Original Article
A Short-Term Clinical Evaluation of L-697,661, a Non-Nucleoside Inhibitor of HIV-1 Reverse Transcriptase
N Engl J Med 1993; 329:1065-1072October 7, 1993
- Abstract
Background
The non-nucleoside reverse transcriptase inhibitors are novel antiretroviral agents with selective activity in vitro against human immunodeficiency virus type 1 (HIV-1). They act through direct inhibition of reverse transcriptase and are not incorporated into DNA.
Methods
We evaluated a pyridinone non-nucleoside reverse transcriptase inhibitor, L-697,661, in separate six-week double-blind trials in patients with HIV-1 infection whose CD4 counts ranged from 200 to 500 cells per cubic millimeter (68 patients) or less than 200 cells per cubic millimeter (67 patients). Eligible patients were randomly assigned to receive L-697,661 orally in one of three doses (25 mg twice a day, 100 mg three times a day, or 500 mg twice a day) or zidovudine (100 mg five times a day). Clinical and laboratory assessments were performed weekly. Viral isolates were obtained from a subgroup of patients before and after treatment and were evaluated for in vitro sensitivity to L-697,661.
Results
Both L-697,661 and zidovudine were well tolerated. Transient increases in CD4 counts were noted in the patients with fewer than 200 CD4 cells per cubic millimeter who received the two higher doses of L-697,661, but not in those who received the lowest dose or zidovudine. Patients who received L-697,661 had rapid, dose-related decreases in plasma p24 antigen levels. However, this response virtually disappeared after six weeks in some patients receiving L-697,661, coincidently with the emergence of resistant viruses. This change in susceptibility was more frequent among patients receiving the higher doses of L-697,661 and was associated with amino acid substitutions at positions 103 and 181 in the HIV-1 reverse transcriptase gene.
Conclusions
L-697,661 is safe and well tolerated and has significant dose-related activity against HIV-1. However, resistant strains of the virus emerge rapidly and may limit the effectiveness of non-nucleoside reverse transcriptase inhibitors as monotherapy for HIV-1 infection.
Media in This Article
Figure 1
Plasma p24 Antigen Levels and IC90 Values for L-697,661 and Zidovudine in HIV-1 Isolates from Eight Representative Patients Treated with L-697,661.Table 1
Commonly Reported Adverse Events.Article Activity
- Article
Current treatment of human immunodeficiency virus type 1 (HIV-1) infection consists exclusively of the nucleoside-analogue reverse transcriptase inhibitors zidovudine, didanosine, and zalcitabine1-8. Unfortunately, the antiretroviral and clinical effectiveness of nucleoside therapy diminishes over time. It remains unclear whether the loss of effectiveness of these agents is due to incomplete inhibition of viral replication, the development of resistant viral variants, or other mechanisms of pathogenesis9-11. Therefore, the search for new agents that inhibit viral replication more completely, preferably through complementary mechanisms of action, has intensified.
A new group of non-nucleoside reverse transcriptase inhibitors has been developed over the past several years12-17. In contrast to the nucleoside analogues, which inhibit the reverse transcription process by incorporation into the elongating DNA strand with resultant chain termination, the non-nucleoside agents act through direct inhibition of reverse transcriptase and are not incorporated into the growing DNA chain. These agents, which include the tetrahydroimidazobenzo-diazepinone (TIBO) derivatives,12 alpha-anilino phenylacetamide derivatives,13 delavirdine (U-90152),14 nevirapine (BI-RG 587),15 and the pyridinone derivatives,16,17 selectively inhibit HIV-1 (but not HIV-2) reverse transcriptase at nanomolar concentrations and are active against HIV-1 isolates that are resistant to zidovudine16,17.
Recently, one compound from the pyridinone group -- L-697,661 -- was selected for further development in phase 1-2 clinical trials. Preclinical studies and early pharmacokinetic studies in humans demonstrated that it had good oral bioavailability, with serum levels of more than 1 μmol per liter after a single oral dose of 500 mg, and an acceptable safety profile. In this paper, we describe the results of two initial clinical trials of this new compound.
Methods
Patients
Two independent, concurrently run clinical trials were initiated in May 1991 at the University of Alabama at Birmingham. The protocol for each trial was approved by the university's institutional review board. Patients with HIV-1 infection whose CD4 counts ranged from 200 to 500 cells per cubic millimeter were treated under protocol A, and patients with counts below 200 per cubic millimeter were treated under protocol B. Both protocols specified that patients had to be more than 17 years old, not be pregnant, have normal renal and hepatic function (all laboratory values had to be less than twice the upper limit of normal), be seronegative for hepatitis B surface antigen, not be taking recreational drugs or abusing alcohol, and be able to give informed consent. Patients were excluded from treatment under protocol A if they had had evidence of the acquired immunodeficiency syndrome (AIDS) (i.e., an AIDS-defining condition). Patients were eligible for treatment under protocol B if they had previously had Pneumocystis carinii pneumonia or stable Kaposi's sarcoma but were ineligible if they had a history of any other AIDS-defining condition. Patients could be treated under either protocol if they had undergone antiretroviral therapy with zidovudine, but could not have received the drug for a minimum of 14 days before they began receiving study medication. No investigational or immunosuppressive agents could be given within 30 days before study entry.
Study Design and Treatment Regimens
The studies were double-blind, randomized, parallel-group six-week clinical trials. Under both protocols, patients were assigned to one of the following treatments according to a randomized allocation schedule: a low dose of L-697,661 (25 mg orally every 12 hours), a medium dose of L-697,661 (100 mg orally every 8 hours), a high dose of L-697,661 (500 mg orally every 12 hours), or standard therapy with zidovudine (100 mg orally every 4 hours, five times daily). Fifteen patients were sought for each of the four treatment groups in both protocols (total target enrollment, 120 patients). At the end of the six-week study period, the study treatment was stopped for a one-week washout period during which additional tests for surrogate markers of antiviral activity were performed. After this period, the patients were allowed to continue taking study medications in a double-blind fashion as part of an extension protocol. Patients in protocol B continued to receive therapy for an additional six weeks according to their originally assigned regimens. Patients in protocol A who had taken L-697,661 continued to receive it according to their original treatment assignments; however, those in protocol A who had originally taken zidovudine were randomly reassigned to receive one of the three doses of L-697,661.
Evaluation and Follow-up
During the two weeks before enrollment, all patients underwent a physical examination, electrocardiography, and a clinical laboratory evaluation, and a complete history was obtained. Base-line laboratory studies and physical examination were repeated on the day of study entry and on each subsequent visit. Patients were assessed weekly throughout the six-week study period and again during study week 7 after the one-week washout period. During the six-week extension, patients were evaluated every other week.
