Original Article
Brief Report
Heavy-Chain Deposition Disease
N Engl J Med 1993; 329:1389-1393November 4, 1993
- Article
Light-chain amyloidosis and light-chain deposition disease are closely related processes characterized by tissue deposition of organized (fibrillar) or nonorganized material related to monoclonal immunoglobulin light chains. Both conditions can occur in patients with immunoproliferative disorders. The clinical manifestations of light-chain deposition disease result from multivisceral involvement and are heterogeneous. Rapidly progressive renal failure or the nephrotic syndrome is the most common manifestation, but heart failure, arrhythmia, liver involvement (peliosis), and neurologic disorders may also be present. These findings may be caused by structural abnormalities or unusual behavior of deposited light chains. In particular, pathogenic light chains are characterized by unusual sizes, glycosylation, variable-region subgroups, exposed hydrophobic amino acid residues, or the propensity to polymerize or aggregate1. Soon after the first description of light-chain deposition disease,2 it became apparent that heavy chains that are monoclonal in origin may be found together with light chains in the tissue of some patients3.
Eulitz et al. have described a patient with systemic heavy-chain amyloidosis in whom the amyloid component was a short IgG heavy γ chain alone4. The shortened heavy chain belonged to the gamma1 subclass and contained a normal variable domain directly linked to the third constant domain. We now describe two patients with a disorder that resembled light-chain deposition disease both clinically and pathologically in whom the kidney deposits contained short heavy chains but no detectable light chains. Unlike the deposits associated with systemic heavy-chain amyloidosis, these deposits had a nonfibrillar structure and did not stain with Congo red. The sequence of the truncated heavy chain from one patient was strikingly similar to that of the protein found in the patient with systemic heavy-chain amyloidosis4. We believe that this condition, characterized by nonamyloid deposits of heavy chains, is a specific entity -- namely, heavy-chain deposition disease.
Methods
Patients
Patient 1, a 53-year-old woman, was referred because of hypertension, leg edema, exertional dyspnea, and anemia of five months' duration. Her urinary protein excretion was 4.4 g per 24 hours. Her serum total protein concentration was 47 g per liter, with 27 g of albumin per liter and 4 g of gamma globulin per liter (normal, 8 to 16). Thin-layer agarose electrophoresis revealed peaks of beta-2 and gamma globulin. The serum creatinine concentration was 1.5 mg per deciliter (133 μmol per liter). Bone marrow aspiration showed 8 percent plasma cells, and the results of a bone marrow biopsy were consistent with a diagnosis of multiple myeloma, with infiltration of plasma cells that stained with fluorescein-conjugated anti-gamma-heavy-chain and anti-lambda-light-chain antibodies by direct immunofluorescence. No cells containing kappa light chains were detected. The patient was treated with melphalan, prednisone, albumin, and antihypertensive drugs. Nine months later, she was asymptomatic, but her bone marrow was hypoplastic, with minimal plasma-cell infiltration (1 to 2 percent), and she had persistent proteinuria (5 to 7 g per 24 hours) and hypoproteinemia.
Patient 2, a 59-year old woman referred because she had hypertension and the nephrotic syndrome, had a long history of autoimmune disorders, including Graves' hyperthyroidism followed by Hashimoto's thyroiditis with a goiter and persistently high serum concentrations of antithyroid, antinuclear, and antigastric parietal-cell antibodies. She also had chronic thrombocytopenia, which had been treated unsuccessfully with prednisolone and cyclophosphamide and then with vincristine and danazol, and diabetes mellitus that was controlled by diet. Her 24-hour urinary protein excretion was 3 to 18 g. The serum total protein concentration was 52 g per liter, with 26 g of albumin per liter and 4 g of gamma globulin per liter. The patient was treated initially with intravenous immune globulin in a dose of 30 g per day for five days. A renal biopsy was performed and repeated (after platelet infusions) twice: 2 months later, to rule out the possibility that the infused immune globulin was deposited in glomeruli; and 15 months later because her serum creatinine concentration had increased from 1.6 to 7.1 mg per deciliter (140 to 630 μmol per liter). A liver biopsy was performed because of an elevated serum alkaline phosphatase concentration. Monoclonal-plasma-cell proliferation was not detected by skeletal x-ray survey, bone marrow aspiration and biopsy, thyroidectomy, or cytoplasmic immunofluorescence studies of bone marrow and thyroid cells with the use of antibodies to immunoglobulin heavy chains (including IgG-subclass-specific antibodies) and light chains. Treatment with chlorambucil, methylprednisolone, and plasma exchanges resulted in transient improvement; subsequent treatment with melphalan and prednisolone had no effect.
