Original Article
Brief Report
Lymphoma of Donor Origin Occurring in the Porta Hepatis of a Transplanted Liver
N Engl J Med 1993; 329:27-29July 1, 1993
- Article
Non-Hodgkin's lymphoma after organ transplantation is a recognized complication of immunosuppressive therapy. A number of cases of post-transplantation lymphoma arising in allografted tissue have been described1. In addition, leukemia and lymphoma arising from donor cells after allogeneic bone marrow transplantation have been recognized2-8. Two cases of donor-related lymphoma in renal allografts have also been reported9,10.
We describe the development of a lymphoma in a hepatic allograft recipient 4.5 months after orthotopic liver transplantation. Using a rapid technique based on the polymerase chain reaction (PCR), which makes use of a DNA sequence polymorphism at the D4S174 locus on chromosome 4, we demonstrated that the patient's tumor was of donor origin.
Case Report
In November 1991, a 54-year-old man underwent orthotopic liver transplantation for liver failure due to chronic hepatitis C infection. This infection was presumed to have been acquired from multiple transfusions during aortic-valve replacement in 1982. The patient's post-transplantation course included acute rejection beginning five days after surgery. He was treated with methylprednisolone sodium succinate (Solu-Medrol) and OKT3 and was discharged on the 20th day after transplantation with essentially normal hepatic allograft function.
One month later, a cytomegalovirus infection was diagnosed and treated with ganciclovir. The immunosuppressive post-transplantation therapy was adjusted: azathioprine was discontinued, and the daily dose of cyclosporine was gradually tapered from 12 to 9 mg per kilogram of body weight per day. Ten days later, a percutaneous liver biopsy was performed because of persistently abnormal hepatic function. Histopathological analysis showed cytomegalovirus infection with minimal evidence of rejection. After a reduction in the dose of cyclosporine to 6 mg per kilogram per day, the patient's condition improved and he was discharged in early January 1992. During the next two months, allograft function remained stable, with a total bilirubin level of 1.3 to 1.8 mg per deciliter (22 to 31 μmol per liter) and a serum aspartate aminotransferase level of 40 to 60 U per liter. Azathioprine therapy was resumed at a dose of 50 mg per day.
The patient was seen at a routine follow-up visit in March 1992. At that time, his immunosuppressive regimen consisted of 5.3 mg of cyclosporine per kilogram per day, 20 mg of prednisone per day, and 50 mg of azathioprine per day. Physical examination revealed mild icterus but was otherwise normal. Laboratory studies revealed a direct bilirubin level of 3.2 mg per deciliter (55 μmol per liter), total bilirubin level of 4.5 mg per deciliter (77 μmol per liter), lactate dehydrogenase concentration of 2816 U per liter, serum aspartate aminotransferase level of 2292 U per liter, and serum alanine aminotransferase level of 1561 U per liter. The patient was admitted for further evaluation.