Antiretroviral activity was assessed by weekly measurement of CD4 cell counts and plasma HIV-1 p24 antigen levels (Abbott Laboratories, Chicago). A p24 antigen test was defined as positive if it detected more than 4 pg of p24 antigen per milliliter (a majority of patients with detectable p24 antigen had levels above 25 pg per milliliter). As part of the protocol, aliquots of plasma and peripheral-blood mononuclear cells (PBMCs) were collected periodically throughout the study and stored at -70 °C and -156 °C, respectively, for future use, including evaluation for the development of resistance.
Virus Isolation
Blood for isolation of the virus was obtained from all patients on the day therapy was initiated (day 0) and again on day 49, one week after therapy was discontinued. Pretreatment and post-treatment viral isolates from 22 randomly chosen patients were selected for evaluation. HIV-1 was isolated from the PBMCs by cocultivation with phytohemagglutinin-stimulated donor PBMCs as previously described18. Thus, all viral isolates represented primary virus amplifications.
Viral-Isolate Expansion and Sensitivity Assay
Paired primary viral isolates (pretreatment and post-treatment isolates) were thawed and added separately to 5.0 × 106 activated, uninfected normal donor PBMCs in 5.0 ml of culture medium. Additional activated PBMCs were added at two-day intervals; seven days after initiation, the final culture contained approximately 4.0 × 106 cells per milliliter in 40 ml. After two more days of incubation, the culture medium was collected, centrifuged to remove residual cells, and stored at -70 °C in 1.0-ml aliquots. Viral p24 antigen in the stored medium was measured with a commercial assay (Coulter, Hialeah, Fla.).
Sensitivity assays were performed in 48-well cell-culture plates. Each well contained 5.0 × 105 activated, uninfected human PBMCs in a total volume of 0.5 ml of culture medium. The same inoculum of virus (5 to 500 pg of p24 antigen) was used to evaluate both pretreatment and post-treatment isolates. Test compounds were added to the culture wells in a twofold-dilution series. Twenty-four hours after the start of the assay, the viral inoculum was removed by harvesting and washing the cells from each well. The cells were then resuspended in fresh medium containing the appropriate concentration of test compound and were seeded in 96-well cell-culture plates. Each well received 2.5 × 105 cells in 0.25 ml. Cultures were fed with compound-containing medium, and viral p24 antigen levels were determined every two to three days.
All assays were performed in quadruplicate, and control cultures without test compound were included. The 90 percent inhibitory concentration (IC90) was determined on day 11 of the assay by comparing the mean p24 antigen levels in test cultures with the levels expressed by the control cultures. The IC90 value was the lowest actual concentration of test compound that inhibited p24 antigen expression by at least 90 percent.
Sequencing the Reverse Transcriptase Coding Region
DNA was extracted from the cryopreserved PBMCs (approximately 1.0 × 106 to 5.0 × 106 cells) from the viral-isolate expansion. The viral reverse transcriptase gene (1680 bp) was amplified by means of a nested-primer polymerase chain reaction (PCR). The sequences of the flanking primer pair were (sense) 5'GGACCTACACCTGTCAACAT (nucleotides 2483 to 2502 of HXB2) and (antisense) 5'TCACTAGCCATTGCTCTCCA (nucleotides 4283 to 4302). The sequences of the nested primer pair were (sense) 5'CCGACCTGCATAGAATTCATGCC(C/A)ATTAGTCCTATTGA (nucleotides 2549 to 2565) and (antisense) 5'GCCCCGACCTGCATAAAGCTTATAGTAC(C/T)TTCCTGATTCC (nucleotides 4211 to 4229). The nested primers included either ATG initiation or TGA termination codons and restriction-enzyme sites to facilitate cloning and expression of reverse transcriptase. The first-round PCR reaction mixture contained PCR buffer I (Perkin-Elmer Cetus, Norwalk, Conn.), 200 μmol of each deoxynucleoside triphosphate per liter, 1 μmol of each flanking primer per liter, 0.5 μg of template DNA, and 2 units of Taq polymerase in a final volume of 50 microliters. Amplification was carried out for one minute at 94 °C, one minute at 56 °C, and three minutes at 72 °C, for 25 cycles. On completion, 3 microliters of the reaction product was added to a second-round PCR mixture, which contained 1 μmol of each nested primer per liter in a 100-microliter reaction volume. PCR was carried out for one minute at 94 °C, one minute at 45 °C, and three minutes at 72 °C, for five cycles. The annealing temperature was then raised from 45 °C to 52 °C, and the samples were amplified for an additional 30 cycles. The reverse transcriptase PCR products were cloned into the EcoRI and HindIII sites of bacterial expression plasmid pLG18-1, a derivative of pRT1-lacI19 in which the reverse transcriptase coding sequences were replaced with polylinker HindIII/EcoRI Genblock (Pharmacia LKB Biotechnology, Piscataway, N.J.). The expression plasmids were screened for the presence of a functional reverse transcriptase with use of the in situ assay, essentially as described by Prasad and Goff,20 to eliminate the sequencing of clones containing stop codons. Reverse transcriptase expression was induced with 200 μmol of isopropyl-beta-d-thiogalactopyranoside for six hours. The reverse transcriptase coding region from three molecular clones that exhibited enzymatic activity in the in situ assay was sequenced. Sequence analysis was confined to the N-terminal 343 codons of the reverse transcriptase gene.
Statistical Analysis
Differences in base-line characteristics among the treatment groups were assessed with an extension of Fisher's exact test for categorical outcomes21 and analysis of variance for continuous outcomes (on ranks for CD4 counts and p24 antigen levels). Drug safety and tolerability were assessed by tabulating clinically relevant adverse events. Fisher's exact test was used to compare the observed incidence rates among and between the treatment groups. Adverse events were recorded only if they began between the time of the first dose and the end of the extension period.
Mixed-effect models22,23 were used to analyze the temporal change in each surrogate marker during the first six weeks of treatment. The analysis focused on the first six weeks because the treatment of some patients in protocol A was changed from zidovudine to L-697,661. For each patient, the logarithm of the ratio of values from week 1 through week 6 to base-line values was modeled as a simple, random slope over time. The analysis of p24 antigen values was restricted to patients whose pretreatment levels were above the detectable limit (i.e., >4 pg per milliliter); if levels were undetectable on subsequent visits, the minimal detectable level was recorded. The patients were evaluated according to their protocol, except in the evaluation of p24 antigen values; the few patients in protocol A who had detectable levels of the antigen (18 patients) were evaluated together with the patients in protocol B.
Significant results (P<0.05) are reported without adjustment for multiple comparisons, and all P values are based on two-sided tests.