Pathological Studies
Fragments of tissue specimens (kidney and bone marrow from both patients and liver and thyroid from Patient 2) were processed for light, electron, and immunofluorescence microscopy with the use of fluorescein-labeled antibodies specific for immunoglobulin heavy and light chains and for C1q, C3, C4, fibrinogen, and albumin and for indirect assays with the monoclonal antibodies described below.
Immunochemical Studies
Serum and concentrated urine samples from both patients were studied by high-resolution electrophoresis, immunoelectrophoresis, and Western blot analysis5. The immunologic studies were performed with monoclonal antibodies specific for kappa light chains, lambda light chains, heavy-chain constant domains, and IgG subclasses. The antigen-antibody reactions were detected with alkaline phosphatase-conjugated antimouse IgG antibodies and were visualized with nitroblue tetrazolium and bromochloro-indolyl phosphate.
The abnormal (shortened) IgG from Patient 1 was partially purified by diethylaminoethyl and Sephadex G-150 superfine chromatography and analyzed by sodium dodecyl sulfate-polyacrylamide-gel electrophoresis followed by Western blotting. The size of the native molecule was evaluated on calibrated Sephadex G-100 and G-150 superfine columns.
Study of Messenger RNA in Patient 1
Single-stranded complementary DNA (cDNA) was synthesized from bone marrow messenger RNA from Patient 1, with reverse transcriptase and random hexadeoxynucleotides used as primers. A series of polymerase chain reactions was performed with the cDNA as a template, a 3' primer (5'CGAGAGCCCGGGGAGCGGGG3') complementary to a noncoding sequence downstream from the third heavy-chain constant (CH3) exon that is identical in the four IgG subclasses, and six different 5' primers that were consensus sequences of every subgroup leader of the variable region (VH)6,7. Two further independent amplifications were performed with the same 3' primer and the 5' primer corresponding to the third subgroup (VHIII) leader exon (5'ATGGAGTTTGGGCTGAGC3'). The amplification products and restriction fragments were independently cloned into mp18 and mp19 vectors, and both strands were sequenced8.
Results
Histopathological Studies
The microscopical appearance of the renal-biopsy specimens from the two patients was similar, and the renal, bone marrow, and thyroid specimens from Patient 2 had many similarities (Figure 1Figure 1
Renal-Biopsy Findings in Patients 1 (Panel A, Panel B, and Panel C) and 2 (Panel D, Panel E, and Panel F) with Heavy-Chain Deposition Disease.). Light microscopy showed nodular glomerulosclerosis but no fluorescence after staining with thioflavine T and no green birefringence under polarized light after staining with Congo red. After silver methenamine impregnation, the glomerular nodules were heterogeneously argyrophilic and sometimes laminated. Renal tubular-cell basement membranes were thickened by a refractile ribbonlike material that was positive on periodic acid-Schiff staining. Fibrinoid deposits were present in mesangial nodules and around renal tubules in Patient 2. No arteriolar hyaline deposits or exudative lesions, such as fibrinoid caps, were seen. Material positive on periodic acid-Schiff staining was present around smooth-muscle cells of the arterial and arteriolar walls in the kidney and bone marrow specimens from Patient 2.Immunofluorescence with polyclonal antiserum showed staining only with the anti-gamma-heavy-chain conjugate in the mesangial areas; along the glomerular-capillary, capsular, and tubular basement membranes in both patients; and around vascular smooth-muscle cells in Patient 2, in whom there were also gamma-heavy-chain deposits in Disse's spaces in the liver and around thyroid follicles. The absence of detectable light chains was confirmed with the use of monoclonal antibodies. The deposited heavy chains lacked epitopes in the first and second constant domains in Patient 1 and in the first constant domain in Patient 2 (Table 1Table 1
Monoclonal-Antibody Reactivity of Abnormal IgG in Two Patients with Heavy-Chain Deposition Disease.); the chains belonged to a single IgG subclass (gamma4) in Patient 2.Electron microscopy showed deposits very similar to those reported in light-chain deposition disease. The enlarged nodular mesangial areas in the kidneys contained finely granular basement-membrane-like material. In Patient 2, the same nonorganized granular deposits were present along the internal part of glomerular basement membranes and along tubular basement membranes, as well as around vascular smooth-muscle cells. The lamina densa of the glomerular-capillary walls was not thickened. The results of the three kidney biopsies performed in Patient 2 were identical.