Vascular ultrasonography performed on the first hospital day showed a patent portal vein. A percutaneous liver biopsy, performed on the second hospital day, showed macrovesicular steatohepatitis with Mallory's bodies. A contrast-enhanced computed tomographic scan of the abdomen showed a 4-cm mass in the porta hepatis and intrahepatic biliary dilatation (Figure 1Figure 1
Contrast-Enhanced Computed Tomographic Scan Showing a 3-cm Hypodense Mass in the Porta Hepatis Lying Just in Front of the Main Portal Vein (Curved Arrow).). In addition, there was a 3-cm mass posterior to the left lobe of the liver and a small collection of fluid abutting the right hepatic lobe. Magnetic resonance imaging of the liver showed that, although the mass in the porta hepatis was solid, the two other collections of fluid seen on computed tomography were hematomas (Figure 2Figure 2
Magnetic Resonance Imaging Confirming the Presence of a Mass in the Porta Hepatis and Biliary Dilatation on T1-Weighted (Panel A) and T2-Weighted (Panel B) Images.). A T-tube cholangiogram obtained to evaluate the bile ducts failed to provide adequate retrograde filling of the biliary tree. Endoscopic retrograde cholangiopancreatography demonstrated a narrowed segment of the common bile duct proximal to the T tube, apparently caused by extrinsic compression.Exploratory laparotomy revealed a mass measuring 3 by 4 cm at the hilum of the liver, encasing the common bile duct of the allograft. Separate incisional biopsies of this mass and the liver were performed. The mass was classified as a malignant diffuse large-cell lymphoma of B-cell lineage (Figure 3Figure 3
Malignant Diffuse Large-Cell Lymphoma in the Porta Hepatis.). Further staging revealed no other sites of disease. Radiation therapy directed at the region of the mass and the primary draining lymph nodes was begun. The daily dose of cyclosporine was reduced to 2.5 mg per kilogram, and treatment with azathioprine was again discontinued.Methods
DNA was isolated from the patient's blood and frozen tumor specimen as described previously11. DNA fragments from the D4S174 locus were generated with use of the PCR in a volume of 25 microliters containing 2.5 pmol of primer pair (5'AAGAACCATGCGATACGACT3' and 5'CATTCCTAGATGGGTAAAGC3'), 50 ng of DNA, 0.2 mmol (for fresh or frozen tissue) or 2 mmol (for paraffin-embedded samples) of deoxyadenosine triphosphate, deoxythymidine triphosphate, and deoxyguanosine triphosphate; 2 μmol of deoxycytidine triphosphate per liter; 1.5 mmol of magnesium chloride per liter; 20 mmol of TRIS buffer per liter (pH 8.6); 50 mmol of potassium chloride per liter; 50 μg of bovine serum albumin per milliliter; 0.5 U (for fresh or frozen tissue) or 1 U (for paraffin-embedded samples) of Taq polymerase (Perkin-Elmer Cetus); and 0.1 microliter (7 nmol per liter) of [alpha-32P]deoxycytidine triphosphate (3000 Ci per millimole). The reaction was performed for 35 cycles (for fresh or frozen tissue) or 40 cycles (for paraffin-embedded samples), consisting of 5 minutes of denaturation at 94 °C, 30 seconds of annealing at 52 °C, and 30 seconds of extension at 71 °C. The samples were diluted, and polyacrylamide-gel electrophoresis was carried out as described previously12.
Results
The lesion was classified as a malignant diffuse large-cell lymphoma. There was no evidence of allografted tissue in the biopsy specimen. Immunoperoxidase staining of frozen sections showed that the tumor cells expressed IgG-κ. The cells were positive for antibodies to CD20, but negative for antibodies to CD5 and CD10. Rare T cells (CD3+) were also present.
A highly polymorphic dinucleotide repeat [(AC)23A] on chromosome 4 at the D4S174 locus was examined13,14. Eleven different repeat configurations, ranging in size from 175 to 195 base pairs, were described. Figure 4Figure 4
Autoradiograph of the Results of Polyacrylamide-Gel Electrophoresis of the D4S174 Sequence-Length Polymorphism on Chromosome 4. shows the variations in the lengths of PCR fragments derived from the patient's tumor, allograft, blood, and bone marrow. Tumor and blood (lanes 1 and 3, straight arrows) showed distinct differences in alleles, which are best explained by the different genetic origins of these tissues. This indicates that the tumor arose from allografted cells, rather than host tissue. In addition, DNA from a paraffin-embedded sample of allograft, obtained from a separate incisional biopsy, showed a pattern similar to that of the tumor. The allograft also had a weak signal corresponding to that of the recipient (Figure 4; lane 2, open arrow), as would be expected because of the presence of host nucleated blood cells in the allograft. The bone marrow shows an allelic pattern that corresponds predominantly to that of the recipient. Surprisingly, a weak signal corresponding to that of the allograft is evident in the bone marrow in addition to the pattern corresponding to the recipient (Figure 4; lane 4, curved arrow). This most likely represents donor white cells that have engrafted in the marrow; however, an alternative explanation is that there is subclinical involvement of the bone marrow by lymphoma. Analysis of a second highly polymorphic marker, Rb1.20,15 on chromosome 13 (data not shown) also confirmed that the tumor was not derived from host tissues.Discussion
Lymphoproliferative disorders are a potential complication of immunosuppressive therapy in patients who have received solid-organ transplants. In one series, the incidence of such disorders in liver-transplant recipients was 2.2 percent16. Three of the 23 lymphoproliferative disorders in this series were limited to the allograft or periportal region, 3 involved the allograft and distant sites, and 17 consisted of diffuse disease alone.