Results
Base-Line Characteristics
A total of 68 patients in protocol A and 67 patients in protocol B were randomly assigned to the four treatment regimens. Only four patients (two in each study) were nonwhite. Most of the patients were men (93 percent), and the average age was 36 years. No significant demographic differences between the treatment groups were detected in either study. Furthermore, there were no clinically important differences between the treatment groups in the results of pretreatment laboratory tests for drug safety. As expected, the proportion of patients with detectable plasma p24 antigen levels before treatment was greater in protocol B (69 percent) than in protocol A (26 percent). Among the patients in protocol A, there were significant differences in median pretreatment CD4 counts between those receiving 50 mg of L-697,661 (395 per cubic millimeter) and those receiving 300 mg (243 per cubic millimeter, P = 0.009) or 1000 mg (294 per cubic millimeter, P = 0.05) or those receiving zidovudine (294 per cubic millimeter, P = 0.02). No within-protocol treatment differences were detected in the frequency of pretreatment p24 antigenemia.
Among the patients in protocols A and B, 59 (87 percent) and 55 (82 percent), respectively, had previously received zidovudine therapy; most (38 and 45, respectively) had undergone therapy for more than six months. In both protocols, a greater proportion of patients assigned to the low dose of L-697,661 had received zidovudine, but this difference was not significant.
Treatment Period
Eight patients (12 percent) in protocol A and 18 patients (27 percent) in protocol B did not complete the full 13-week study period. One other patient in protocol B was withdrawn from treatment shortly before the visit during week 6 because of elevated liver-enzyme levels; treatment was resumed after the washout period, without subsequent hepatic dysfunction. Only two patients in protocol A were withdrawn because of adverse clinical events (nausea in both patients and headache and lethargy in one each). Ten patients in protocol B were withdrawn because of adverse clinical events (esophageal ulcer and candidiasis in one patient, pulmonary cryptococcosis in one, worsening Kaposi's sarcoma requiring chemotherapy in one, desquamating rash in two, constitutional symptoms in three, cerebral toxoplasmosis in one, and peripheral neuropathy in one). Three adverse clinical events in combination with elevated serum aminotransferase levels were noted: Hodgkin's lymphoma in one patient (protocol A), rash in another (protocol A), and fever in a third (protocol B). Two patients (one in each protocol) were withdrawn during the first week of the study when they were found to have been ineligible for entry.
Safety and Tolerability
The adverse events are summarized in Table 1Table 1
Commonly Reported Adverse Events.. There were no differences in the frequency of fever, headache, and asthenia or fatigue. However, significantly more patients receiving 300 mg of L-697,661 had rashes than those receiving zidovudine (P = 0.04). More patients receiving zidovudine reported at least one episode of nausea than those receiving L-697,661, but this difference was not significant. One patient in protocol A who was receiving L-697,661 (1000 mg) was temporarily withdrawn from treatment because of elevated serum liver-enzyme levels (aspartate and alanine aminotransferase); treatment was resumed with a lower dose (300 mg per day), with no recurrence of hepatic dysfunction. No patient had a significant elevation of the serum total bilirubin or serum creatinine level. Abnormally low hemoglobin levels (≤ 8 g per deciliter) were not observed in any patient in protocol A, but were seen in four patients in protocol B (one patient per treatment group). No patient had a white-cell count below 1000 per cubic millimeter. A serious opportunistic infection and a neoplasm developed in two patients before the conclusion of the 13 weeks of study (Hodgkin's lymphoma in a patient in protocol A receiving 50 mg of L-697,661 and cerebral toxoplasmosis in a patient in protocol B receiving 50 mg of L-697,661). One patient died during the study period, but had been withdrawn from the study for over two weeks before death (zidovudine, protocol B).Measurements of Antiretroviral Activity
Mixed-effects-model estimates of the change from base line in the CD4 count after one week and six weeks of treatment are shown in Table 2Table 2
Changes from Base Line in CD4 Counts and Plasma p24 Antigen Levels after One and Six Weeks of Treatment.. None of the changes were significant among the patients in protocol A. Among the patients in protocol B, significant increases from base line were seen at week 1 in those receiving 300 mg of L-697,661 (53.2 percent, P<0.001) and those receiving 1000 mg (29 percent, P = 0.01), although the CD4 counts in each of these groups returned to close to base line by week 6 (6.7 percent above base line and 2.7 percent below base line, respectively). In contrast, the patients receiving the low dose of L-697,661 (50 mg) had an immediate and progressive fall from base line in the CD4 counts; the decrease became significant by week 6 (32.1 percent, P = 0.002). CD4 counts did not increase significantly from base line among the patients receiving zidovudine (4.8 percent at week 1 and 4.6 percent at week 6, P>0.05 for both).Mixed-effects-model estimates for the change from base line in the p24 antigen level at week 1 and week 6 are also shown in Table 2. All patients receiving L-697,661 had significant declines in p24 antigen levels from base line at week 1 (19.2 percent in those receiving 50 mg, P = 0.04; 31.9 percent in those receiving 300 mg, P = 0.002; and 42.1 percent in those receiving 1000 mg, P<0.001); however, only those receiving 300 mg had a significant decrease at week 6 (34.1 percent, P = 0.015). A trend toward decreased p24 antigen levels was observed in the patients receiving zidovudine, but this trend did not reach statistical significance. In the patients receiving 1000 mg of L-697,661, the slope estimate for p24 antigen levels between week 1 (-42.1 percent) and week 6 (-17.0 percent) was significant (P<0.05), thus raising the possibility that HIV-1 had become resistant to the drug.
Viral-Susceptibility Assays
Table 3Table 3
Resistance-Associated Amino Acid Mutations and Susceptibility of Viral Isolates. shows the IC90 values for L-697,661 and zidovudine in viral isolates from 19 randomly selected patients before and after treatment. All pretreatment isolates (week 0) were found to be sensitive to L-697,661; the IC90 ranged from 25 to 800 nmol per liter. Loss of sensitivity to L-697,661, indicated by an eightfold or greater difference between pretreatment and post-treatment isolates, was observed in all five patients receiving the high dose of the drug (1000 mg per day), four of five receiving the medium dose (300 mg), and two of six receiving the low dose (50 mg). The development of drug resistance generally coincided with increases in the plasma p24 antigen level between weeks 1 and 6 of treatment (Figure 1Figure 1Plasma p24 Antigen Levels and IC90 Values for L-697,661 and Zidovudine in HIV-1 Isolates from Eight Representative Patients Treated with L-697,661.). As expected, changes in sensitivity to zidovudine were not found in isolates from the patients treated with L-697,661, nor were changes in sensitivity to L-697,661 observed in isolates from patients treated with zidovudine.The reverse transcriptase coding regions of the 19 pairs of isolates were sequenced and analyzed for amino acid substitutions known from in vitro studies to contribute to phenotypes showing resistance to L-697,661 and zidovudine10,11,24. Three molecular clones from each isolate representing the predominant viral genotype were sequenced. The results, summarized in Table 3, reveal a perfect correlation between reduced viral sensitivity to the non-nucleoside inhibitor and selection for mutational alterations at reverse transcriptase residue 103 or 181 (or both). An 8-fold to 10-fold loss of sensitivity to L-697,661 was associated with a substitution of glutamine for lysine at position 103 (Patient 9). A higher level of resistance (≥ 30-fold loss of sensitivity) was associated exclusively with a substitution of cysteine for tyrosine at position 181, occasionally expressed with a substitution of asparagine for lysine at position 103. A substitution of arginine for lysine at position 103 in an isolate from Patient 16 was not associated with reduced drug sensitivity. Resistance to zidovudine correlated with alterations at residues 41, 67, 70, 215, and 219, as reported previously10,11.