Immunochemical and Sequencing Studies of Serum and Urine
The serum (five samples) and concentrated urine (two samples) from Patient 2 contained small amounts of several monoclonal immunoglobulins, which were probably related to long-term immunosuppressive therapy9. The patient's IgG4 appeared to be polyclonal, and no short heavy chain could be found by Western blotting after sodium dodecyl sulfate-polyacrylamide-gel electrophoresis. In both patients, tests for cryoglobulins were negative.
The serum and urine from Patient 1 contained two monoclonal forms of IgG, one with gamma globulin and the other with beta-2 globulin mobility; the latter lacked heavy-chain epitopes by immunoelectrophoresis. A lambda-chain Bence Jones protein was detected in the patient's urine. The slow-migrating IgG was an apparently normal IgG1, whereas the fast-migrating IgG was unreactive with antibodies to the first and second constant domains (Table 1). The native protein had an apparent molecular weight of 94,000. This finding and the results of gel electrophoresis (Figure 2Figure 2
Immunoblot Analysis after Sodium Dodecyl Sulfate-Polyacrylamide-Gel Electrophoresis of Protein Partially Purified from the Serum of Patient 1 (P) and from a Patient with a Normal-Sized Myeloma IgG (N) under Reducing and Nonreducing Conditions.) indicated that this short IgG was made up of two truncated (24 kd) heavy chains noncovalently linked to a covalent dimer of normal-sized lambda light chains.A polymerase-chain-reaction product of about 0.8 kb was consistently obtained with the upstream primer corresponding to the VHIII leader sequence. The sequences of clones from three independent amplifications were identical. Each clone contained a normally rearranged variable exon made up of VHIII, DH, and JH segments and directly joined to a normal heavy-chain CH3 exon. Comparison of the deduced sequence with the sequences of 82 VHIII regions described elsewhere10 showed that eight amino acids present in this protein had not been reported at the corresponding positions in the other sequences. In particular, highly conserved residues in the framework regions were mutated; tryptophan 47, for example, was replaced by a cysteine. The full deduced sequence is available elsewhere (NAPS).
Discussion
The two patients we studied have a disorder that is clinically and pathologically indistinguishable from light-chain deposition disease, except by immunofluorescence studies, and that clearly differs from amyloidosis. We believe them to have heavy-chain deposition disease, because the tissue deposits in both patients strongly stained for heavy chains. Light-chain determinants were undetectable by immunofluorescence with potent polyclonal and monoclonal reagents. Both patients presented with renal disease, but the process is probably more widespread, as evidenced in Patient 2. Diabetic nephropathy was ruled out by the results of light and immunofluorescence microscopy, and amyloidosis was ruled out by electron microscopy.
In Patient 1 a heavy-chain cDNA lacking the CH1, hinge, and CH2 domains was amplified from bone marrow RNA. The corresponding protein was the single immunoglobulin component in the renal deposits. It was noncovalently linked to lambda light-chain dimers in the serum and urine. These findings are similar to those reported in a patient with systemic heavy-chain amyloidosis,4 whose abnormal protein also belonged to the VHIII subgroup and gamma1 subclass; however, its variable region was strikingly different, and it belonged to a different allotype. The primary structure of the variable region of the protein in Patient 1 had unusual features that might play a part in tissue deposition.
The short heavy chains in our patients and in the patient with heavy-chain amyloidosis lacked the CH1 domain. The domain is present in the heavy chains of almost all patients with heavy-chain disease, a disorder in which there is no kidney disease and no deposition of heavy chains1. The absence of the CH1 domain and the unusual structure of the protein in Patient 1 suggest that the variable region has a role in tissue deposition.
No clinical feature distinguishes light-chain deposition disease from heavy-chain deposition disease. Both conditions may be associated with various immunoproliferative disorders or found in the absence of an overt malignant process. However, the predominant disease in patients with either light- or heavy-chain deposition is myeloma, whereas myeloma is extremely rare in patients with heavy-chain disease. Hence, the finding of symptoms (especially renal) known to be associated with light-chain deposition, especially in patients with myeloma, should lead to the use of anti-heavy-chain antibodies in biopsy studies.