Two cases of lymphoma arising from donor tissue in recipients of renal allografts have been reported,9,10 but we could find no previous reports of donor-related lymphoproliferative disorders arising from allografted tissue after liver transplantation. A B-cell lymphoma of the porta hepatis developed in our patient 4.5 months after orthotopic liver transplantation. Using a rapid PCR-based technique to detect DNA polymorphisms, we showed that the tumor was of donor origin. The use of these techniques enabled us to analyze paraffin-embedded donor (allograft) and host (bone marrow) tissues, and these results confirmed the observed differences in host tissue and tumor specimens. Presumably, this tumor arose from lymphoid tissue present in the allograft. The donor had no evidence of lymphoma, so that it is unlikely that the recipient's lymphoma arose from occult involvement of the allograft by previously transformed lymphoid cells, although such a case has been reported17. In addition, lymphoma has not developed in two recipients of renal allografts from the same donor.
The role of local and systemic treatment in the management of post-transplantation lymphoproliferative disorders is controversial, since cessation of immunosuppressive therapy or a reduction in the dosage can result in resolution of the disease in some patients18,19. Unfortunately, many lymphomas do not respond to a reduction in the dosage,16,20,21 and the potential benefits of reduced doses of immunosuppressive drugs must be balanced against the risks of rejection in patients with life-sustaining allografts. In one case of donor-related lymphoma after renal transplantation, a trial of reduced doses of immunosuppressive drugs did not eradicate the disease9.
The demonstration that lymphoma can arise from donor tissue in a liver-transplant recipient should encourage molecular analysis of similar cases in which the allograft was the primary site of the lymphoproliferative disorder.
Source Information
From the Departments of Radiation Oncology (I.J.S.), Surgery (J.P., A.B.C.), Radiology (S.S.), Pathology (J.F.), and Medicine (W.N.K.), Massachusetts General Hospital; Harvard University School of Public Health (C.L., D.W.Y.); and Massachusetts Eye and Ear Infirmary (D.W.Y.) -- all in Boston.
Address reprint requests to Dr. Spiro at the Department of Radiation Oncology, Massachusetts General Hospital, Fruit St., Boston, MA 02114.