The pretreatment and post-treatment viral isolates from Patients 3, 8, and 9 were tested for cross-resistance to other non-nucleoside reverse transcriptase inhibitors -- L-697,229, nevirapine, and R82913 (a TIBO derivative). As compared with the pretreatment isolates, which were uniformly sensitive to these agents, the post-treatment isolates were resistant to all three inhibitors, showing increases of 15-fold to 240-fold in the IC90 (data not shown).
Discussion
This study reports on the clinical activity and safety profile of L-697,661, a novel antiretroviral agent representative of the non-nucleoside reverse transcriptase inhibitors. All three doses of L-697,661 were well tolerated, and their safety profile was comparable to that of zidovudine. Over the 13-week study period, a small proportion of the patients were withdrawn from treatment because of adverse reactions. With few exceptions, these reactions were evenly distributed among all treatment groups and between the two protocol groups. Nausea was a common side effect but occurred more often among patients receiving zidovudine. Rash was the only adverse reaction that occurred more frequently among those receiving L-697,661. Although preclinical studies indicated the potential hepatotoxicity of L-697,661, very few of the patients receiving L-697,661 had markedly elevated serum aminotransferase levels; there was no significant difference between the patients receiving L-697,661 and those receiving zidovudine in the frequency of these abnormal values.
Previous studies of zidovudine and other nucleoside agents generally have observed a significant increase in the CD4 count over the first 6 to 8 weeks of therapy, with a return toward base line by 24 weeks1-3,25. In the present study, the CD4 counts of the patients receiving the medium or high dose of L-697,661 were increased significantly at week 1 but returned to base line by week 6 (Table 2); the counts of the patients receiving the low dose showed an immediate and progressive decline. The CD4 counts of the patients receiving zidovudine did not change significantly over the treatment period, probably because over 80 percent of the patients had received zidovudine therapy previously.
Changes in plasma p24 antigen levels generally correlated inversely with changes in CD4 counts, with a significant early (week 1) but unsustained fall in response to L-697,661 (Table 2). In many patients, the fall in the p24 antigen level at week 1 was followed by a progressive increase to base-line or even higher values (Figure 1), suggesting that viral drug resistance had developed.
Previous studies of HIV-1 isolates exposed to L-697,661 in vitro have demonstrated a marked reduction in viral susceptibility to the drug in association with single point mutations at either of two critical amino acid positions (103 and 181) within the reverse transcriptase gene product24. On the basis of these findings, we analyzed pretreatment and post-treatment isolates from a subgroup of patients for susceptibility to L-697,661 and sequenced their reverse transcriptase genes.
This analysis showed that treatment with L-697,661 resulted in the rapid selection of HIV-1 variants that were resistant to inhibition by the compound. Viral sensitivity to L-697,661 was not influenced by previous treatment with zidovudine, and conversely, changes in viral sensitivity to zidovudine were not observed after treatment with the non-nucleoside inhibitor. Analysis of the nucleic acid sequence of the post-treatment isolates revealed alterations at positions 103 and 181 in strains that exhibited drug resistance, but not in those that remained drug sensitive. The frequency of resistance was higher among the patients receiving the medium dose of L-697,661 (four of five patients) or the high dose (all of five patients) than in those receiving the low dose (two of six patients). The absence of the development of resistance to L-697,661 among patients receiving the low dose is most likely due to insufficient selective pressure. Taken together with the CD4 and p24 antigen responses (Table 2), the data argue for a clinically important dose-related antiviral effect of L-697,661.
The rapidity with which resistant viral populations were selected reflects a previously unsuspected dynamism of HIV-1 in vivo. Although there has been a growing appreciation that microbiologic latency of HIV-1 in vivo does not exist,18,26-30 our study suggests an even higher rate of ongoing viral replication, and presumably continuous cellular infection, than previously appreciated. Recent studies using PCR to detect and quantify virion-associated RNA in plasma have corroborated this finding by demonstrating continuous replication of HIV-1 throughout all stages of infection31. Coffin has shown in studies of avian leukosis virus and by computer modeling that even a small (4.0 percent) growth advantage for a variant virus can result in complete replacement of the parental population within 40 to 50 replication cycles32. These findings probably explain the rapid emergence of viral resistance to L-697,661 in our study population. A heightened appreciation of viral dynamics will be important in the design and interpretation of future clinical evaluations of antiviral compounds specific for HIV-1.
The rapid selection of viral variants with decreased sensitivity to L-697,661 will limit the clinical usefulness of this and probably other non-nucleoside reverse transcriptase inhibitors. However, in vitro studies have shown additive or synergistic activity between nucleoside and non-nucleoside antiretroviral agents24,33,34. Thus, these agents may still be useful in combination regimens. Because the emergence of resistant isolates occurred in this study in the setting of established infection, when the genetic complexity of the virus is extensive and subpopulations of resistant virus are more likely,35 the use of non-nucleoside agents for very early infection18,36-38 or post-exposure prophylaxis may be especially advantageous.
Supported by a grant from Merck Research Laboratories and by grants from the National Institutes of Health (AI-27767 and AI-27290), the General Clinical Research Center (NIH NCRR 5M01-RR00032), and the U.S. Army Medical Research Acquisition Activity (DAMD-17-90-C-0064 and DAMD-17-93-C-3146).
We are indebted to John Ryan, Vinod Sardana, Jon Condra, and Mark Goldman for helpful discussions; to Jane Garrison and Dolores Wilson for their assistance in the preparation of the manuscript; to the AIDS Center of the University of Alabama at Birmingham for the use of shared laboratory facilities and administrative assistance; to the staff of the core research facilities of the Birmingham Veterans Affairs Medical Center; and above all, to the study participants, many of whom traveled great distances on a weekly basis to participate in this trial.
Source Information
From the Department of Medicine, University of Alabama at Birmingham (M.S.S., J.D., W.I.L., R.J.W., J.C.K., G.M.S.), and Merck Research Laboratories, West Point, Pa. (E.A.E., O.L.L., W.A.S., C.H., V.W.B., K.W.A., F.E.M.).
Address reprint requests to Dr. Saag at the University of Alabama at Birmingham, 908 S. 20th St., #245B, Birmingham, AL 35294-2050.
The members of the L-697,661 Working Group are listed in the Appendix.