Supported in part by grants from the Institut National de la Sante et de la Recherche Medicale (CRE930602) and the Association pour la Recherche sur le Cancer (6044) and by a fellowship from the Ligue Nationale Contre le Cancer (to Mr. Khamlichi).
NAPS See NAPS document no. 05061 for one page of supplementary material. To order, contact NAPS c/o Microfiche Publications, 248 Hempstead Tpk., West Hempstead, NY 11552.
We are indebted to Drs. George Carlone (Centers for Disease Control and Prevention, Atlanta) and Margaret Goodall (Recognition Sciences, Birmingham, United Kingdom) for the gift of monoclonal antibodies, to Mrs. Francoise Buisson for expert editorial assistance, and to Drs. Joel Buxbaum (New York) and Jean-Claude Brouet (Paris) for their critical reading of the manuscript.
Source Information
From the Laboratory of Immunology and Molecular Interactions (Centre National de la Recherche Scientifique Associated Research Unit 1172), University Hospital and Faculty of Sciences, Poitiers (P.A., A.A.K., M.C., J.-L.P.); the Department of Nephrology, University Hospital, Poitiers (G.T.); and the Department of Pathology (E.J.) and the Human and Experimental Digestive Cancer Unit (Institut National de la Sante et de la Recherche Medicale Unit 252) (B.C., F.M.), University Hospital, Dijon -- all in France.
Address reprint requests to Dr. Aucouturier at the Centre National de la Recherche Scientifique, Unite de Recherche Associee 1172, Centre Hospitalier Universitaire, B.P. 577, F-86021 Poitiers, France.
- References
References
1
Cogne M ,Silvain C ,Khamlichi AA ,Preud'homme JL . Structurally abnormal immunoglobulins in human immunoproliferative disorders. Blood 1992;79:2181-2195
Web of Science | Medline2
Randall RE ,Williamson WC Jr ,Mullinax F ,Tung MY ,Still WJS . Manifestations of systemic light chain deposition. Am J Med 1976;60:293-299
CrossRef | Web of Science | Medline3
Preud'homme JL ,Morel-Maroger L ,Brouet JC ,Mihaesco E ,Mery JP ,Seligmann M . Synthesis of abnormal heavy and light chains in multiple myeloma with visceral deposition of monoclonal immunoglobulin. Clin Exp Immunol 1980;42:545-553
Web of Science | Medline4
Eulitz M ,Weiss DT ,Solomon A . Immunoglobulin heavy-chain-associated amyloidosis. Proc Natl Acad Sci U S A 1990;87:6542-6546
CrossRef | Web of Science | Medline5
Briault S ,Courtois-Capella M ,Duarte F ,Aucouturier P ,Preud'homme JL . Isotypy of serum monoclonal immunoglobulins in human immunodeficiency virus-infected adults. Clin Exp Immunol 1988;74:182-184
Web of Science | Medline6
Kelly PJ ,Pascual V ,Capra JD ,Lipsky PE . Anti-CD3-stimulated T cells induce the production of multiple Ig H chain isotypes by individual human peripheral B lymphocytes. J Immunol 1992;148:1294-1301
Web of Science | Medline7
Campbell MJ ,Zelenetz AD ,Levy S ,Levy R . Use of family specific leader region primers for PCR amplification of the human heavy chain variable region gene repertoire. Mol Immunol 1992;29:193-203
CrossRef | Web of Science | Medline8
Sanger F ,Nicklen S ,Coulson AR . DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci U S A 1977;74:5463-5467
CrossRef | Web of Science | Medline9
Radl J . Age-related monoclonal gammapathies: clinical lessons from the aging C57BL mouse. Immunol Today 1990;11:234-236
CrossRef | Medline10
Human heavy chains subgroup III. In: Kabat EA, Wu TT, Perry HM, Gottesman KS, Foeller C. Sequences of proteins of immunological interest. 5th ed. Vol. 1. Bethesda, Md.: National Institutes of Health, 1991:324-38. (DHHS publication no. (NIH) 91-3242.)