- References
References
1
Yousem SA ,Randhawa P ,Locker J , et al. Posttransplant lymphoproliferative disorders in heart-lung transplant recipients: primary presentation in the allograft. Hum Pathol 1989;20:361-369
CrossRef | Web of Science | Medline2
Elfenbein GJ ,Brogaonkar DS ,Bias WB , et al. Cytogenetic evidence for recurrence of acute myelogenous leukemia after allogeneic bone marrow transplantation in donor hematopoietic cells. Blood 1978;52:627-636
Web of Science | Medline3
Fialkow PJ ,Thomas ED ,Bryant JI ,Neiman PE . Leukaemic transformation of engrafted human marrow cells in vivo. Lancet 1971;1:251-255
CrossRef | Web of Science | Medline4
Goh K ,Klemperer MR . In vivo leukemic transformation: cytogenetic evidence of in vivo leukemic transformation of engrafted marrow cells. Am J Hematol 1977;2:283-290
CrossRef | Web of Science | Medline5
Gossett TC ,Gale RP ,Fleischman H ,Austin GE ,Sparkes RS ,Taylor CR . Immunoblastic sarcoma in donor cells after bone-marrow transplantation. N Engl J Med 1979;300:904-907
Full Text | Web of Science | Medline6
Newburger PE ,Latt SA ,Pesando JM , et al. Leukemia relapse in donor cells after allogeneic bone-marrow transplantation. N Engl J Med 1981;304:712-714
Full Text | Web of Science | Medline7
Schubach WH ,Hackman R ,Neiman PE ,Miller G ,Thomas ED . A monoclonal immunoblastic sarcoma in donor cells bearing Epstein-Barr virus genomes following allogeneic marrow grafting for acute lymphoblastic leukemia. Blood 1982;60:180-187
Web of Science | Medline8
Thomas ED ,Bryant JI ,Buckner CD , et al. Leukaemic transformation of engrafted human marrow cells in vivo. Lancet 1972;1:1310-1313
CrossRef | Web of Science | Medline9
Hjelle B ,Evans-Holm M ,Yen TSB ,Garovoy M ,Guis M ,Edman JC . A poorly differentiated lymphoma of donor origin in a renal allograft recipient. Transplantation 1989;47:945-948
CrossRef | Web of Science | Medline10
Meduri G ,Fromentin L ,Vieillefond A ,Fries D . Donor-related non-Hodgkins's lymphoma in a renal allograft recipient. Transplant Proc 1991;23:2649-2649
Web of Science | Medline11
Kunkel LM ,Smith KD ,Boyer SH , et al. Analysis of human Y-chromosome-specific reiterated DNA in chromosome variants. Proc Natl Acad Sci U S A 1977;74:1245-1249
CrossRef | Web of Science | Medline12
Toguchida J ,Yamaguchi T ,Dayton SH , et al. Prevalence and spectrum of germline mutations of the p53 gene among patients with sarcoma. N Engl J Med 1992;326:1301-1308
Full Text | Web of Science | Medline13
Weber JL ,May PE . Abundant class of human DNA polymorphisms which can be typed using the polymerase chain reaction. Am J Hum Genet 1989;44:388-396
Web of Science | Medline14
Weber JL ,Kwitek AE ,May PE ,Killary AM . Dinucleotide repeat polymorphism at the D4S174 locus. Nucleic Acids Res 1990;18:4636-4636
Web of Science | Medline15
Yandell DW ,Dryja TP . Detection of DNA sequence polymorphisms by enzymatic amplification and direct genomic sequencing. Am J Hum Genet 1989;45:547-555
Web of Science | Medline16
Nalesnik MA ,Jaffe R ,Starzl TE , et al. The pathology of posttransplant lymphoproliferative disorders occurring in the setting of cyclosporine A-prednisone immunosuppression. Am J Pathol 1988;133:173-192
Web of Science | Medline17
Gambacorta M ,Bonacina E ,Falini B ,Sabattini E ,Pileri S . Malignant lymphoma in the recipient of a heart transplant from a donor with malignant lymphoma: lymphoma transplantation or de novo disease? Transplantation 1991;51:920-922
CrossRef | Web of Science | Medline18
Harris KM ,Schwartz ML ,Slasky BS ,Nalesnik M ,Makowka L . Posttransplantation cyclosporine-induced lymphoproliferative disorders: clinical and radiologic manifestations. Radiology 1987;162:697-700
Web of Science | Medline19
Starzl TE ,Nalesnik MA ,Porter KA , et al. Reversibility of lymphomas and lymphoproliferative lesions developing under cyclosporin-steroid therapy. Lancet 1984;1:583-587
CrossRef | Web of Science | Medline20
Hanto DW ,Frizzera G ,Gajl-Peczalska KJ ,Simmons RL . Epstein-Barr virus, immunodeficiency, and B cell lymphoproliferation. Transplantation 1985;39:461-472
CrossRef | Web of Science | Medline21
Ferry JA ,Jacobson JO ,Conti D ,Delmonico F ,Harris NL . Lymphoproliferative disorders and hematologic malignancies following organ transplantation. Mod Pathol 1989;2:583-592
Web of Science | Medline
- Citing Articles (35)
Citing Articles
1
J. Olagne, S. Caillard, M. P. Gaub, M. P. Chenard, B. Moulin. (2011) Post-transplant Lymphoproliferative Disorders: Determination of Donor/Recipient Origin in a Large Cohort of Kidney Recipients. American Journal of Transplantation 11:6, 1260-1269
CrossRef2
R. Reshef, M.R. Luskin, M. Kamoun, S. Vardhanabhuti, J. E. Tomaszewski, E. A. Stadtmauer, D. L. Porter, D. F. Heitjan, De. E. Tsai. (2011) Association of HLA Polymorphisms with Post-transplant Lymphoproliferative Disorder in Solid-Organ Transplant Recipients. American Journal of Transplantation 11:4, 817-825
CrossRef3
Margaret Burke, Alexandra Rice. 2011. Lung transplantation. , 509-529.