Appendix
The following persons are members of the L-697,661 Working Group: University of Alabama at Birmingham -- P. Chopra, J. Conway, L. DeLoach, S. Hill, S.Y. Jiang, V. Maples, and S.R. Wang; Merck Research Laboratories -- G.B. Calandra, A. Cnaan, L. Gotlib, P. Patterson, J.C. Quintero, A. Rhodes, C.L. Schneider, D.L. Titus, C. Uncapher, and J.A. Waterbury.
- References
References
1
Fischl MA ,Richman DD ,Grieco MH , et al. The efficacy of azidothymidine (AZT) in the treatment of patients with AIDS and AIDS-related complex: a double-blind, placebo-controlled trial. N Engl J Med 1987;317:185-191
Full Text | Web of Science | Medline2
Volberding PA ,Lagakos SW ,Koch MA , et al. Zidovudine in asymptomatic human immunodeficiency virus infection: a controlled trial in persons with fewer than 500 CD4-positive cells per cubic millimeter. N Engl J Med 1990;322:941-949
Full Text | Web of Science | Medline3
Fischl MA ,Parker CB ,Pettinelli C , et al. A randomized controlled trial of a reduced daily dose of zidovudine in patients with the acquired immunodeficiency syndrome. N Engl J Med 1990;323:1009-1014
Full Text | Web of Science | Medline4
Yarchoan R ,Mitsuya H ,Thomas RV , et al. In vivo activity against HIV and favorable toxicity profile of 2',3'-dideoxyinosine. Science 1989;245:412-415
CrossRef | Web of Science | Medline5
Lambert JS ,Seidlin M ,Reichman RC , et al. 2',3'-Dideoxyinosine (ddI) in patients with the acquired immunodeficiency syndrome or AIDS-related complex: a Phase I trial. N Engl J Med 1990;322:1333-1340
Full Text | Web of Science | Medline6
Cooley TP ,Kunches LM ,Saunders CA , et al. Once-daily administration of 2',3'-dideoxyinosine (ddI) in patients with the acquired immunodeficiency syndrome or AIDS-related complex: results of a Phase I trial. N Engl J Med 1990;322:1340-1345
Full Text | Web of Science | Medline7
Yarchoan R ,Perno CF ,Thomas RV , et al. Phase I studies of 2',3'-dideoxycytidine in severe human immunodeficiency virus infection as a single agent and alternating with zidovudine (AZT). Lancet 1988;1:76-81
CrossRef | Web of Science | Medline8
Merigan TC ,Skowron G ,Bozzette SA , et al. Circulating p24 antigen levels and responses to dideoxycytidine in human immunodeficiency virus (HIV) infections: a phase I and II study. Ann Intern Med 1989;110:189-194
Web of Science | Medline9
Larder BA ,Darby G ,Richman DD . HIV with reduced sensitivity to zidovudine (AZT) isolated during prolonged therapy. Science 1989;243:1731-1734
CrossRef | Web of Science | Medline10
Larder BA ,Kemp SD . Multiple mutations in HIV-1 reverse transcriptase confer high-level resistance to zidovudine (AZT). Science 1989;246:1155-1158
CrossRef | Web of Science | Medline11
Kellam P ,Boucher CA ,Larder BA . Fifth mutation in human immunodeficiency virus type 1 reverse transcriptase contributes to the development of high-level resistance to zidovudine. Proc Natl Acad Sci U S A 1992;89:1934-1938
CrossRef | Web of Science | Medline12
Pauwels R ,Andries K ,Desmyter J , et al. Potent and selective inhibition of HIV-1 replication in vitro by a novel series of TIBO derivatives. Nature 1990;343:470-474
CrossRef | Web of Science | Medline13
Pauwels R ,Andries K ,Debyser Z , et al. Potent and highly selective human immunodeficiency virus type 1 (HIV-1) inhibition by a series of alpha-anilinophenylacetamide derivatives targeted at HIV-1 reverse transcriptase. Proc Natl Acad Sci U S A 1993;90:1711-1715
CrossRef | Web of Science | Medline14
Dueweke TJ ,Poppe SM ,Romero DL , et al. U-90152, a potent inhibitor of human immunodeficiency virus type 1 replication. Antimicrob Agents Chemother 1993;37:1127-1131
Web of Science | Medline15
Merluzzi VJ ,Hargrave KD ,Labadia M , et al. Inhibition of HIV-1 replication by a nonnucleoside reverse transcriptase inhibitor. Science 1990;250:1411-1413[Erratum, Science 1991;251:362.]
CrossRef | Web of Science | Medline16
Goldman ME ,Nunberg JH ,O'Brien JA , et al. Pyridinone derivatives: specific human immunodeficiency virus type 1 reverse transcriptase inhibitors with antiviral activity. Proc Natl Acad Sci U S A 1991;88:6863-6867
CrossRef | Web of Science | Medline17
Goldman ME ,O'Brien JA ,Ruffing TL , et al. L-696,229 specifically inhibits human immunodeficiency virus type 1 reverse transcriptase and possesses antiviral activity in vitro. Antimicrob Agents Chemother 1992;36:1019-1023
Web of Science | Medline18
Clark SJ ,Saag MS ,Decker WD , et al. High titers of cytopathic virus in plasma of patients with symptomatic primary HIV-1 infection. N Engl J Med 1991;324:954-960
Full Text | Web of Science | Medline19
Condra JH ,Emini EA ,Gotlib L , et al. Identification of the human immunodeficiency virus reverse transcriptase residues that contribute to the activity of diverse nonnucleoside inhibitors. Antimicrob Agents Chemother 1992;36:1441-1446
Web of Science | Medline20
Prasad VR ,Goff SP . A novel in situ colony screening method to detect human immunodeficiency virus reverse transcriptase activity expressed in bacteria: isolation of pseudorevertants of reverse transcriptase mutants. J Biol Chem 1989;264:16689-16693
Web of Science | Medline21
Mehta CR ,Patel NR . A network algorithm for performing Fisher's exact test r × c contingency tables. J Am Stat Assoc 1983;78:427-434
CrossRef | Web of Science22
Laird NM ,Ware JH . Random-effects models for longitudinal data. Biometrics 1982;38:963-974
CrossRef | Web of Science | Medline23
Laird N ,Lange N ,Stram D . Maximum likelihood computations with repeated measures: application of the EM algorithm. J Am Stat Assoc 1987;82:97-105