- Citing Articles (30)
Citing Articles
1
Frank Bridoux, Sébastien Delbes, Christophe Sirac, François Pourreau, Matthieu Puyade, Estelle Desport, Arnaud Jaccard, Jean-Paul Fermand, Guy Touchard. (2012) Atteintes rénales des dysglobulinémies : avancées diagnostiques et thérapeutiques. La Presse Médicale
CrossRef2
Mariam P. Alexander, Samih H. Nasr, Didie C. Watson, Gonzalo P. Méndez, Helmut G. Rennke. (2011) Renal Crescentic Alpha Heavy Chain Deposition Disease: A Report of 3 Cases and Review of the Literature. American Journal of Kidney Diseases 58:4, 621-625
CrossRef3
D. Corcos, M. J. Osborn, L. S. Matheson. (2011) B-cell receptors and heavy chain diseases: guilty by association?. Blood 117:26, 6991-6998
CrossRef4
Pierre Ronco, Emmanuelle Plaisier, Pierre Aucouturier. (2010) Ig-Related Renal Disease in Lymphoplasmacytic Disorders: An Update. Seminars in Nephrology 30:6, 557-569
CrossRef5
Guillermo A. Herrera, Elba A. Turbat-Herrera. (2010) Ultrastructural Immunolabeling in the Diagnosis of Monoclonal Light-and Heavy-chain-related Renal Diseases. Ultrastructural Pathology 34:3, 161-173
CrossRef6
D. Corcos, M. J. Osborn, L. S. Matheson, F. Santos, X. Zou, J. A. Smith, G. Morgan, A. Hutchings, M. Hamon, D. Oxley, M. Bruggemann. (2010) Immunoglobulin aggregation leading to Russell body formation is prevented by the antibody light chain. Blood 115:2, 282-288
CrossRef7
Yuji Oe, Izaya Nakaya, Mayumi Yahata, Tsutomu Sakuma, Hiroshi Sato, Jun Soma. (2010) A Case of γ 1-Heavy Chain Deposition Disease Successfully Treated with Melphalan and Prednisolone Therapy. Internal Medicine 49:14, 1411-1415
CrossRef8
Kensuke Joh. (2007) Pathology of glomerular deposition diseases. Pathology International 57:9, 551-565
CrossRef9
Mara Popović, Rok Tavćar, Damjan Glavač, Metka Volavšek, Zvezdan Pirtošek, Alenka Vizjak. (2007) Light chain deposition disease restricted to the brain: the first case report. Human Pathology 38:1, 179-184
CrossRef10
Jeffrey G. Penfield. (2006) HEMATOLOGY: ISSUES IN THE DIALYSIS PATIENT: Multiple Myeloma in End-Stage Renal Disease. Seminars in Dialysis 19:4, 329-334
CrossRef11
Hiroshi Ohtani, Hideki Wakui, Atsushi Komatsuda, Shin Okuyama, Rie Masai, Nobuki Maki, Akihiko Kigawa, Ken-ichi Sawada. (2006) Nodular mesangial lesions, marked mesangiolysis, and fingerprint deposits of unknown origin in a patient with nephrotic syndrome: a unique combination of glomerular lesions. Clinical and Experimental Nephrology 10:2, 140-145
CrossRef12
A. Komatsuda, N. Maki, H. Wakui, H. Ohtani, T. Hatakeyama, T. Yasuda, Y. Nakamoto, H. Imai, K.-i. Sawada. (2005) Development of systemic -light chain amyloidosis in a patient with -heavy chain deposition disease during long-term follow-up. Nephrology Dialysis Transplantation 20:2, 434-437
CrossRef13
Masahide Yazaki, Tomohisa Fushimi, Takahiko Tokuda, Fuyuki Kametani, Kanji Yamamoto, Masayuki Matsuda, Hisashi Shimojo, Yoshinobu Hoshii, Kei-ichi Higuchi, Shu-ichi Ikeda. (2004) A patient with severe renal amyloidosis associated with an immunoglobulin γ-heavy chain fragment. American Journal of Kidney Diseases 43:5, e23-e28
CrossRef14
A. C. Vedder. (2004) Intracapillary proliferative glomerulonephritis due to heavy chain deposition disease. Nephrology Dialysis Transplantation 19:5, 1302-1304
CrossRef15