CrossRef4
Sergey V. Anisimov, Asuka Morizane, Ana S. Correia. (2010) Risks and Mechanisms of Oncological Disease Following Stem Cell Transplantation. Stem Cell Reviews and Reports 6:3, 411-424
CrossRef5
John O. Prior, Michel A. Duchosal, Sabine Schmidt, Pierre Turini, Nathalie Pilon, René Chioléro, Manuel Pascual. (2010) Absence of residual Hodgkinâs disease demonstrated by PET/CT in a deceased organ donor. Transplant International 23:1, 101-104
CrossRef6
Gustaf Edgren, Henrik Hjalgrim, Marie Reilly, Trung Nam Tran, Klaus Rostgaard, Agneta Shanwell, Kjell Titlestad, Johanna Adami, Agneta Wikman, Casper Jersild, Gloria Gridley, Louise Wideroff, Olof Nyrén, Mads Melbye. (2007) Risk of cancer after blood transfusion from donors with subclinical cancer: a retrospective cohort study. The Lancet 369:9574, 1724-1730
CrossRef7
D.W. Petrik, R. Lai, R.G. Pearcey. (2007) Post-transplant Lymphoproliferative Disorder (PTLD). Clinical Oncology 19:2, 163-164
CrossRef8
Noriaki Kawano, Kazuya Shimoda, Fumihiko Ishikawa, Akinobu Taketomi, Tomoharu Yoshizumi, Shinji Shimoda, Shuro Yoshida, Koji Uozumi, Shinsuke Suzuki, Yoshihiko Maehara, Mine Harada. (2006) Adult T-cell Leukemia Development From a Human T-cell Leukemia Virus Type I Carrier After a Living-Donor Liver Transplantation. Transplantation 82:6, 840-843
CrossRef9
Sophie Caillard, Erwan Pencreach, Laura Braun, Luc Marcellin, Marie-Lorraine Woehl Jaegle, Philippe Wolf, Anne Parissiadis, Thierry Hannedouche, Marie-Pierre Gaub, Bruno Moulin. (2005) Simultaneous Development of Lymphoma in Recipients of Renal Transplants from a Single Donor: Donor Origin Confirmed by Human Leukocyte Antigen Staining and Microsatellite Analysis. Transplantation 79:1, 79-84
CrossRef10
Yoshihiko Hoshida, Katsuyuki Aozasa. (2004) Malignancies in organ transplant recipients. Pathology International 54:9, 649-658
CrossRef11
Margaret L. Gulley, Lode J. Swinnen, Kerry T. Plaisance, Carrie Schnell, Thomas M. Grogan, Barbara G. Schneider. (2003) Tumor origin and CD20 expression in posttransplant lymphoproliferative disorder occurring in solid organ transplant recipients: implications for immune-based therapy.1. Transplantation 76:6, 959-964
CrossRef12
Suleyman Yedibela, Thomas Reck, Gerald Niedobitek, Martin Gramatzki, Roland Repp, Werner Hohenberger, Rudolf Ott, M. Gramatzki. (2003) Anti-CD20 monoclonal antibody treatment of Epstein-Barr virus-induced intrahepatic lymphoproliferative disorder following liver transplantation. Transplant International 16:3, 197-201
CrossRef13
H. Myron Kauffman, Maureen A. McBride, Francis L. Delmonico. (2000) FIRST REPORT OF THE UNITED NETWORK FOR ORGAN SHARING TRANSPLANT TUMOR REGISTRY: DONORS WITH A HISTORY OF CANCER1. Transplantation 70:12, 1747-1751