CrossRef | Web of Science24
Nunberg JH ,Schleif WA ,Boots EJ , et al. Viral resistance to human immunodeficiency virus type 1-specific pyridinone reverse transcriptase inhibitors. J Virol 1991;65:4887-4892
Web of Science | Medline25
Meng T-C ,Fischl MA ,Boota AM , et al. Combination therapy with zidovudine and dideoxycytidine in patients with advanced human immunodeficiency virus infection: a phase I/II study. Ann Intern Med 1992;116:13-20
Web of Science | Medline26
Coombs RW ,Collier AC ,Allain J-P , et al. Plasma viremia in human immunodeficiency virus infection. N Engl J Med 1989;321:1626-1631
Full Text | Web of Science | Medline27
Ho DD ,Moudgil T ,Alam M . Quantitation of human immunodeficiency virus type 1 in the blood of infected persons. N Engl J Med 1989;321:1621-1625
Full Text | Web of Science | Medline28
Saag MS ,Crain MJ ,Decker WD , et al. High-level viremia in adults and children infected with human immunodeficiency virus: relation to disease stage and CD4+ lymphocyte levels. J Infect Dis 1991;164:72-80
CrossRef | Web of Science | Medline29
Schnittman SM ,Greenhouse JJ ,Lane HC ,Pierce PF ,Fauci AS . Frequent detection of HIV-1-specific mRNAs in infected individuals suggests ongoing active viral expression in all stages of disease. AIDS Res Hum Retroviruses 1991;7:361-367
CrossRef | Web of Science | Medline30
Pantaleo G ,Graziosi C ,Demarest JS , et al. HIV infection is active and progressive in lymphoid tissue during the clinically latent stage of disease. Nature 1993;362:355-358
CrossRef | Web of Science | Medline31
Piatak M Jr ,Saag MS ,Yang LC , et al. High levels of HIV-1 in plasma during all stages of infection determined by competitive PCR. Science 1993;259:1749-1754
CrossRef | Web of Science | Medline32
Coffin JM . Genetic diversity and evolution of retroviruses. Curr Top Microbiol Immunol 1992;176:143-164
Web of Science | Medline33
Richman D ,Rosenthal AS ,Skoog M , et al. BI-RG-587 is active against zidovudine-resistant human immunodeficiency virus type 1 and synergistic with zidovudine. Antimicrob Agents Chemother 1991;35:305-308
Web of Science | Medline34
Chow YK ,Hirsch MS ,Merrill DP , et al. Use of evolutionary limitations of HIV-1 multidrug resistance to optimize therapy. Nature 1993;361:650-654
CrossRef | Web of Science | Medline35
Mohri H ,Singh MK ,Ching WT ,Ho DD . Quantitation of zidovudine-resistant human immunodeficiency virus type 1 in the blood of treated and untreated patients. Proc Natl Acad Sci U S A 1993;90:25-29
CrossRef | Web of Science | Medline36
Pang S ,Shlesinger Y ,Daar ES ,Moudgil T ,Ho DD ,Chen IS . Rapid generation of sequence variation during primary HIV-1 infection. AIDS 1992;6:453-460
CrossRef | Web of Science | Medline37
Shaw GM, Pan G, Clark SJ, Hahn BH, Saag MS. Molecular and biologic transitions from acute to chronic HIV-1 infection. In: Girard M, Valette L, eds. Retroviruses of human A.I.D.S. and related animal diseases: October 28-30, 1991, Paris. Lyon, France: Foundation Marcel Merieux, 1992:73-7.
38
Wolfs TFW ,Zwart G ,Bakker M ,Goudsmit J . HIV-1 genomic RNA diversification following sexual and parenteral virus transmission. Virology 1992;189:103-110
CrossRef | Web of Science | Medline
- Citing Articles (40)
Citing Articles
1
J. Guedj, A.U. Neumann. (2010) Understanding hepatitis C viral dynamics with direct-acting antiviral agents due to the interplay between intracellular replication and cellular infection dynamics. Journal of Theoretical Biology 267:3, 330-340
CrossRef2
José Luis Medina-Franco, Karina Martínez-Mayorga, Cecilia Juárez-Gordiano, Rafael Castillo. (2007) Pyridin-2(1H)-ones: A Promising Class of HIV-1 Non-nucleoside Reverse Transcriptase Inhibitors. ChemMedChem 2:8, 1141-1147
CrossRef3
Igor V. Magedov, Madhuri Manpadi, Nikolai M. Evdokimov, Eerik M. Elias, Elena Rozhkova, Marcia A. Ogasawara, Jennifer D. Bettale, Nikolai M. Przheval’skii, Snezna Rogelj, Alexander Kornienko. (2007) Antiproliferative and apoptosis inducing properties of pyrano[3,2-c]pyridones accessible by a one-step multicomponent synthesis. Bioorganic & Medicinal Chemistry Letters 17:14, 3872-3876
CrossRef4
F. Van Leth, B.S. Kappelhoff, D. Johnson, M.H. Losso, A. Boron-Kaczmarska, M.S. Saag, J.-M. Livrozet, D.B. Hall, J. Leith, A.D.R. Huitema, F.W. Wit, J.H. Beijnen, J.M.A. Lange. (2006) Pharmacokinetic Parameters of Nevirapine and Efavirenz in Relation to Antiretroviral Efficacy. AIDS Research and Human Retroviruses 22:3, 232-239
CrossRef5
P Richard Harrigan, Theresa Mo, Brian Wynhoven, Jennifer Hirsch, Zabrina Brumme, Paula McKenna, Theresa Pattery, Johan Vingerhoets, Lee T Bacheler. (2005) Rare mutations at codon 103 of HIV-1 reverse transcriptase can confer resistance to non-nucleoside reverse transcriptase inhibitors. AIDS 19:6, 549-554
CrossRef6
Dong-Ming Shen, Min Shu, Sander G. Mills, Kevin T. Chapman, Lorraine Malkowitz, Martin S. Springer, Sandra L. Gould, Julie A. DeMartino, Salvatore J. Siciliano, Gloria Y. Kwei, Anthony Carella, Gwen Carver, Karen Holmes, William A. Schleif, Renee Danzeisen, Daria Hazuda, Joseph Kessler, Janet Lineberger, Michael D. Miller, Emilio A. Emini. (2004) Antagonists of human CCR5 receptor containing 4-(pyrazolyl)piperidine side chains. Part 1: Discovery and SAR study of 4-pyrazolylpiperidine side chains. Bioorganic & Medicinal Chemistry Letters 14:4, 935-939
CrossRef7
