (1994) The NF1 Gene in Myelopoiesis and Childhood Myelodysplastic Syndromes. New England Journal of Medicine 330:9, 637-639
Full Text