CrossRef14
Joyce D. Fingeroth. (2000) HERPESVIRUS INFECTION OF THE LIVER. Infectious Disease Clinics of North America 14:3, 689-719
CrossRef15
J. Dean Nuckols, Pedro W. Baron, Timothy T. Stenzel, Babatunde A. Olatidoye, Janet E. Tuttle-Newhall, Pierre-Alain Clavien, David N. Howell. (2000) The Pathology of Liver-Localized Post-Transplant Lymphoproliferative Disease. The American Journal of Surgical Pathology 24:5, 733-741
CrossRef16
Carlos V. Paya, John J. Fung, Michael A. Nalesnik, Elliott Kieff, Michael Green, Gregory Gores, Thomas M. Habermann, Russell H. Wiesner, Lode J. Swinnen, E. Steve Woodle, Jonathan S. Bromberg. (1999) EPSTEIN-BARR VIRUS-INDUCED POSTTRANSPLANT LYMPHOPROLIFERATIVE DISORDERS. Transplantation 68:10, 1517-1525
CrossRef17
Simonetta Kerim, Maria Cristina Abele, Cristina Jemma, Gigliola Reato, Guido Valente, Giorgio Palestro. (1999) In situ hybridization evidence of the donor origin of a post-transplant lymphoproliferative disorder. European Journal of Haematology 63:1, 61-63
CrossRef18
Jung Yeon Kim, Chul Woo Kim, Curie Ahn, Yung-Jue Bang, Hyun Soon Lee. (1999) Rapidly developing T-cell posttransplantation lymphoproliferative disorder. American Journal of Kidney Diseases 34:1, E3
CrossRef19
Ziv Ben-Ari, Peter Amlot, Surech R. Lachmanan, Ran Tur-Kaspa, Keith Rolles, Andrew K. Burroughs. (1999) Posttransplantation lymphoproliferative disorder in liver recipients: Characteristics, management, and outcome. Liver Transplantation and Surgery 5:3, 184-191
CrossRef20
David J. Emanuel, Kenneth G. Lucas, George B. Mallory, Mary K. Edwards-Brown, Karen E. Pollok, Patricia D. Conrad, Kent A. Robertson, Franklin O. Smith. (1997) TREATMENT OF POSTTRANSPLANT LYMPHOPROLIFERATIVE DISEASE IN THE CENTRAL NERVOUS SYSTEM OF A LUNG TRANSPLANT RECIPIENT USING ALLOGENEIC LEUKOCYTES1. Transplantation 63:11, 1691-1694
CrossRef21
ANDREW F. DEAN, TIMOTHY C. DISS, ANDREW C. WOTHERSPOON, TIM COX, CORINNE NEVARD. (1997) Histologic, Molecular, and Radiologic Characterization of Resolving Cerebral Posttransplant Lymphoproliferative Disorder. Pediatric Research 41:5, 651-656
CrossRef22
O. Detry, P. Honoré, M. Meurisse, P. Bonnet, N. Jacquet. (1997) Malignancy transplantation with graft: do patients with primary central nervous system tumors have to be excluded from the donor pool?. Transplant International 10:1, 83-84
CrossRef23
Brent Lee Wood, Daniel Sabath, Virginia C. Broudy, Ganesh Raghu. (1996) The recipient origin of posttransplant lymphoproliferative disorders in pulmonary transplant patients: A report of three cases. Cancer 78:10, 2223-2228
CrossRef24