Min Shu, Jennifer L Loebach, Kerry A Parker, Sander G Mills, Kevin T Chapman, Dong-Ming Shen, Lorraine Malkowitz, Martin S Springer, Sandra L Gould, Julie A DeMartino, Salvatore J Siciliano, Jerry Di Salvo, Kathy Lyons, James V Pivnichny, Gloria Y Kwei, Anthony Carella, Gwen Carver, Karen Holmes, William A Schleif, Renee Danzeisen, Daria Hazuda, Joseph Kessler, Janet Lineberger, Michael D Miller, Emilio A Emini. (2004) Antagonists of human CCR5 receptor containing 4-(pyrazolyl)piperidine side chains. Part 3: SAR studies on the benzylpyrazole segment. Bioorganic & Medicinal Chemistry Letters 14:4, 947-952
CrossRef8
Dong-Ming Shen, Min Shu, Christopher A. Willoughby, Shrenik Shah, Christopher L. Lynch, Jeffrey J. Hale, Sander G. Mills, Kevin T. Chapman, Lorraine Malkowitz, Martin S. Springer, Sandra L. Gould, Julie A. DeMartino, Salvatore J. Siciliano, Kathy Lyons, James V. Pivnichny, Gloria Y. Kwei, Anthony Carella, Gwen Carver, Karen Holmes, William A. Schleif, Renee Danzeisen, Daria Hazuda, Joseph Kessler, Janet Lineberger, Michael D. Miller, Emilio A. Emini. (2004) Antagonists of human CCR5 receptor containing 4-(pyrazolyl)piperidine side chains. Part 2: Discovery of potent, selective, and orally bioavailable compounds. Bioorganic & Medicinal Chemistry Letters 14:4, 941-945
CrossRef9
Ching‐Lung Lai, Jules Dienstag, Eugene Schiff, Nancy W. Y. Leung, Mark Atkins, Christine Hunt, Nathaniel Brown, Mary Woessner, Richard Boehme, Lynn Condreay. (2003) Prevalence and Clinical Correlates of YMDD Variants during Lamivudine Therapy for Patients with Chronic Hepatitis B. Clinical Infectious Diseases 36:6, 687-696
CrossRef10
Jeffrey J. Hale, Richard J. Budhu, Edward B. Holson, Paul E. Finke, Bryan Oates, Sander G. Mills, Malcolm MacCoss, Sandra L. Gould, Julie A. DeMartino, Martin S. Springer, Salvatore Siciliano, Lorraine Malkowitz, William A. Schleif, Daria Hazuda, Michael Miller, Joseph Kessler, Renee Danzeisen, Karen Holmes, Janet Lineberger, Anthony Carella, Gwen Carver, Emilio Emini. (2001) 1,3,4-Trisubstituted pyrrolidine CCR5 receptor antagonists. Part 2: lead optimization affording selective, orally bioavailable compounds with potent Anti-HIV activity. Bioorganic & Medicinal Chemistry Letters 11:20, 2741-2745
CrossRef11
Kristel Van Laethem, Myriam Witvrouw, Christophe Pannecouque, Barbara Van Remoortel, Jean-Claude Schmit, Robert Esnouf, Jörg-Peter Kleim, Jan Balzarini, Jan Desmyter, Erik De Clercq, Anne-Mieke Vandamme. (2001) Mutations in the non-nucleoside binding-pocket interfere with the multi-nucleoside resistance phenotype. AIDS 15:5, 553-561
CrossRef12
D. J. Wiley, Barbara R. Visscher, Stella Grosser, Donald R. Hoover, Roger Day, Stephen Gange, Joan S. Chmiel, Ronald Mitsuyasu, Roger Detels. (2000) Evidence that anoreceptive intercourse with ejaculate exposure is associated with rapid CD4 cell loss. AIDS 14:6, 707-715
CrossRef13
Gerald H. Friedland, Richard Pollard, Brigitte Griffith, Michael Hughes, Gene Morse, Roland Bassett, William Freimuth, Lisa Demeter, Elizabeth Connick, Thomas Nevin, Martin Hirsch, Margaret Fischl. (1999) Efficacy and Safety of Delavirdine Mesylate With Zidovudine and Didanosine Compared With Two-Drug Combinations of These Agents in Persons With HIV Disease With CD4 Counts of 100 to 500 cells/mm3 (ACTG 261). JAIDS Journal of Acquired Immune Deficiency Syndromes 21:4, 281
CrossRef14
Emmanuil Magiorkinis, Dimitrios Paraskevis, Marios Lazanas, Vassilios G. Kiosses, Panagiotis Gargalianos, Angelos Hatzakis. (1999) Identification of reverse transcriptase mutations associated with HIV-1 drug resistance mainly against non-nucleoside reverse transcriptase inhibitors in treatment-naive patients. AIDS 13:10, 1276
CrossRef15
H RUBSAMENWAIGMANN, E HUGUENEL, A SHAH, A PAESSENS, H RUOFF, H VONBRIESEN, A IMMELMANN, U DIETRICH, M WAINBERG. (1999) Resistance mutations selected in vivo under therapy with anti-HIV drug HBY 097 differ from resistance pattern selected in vitro. Antiviral Research 42:1, 15-24
CrossRef16
Anne M.M. Been-Tiktak, Charles A.B. Boucher, Françoise Brun-Vezinet, Véronique Joly, Jan W. Mulder, J. Jost, David A. Cooper, Mauro Moroni, José M. Gatell, Schlomo Staszewski, Robert Colebunders, Graeme J. Stewart, David A. Hawkins, Margaret A. Johnson, Jacqueline M. Parkin, Dermot H. Kennedy, Jennifer F. Hoy, Jan C.C. Borleffs. (1999) Efficacy and safety of combination therapy with delavirdine and zidovudine: a European/Australian phase II trial. International Journal of Antimicrobial Agents 11:1, 13-21
CrossRef17
Lisa M. Demeter, Patricia M. Meehan, Gene Morse, Margaret A. Fischl, Michael Para, William Powderly, John Leedom, Jeanne Holden-Wiltse, Carol Greisberger, Kenneth Wood, Joseph Timpone, Lynne K. Wathen, Thomas Nevin, Lionel Resnick, Donald H. Batts, Richard C. Reichman. (1998) Phase I Study of Atevirdine Mesylate (U-87201E) Monotherapy in HIV-1-Infected Patients. Journal of Acquired Immune Deficiency Syndromes and Human Retrovirology 19:2, 135-144
CrossRef18
Erik De Clercq. (1998) The role of non-nucleoside reverse transcriptase inhibitors (NNRTIs) in the therapy of HIV-1 infection1Presented at the Eleventh International Conference on Antiviral Research, San Diego, CA, 5–10 April 1998.1. Antiviral Research 38:3, 153-179
CrossRef19
J Balzarini. (1998) Retention of marked sensitivity to (S)-4-isopropoxycarbonyl-6-methoxy-3-(methylthiomethyl)-3,4-Dihydroquinoxaline-2(1H)-Thione (HBY 097) by an azidothymidine (AZT)-resistant human immunodeficiency virus type 1 (HIV-1) strain subcultured in the combined presence of quinoxaline HBY 097 and 2′,3′-dideoxy-3′-thiacytidine (Lamivudine). Biochemical Pharmacology 55:5, 617-625
CrossRef20
Kenneth B. Rank, Naisheng Fan, Satish K. Sharma. (1997) A rapid and quantitative assay for inhibition of 3′ cleavage activity of HIV-1 integrase. Antiviral Research 36:1, 27-33