Jun Soma, Kozo Sato, Tsutomu Sakuma, Hirotaka Saito, Hiroshi Sato, Toshinobu Sato, Aı̈cha Abbas, Pierre Aucouturier. (2004) Immunoglobulin γ3-heavy-chain deposition disease: report of a case and relationship with hypocomplementemia. American Journal of Kidney Diseases 43:1, E10-E16
CrossRef16
Keith M. Thompson, Knut Sletten, Per Brandtzaeg, Eva K
llberg, Tale Norbye Wien, Gunnar Husby. (2003) Articular, monoclonal ?3 heavy-chain deposition disease: Characterization of a partially deleted heavy-chain gene and its protein product synthesized in vivo and in vitro. Arthritis & Rheumatism 48:11, 3266-3271
CrossRef17
John N. Copeland, Peter A. Kouides, Marvin Grieff, Tibor Nadasdy. (2003) Metachronous Development of Nonamyloidogenic ?? Light Chain Deposition Disease and IgG Heavy Chain Amyloidosis in the Same Patient. The American Journal of Surgical Pathology 27:11, 1477-1482
CrossRef18
Danevad, Sletten, Gaarder, Mellbye, Husby. (2000) The Amino Acid Sequence of a Monoclonal gamma3-Heavy Chain from a Patient with Articular gamma-Heavy Chain Deposition Disease. Scandinavian Journal of Immunology 51:6, 602-606
CrossRef19
Hal J. Mitnick. (2000) Paraneoplastic rheumatic syndromes. Current Rheumatology Reports 2:2, 163-170
CrossRef20
Gunnar Husby. (2000) Is there a pathogenic link between gamma heavy chain disease and chronic arthritis?. Current Opinion in Rheumatology 12:1, 65-70
CrossRef21
Joel Buxbaum, Gloria Gallo. (1999) NONAMYLOIDOTIC MONOCLONAL IMMUNOGLOBULIN DEPOSITION DISEASE. Hematology/Oncology Clinics of North America 13:6, 1235-1248
CrossRef22
Jacek M. Polski, Nancy Galvin, Luis Salinas-Madrigal. (1999) Non-amyloid fibrils in heavy chain deposition disease. Kidney International 56:4, 1601-1602
CrossRef23
Pierre M Ronco. (1999) Paraneoplastic glomerulopathies: New insights into an old entity. Kidney International 56:1, 355-377
CrossRef24
Neeraja Kambham, Glen S. Markowitz, Gerald B. Appel, Morton J. Kleiner, Pierre Aucouturier, Vivette D. D'Agati. (1999) Heavy chain deposition disease: The disease spectrum. American Journal of Kidney Diseases 33:5, 954-962
CrossRef25
Madhav V. Dhodapkar, Giampaolo Merlini, Alan Solomon. (1997) BIOLOGY AND THERAPY OF IMMUNOGLOBULIN DEPOSITION DISEASES. Hematology/Oncology Clinics of North America 11:1, 89-110
CrossRef26
Ignatius K.P. Cheng, Stephen K.N. Ho, Daniel T.M. Chan, W.K. Ng, Kwok-wah Chan. (1996) Crescentic nodular glomerulosclerosis secondary to truncated immunoglobulin α heavy chain deposition. American Journal of Kidney Diseases 28:2, 283-288
CrossRef27
Andrew M. Herzenberg, John Lien, Alex B. Magil. (1996) Monoclonal heavy chain (immunoglobulin G3) deposition disease: report of a case. American Journal of Kidney Diseases 28:1, 128-131
CrossRef28
Ahmed Amine Khamlichi, Pierre Aucouturier, Jean-Louis Preud'Homme, Michel CognE. (1995) Structure of Abnormal Heavy Chains in Human Heavy-chain-deposition Disease. European Journal of Biochemistry 229:1, 54-60
CrossRef29
Jean-Louis Preud'homme, Pierre Aucouturier, Guy Touchard, Liliane Striker, Ahmed Amine Khamlichi, Anna Rocca, Luc Denoroy, Michel Cogné. (1994) Monoclonal immunoglobulin deposition disease (Randall type). Relationship with structural abnormalities of immunoglobulin chains. Kidney International 46:4, 965-972
CrossRef30
Solomon, Alan, Weiss, Deborah T., . (1993) Ominous Consequences of Immunoglobulin Deposition. New England Journal of Medicine 329:19, 1422-1423
Full Text