Michael Burt, Elizabeth Jazwinska, Stephen Lynch, Paul Kerlin, Devinder Gill, Charles Steadman, Julie Jonsson, Russell Strong, Elizabeth Powell. (1996) Detection of circulating donor deoxyribonucleic acid by microsatellite analysis in a liver transplant recipient. Liver Transplantation and Surgery 2:5, 391-394
CrossRef25
Sven Jonas, Wolf O. Bechstein, Hans-Peter Lemmens, Ruth Neuhaus, Uwe Thalmann, Peter Neuhaus. (1996) Liver graft-transmitted glioblastoma multiforme. A case report and experience with 13 multiorgan donors suffering from primary cerebral neoplasia. Transplant International 9:4, 426-429
CrossRef26
Steven J. Mentzer, Janina Longtine, Joyce Fingeroth, John J. Reilly, Malcolm M. DeCamp, Walter O'Donnell, Scott J. Swanson, Douglas V. Faller, David J. Sugarbaker. (1996) IMMUNOBLASTIC LYMPHOMA OF DONOR ORIGIN IN THE ALLOGRAFT AFTER LUNG TRANSPLANTATION1. Transplantation 61:12, 1720-1725
CrossRef27
Francisco Colina, F. L??pez-R??os, C. Lumbreras, J. Mart??nez-Laso, I. Garc??a Garc??a, E. Moreno-Gonz??lez. (1996) KAPOSI'S SARCOMA DEVELOPING IN A LIVER GRAFT. Transplantation 61:12, 1779-1781
CrossRef28
O. Detry, P. Honoré, M. Meurisse, P. Bonnet, N. Jacquet. (1996) Malignancy transplantation with graft: Do patients with primary central nervous system tumors have to be excluded from the donor pool?. Transplant International 10:1, 83-84
CrossRef29
Israel Penn. (1996) Posttransplantation de novo tumors in liver allograft recipients. Liver Transplantation and Surgery 2:1, 52-59
CrossRef30
Y. Ribas, A. Rafecas, J. Figueras, C. Benasco, J. Fabregat, J. Torras, C. Ca
as, C. Valls, V. Volpini, I. Banchs, E. Jaurrieta. (1995) Post-transplant lymphoma in a liver allograft. Transplant International 8:6, 488-491
CrossRef31
Eric Raymond, Vivianne Tricottet, Didier Samuel, Michel Reynès, Henri Bismuth, Jean-Louis Misset. (1995) Epstein-Barr virus-related localized hepatic lymphoproliferative disorders after liver transplantation. Cancer 76:8, 1344-1351
CrossRef32
C. Shustik, B. M. Jamison, C. Alfieri, S. Scherer, R. Loertscher. (1995) A solitary plasmacytoma of donor origin arising 14 years after kidney allotransplantation. British Journal of Haematology 91:1, 167-168
CrossRef33
Jane E. Armes, Peter Angus, Melissa C. Soufhey, Samuel E. Battaglia, Bruce C. Ross, Robert M. Jones, Deon J. Venter. (1994) Lymphoproliferative disease of donor origin arising in patients after orthotopic liver transplantation. Cancer 74:9, 2436-2441
CrossRef34
Geetha Joseph, Robert L. Barker, Bo Yuan, Alvin Martin, Jeffrey Medeiros, Stephen C. Peiper. (1994) Posttransplantation plasma cell dyscrasias. Cancer 74:7, 1959-1964
CrossRef35
Carolyn Mies. (1994) Molecular biological analysis of paraffin-embedded tissues. Human Pathology 25:6, 555-560
CrossRef