CrossRef21
GJ Moyle. (1997) Viral resistance patterns selected by antiretroviral drugs and their potential to guide treatment choice. Expert Opinion on Investigational Drugs 6:8, 943-964
CrossRef22
ROBERT W. BUCKHEIT, MELINDA HOLLINGSHEAD, SHERMAN STINSON, VALERIE FLIAKAS-BOLTZ, LUKE A. PALLANSCH, JOSEPH ROBERSON, WILLIAM DECKER, CINDY ELDER, SUZANNE BORGEL, CARRIE BONOMI, ROBERT SHORES, TIM SIFORD, LOUIS MALSPEIS, JOHN P. BADER. (1997) Efficacy, Pharmacokinetics, and in Vivo Antiviral Activity of UC781, a Highly Potent, Orally Bioavailable Nonnucleoside Reverse Transcriptase Inhibitor of HIV Type 1. AIDS Research and Human Retroviruses 13:9, 789-796
CrossRef23
S Swindells. (1997) Non-nucleoside reverse transcriptase inhibitors in the treatment of human immunodeficiency virus infection. Expert Opinion on Emerging Drugs 2:1, 155-174
CrossRef24
Erik De Clercq. (1997) Development of resistance of human immunodeficiency virus (HIV) to anti-HIV agents: how to prevent the problem?. International Journal of Antimicrobial Agents 9:1, 21-36
CrossRef25
L. M. Demeter, P. M. Meehan, G. Morse, P. Gerondelis, A. Dexter, L. Berrios, S. Cox, W. Freimuth, R. C. Reichman. (1997) HIV-1 Drug Susceptibilities and Reverse Transcriptase Mutations in Patients Receiving Combination Therapy with Didanosine and Delavirdine. Journal of Acquired Immune Deficiency Syndromes and Human Retrovirology 14:2, 136-144
CrossRef26
ERIC HUNTER. (1996) Perspective: Research Highlights of the University of Alabama at Birmingham Center for AIDS Research : Paradigm Shifts, Translational Research, and CFARs. AIDS Research and Human Retroviruses 12:14, 1301-1303
CrossRef27
Robert T. Schooley, Thomas B. Campbell, Daniel R. Kuritzkes, Terrence Blaschke, Daniel S. Stein, Mary E. Rosandich, John Phair, John C. Pottage, Ferdinand Messari, Ann Collier, James Kahn. (1996) Phase 1 Study of Combination Therapy with L-697,661 and Zidovudine. Journal of Acquired Immune Deficiency Syndromes and Human Retrovirology 12:4, 363-370
CrossRef28
Erik De Clercq. (1996) What can be Expected from Non-nucleoside Reverse Transcriptase Inhibitors (NNRTIs) in the Treatment of Human Immunodeficiency Virus Type 1 (HIV-1) Infections?. Reviews in Medical Virology 6:2, 97-117
CrossRef29
Rebecca Kiser, Susan Makovsky, Sara J. Terpening, Noel Laing, David J. Clanton. (1996) Assessment of a cytoprotection assay for the discovery and evaluation of anti-human immunodeficiency virus compounds utilizing a genetically-impaired virus. Journal of Virological Methods 58:1-2, 99-109
CrossRef30
O'Brien, William A., Hartigan, Pamela M., Martin, David, Esinhart, James, Hill, Andrew, Benoit, Sharon, Rubin, Marc, Simberkoff, Michael S., Hamilton, John D., the Veterans Affairs Cooperative Study Group on AIDS. (1996) Changes in Plasma HIV-1 RNA and CD4+ Lymphocyte Counts and the Risk of Progression to AIDS. New England Journal of Medicine 334:7, 426-431
Full Text31
D CLANTON, R BUCKHEIT, S TERPENING, R KISER, N MONGELLI, A BORGIA, R SCHULTZ, V NARAYANAN, J BADER, W RICE. (1995) Novel sulfonated and phosphonated analogs of distamycin which inhibit the replication of HIV. Antiviral Research 27:4, 335-354
CrossRef32
R DAQUILA. (1995) HIV-1 chemotherapy and drug resistance. Clinical and Diagnostic Virology 3:4, 299-316
CrossRef33
David W. Kimberlin, Clayde S. Crumpacker, Stephen E. Straus, Karen K. Biron, W.Lawrence Drew, Frederick G. Hayden, Mark McKinlay, Douglas D. Richman, Richard J. Whitley. (1995) Antiviral resistance in clinical practice. Antiviral Research 26:4, 423-438
CrossRef34
YUNZHEN CAO, DAVID D. HO, JOHN TODD, ROBERT KOKKA, MICKEY URDEA, JEFFREY D. LIFSON, MICHAEL PIATAK, SHANDE CHEN, BEATRICE H. HAHN, MICHAEL S. SAAG, GEORGE M. SHAW. (1995) Clinical Evaluation of Branched DNA Signal Amplification for Quantifying HIV Type 1 in Human Plasma. AIDS Research and Human Retroviruses 11:3, 353-361
CrossRef35
Xiping Wei, Sajal K. Ghosh, Maria E. Taylor, Victoria A. Johnson, Emilio A. Emini, Paul Deutsch, Jeffrey D. Lifson, Sebastian Bonhoeffer, Martin A. Nowak, Beatrice H. Hahn, Michael S. Saag, George M. Shaw. (1995) Viral dynamics in human immunodeficiency virus type 1 infection. Nature 373:6510, 117-122
CrossRef36
Douglas D. Richman. (1994) Drug resistance in viruses. Trends in Microbiology 2:10, 401-407
CrossRef37
Robert W. Buckheit, Valerie Fliakas-Boltz, W.Don Decker, Joseph L. Roberson, Cathi A. Pyle, E.Lucile White, Bonnie J. Bowdon, James B. McMahon, Michael R. Boyd, John P. Bader, David G. Nickell, Hubert Barth, Tammy K. Antonucci. (1994) Biological and biochemical anti-HIV activity of the benzothiadiazine class of nonnucleoside reverse transcriptase inhibitors. Antiviral Research 25:1, 43-56
CrossRef38
Chiang J. Li, Bruce J. Dezube, Debajit K. Biswas, Christoph M. Ahlers, Arthur B. Pardee. (1994) Inhibitors of HIV-1 transcription. Trends in Microbiology 2:5, 164-169
CrossRef39
Marie-Louse Newell, Catherine S. Peckham. (1994) Working towards a European strategy for intervention to reduce vertical transmission of HIV. BJOG: An International Journal of Obstetrics and Gynaecology 101:3, 192-196
CrossRef40
WILLIAM A. SCHLEIF, KRISHNA K. MURTHY, VINOD V. SARDANA, CHRISTINE L. SCHNEIDER, VERA W. BYRNES, KATHY E. COBB, ELIZABETH ROTH, JILL A. WOLFGANG, JACOB M. HOFFMAN, ANTHONY M. SMITH, KARL M. GELOTTE, EMILIO A. EMINI. (1994) Attempted Prophylaxis of Human Immunodeficiency Virus Type 1 Infection in Chimpanzees with a Nonnucleoside Reverse Transcriptase Inhibitor. AIDS Research and Human Retroviruses 10:1, 107-110
CrossRef
