Correspondence

Polymorphism of the Glycogen Synthase Gene and Non-Insulin-Dependent Diabetes Mellitus

N Engl J Med 1993; 328:1568-1569May 27, 1993

Article

To the Editor:

Dr. Groop and colleagues (Jan. 7 issue)1 reported that, in Finland, the A₂ allele of the XbaI polymorphism of the glycogen synthase gene is associated with non-insulin-dependent diabetes mellitus (NIDDM) and identifies a subgroup of patients with a strong family history of diabetes, a high prevalence of hypertension, and insulin resistance. We studied this polymorphism in 231 unrelated white patients with NIDDM from multiplex French families with the disease by polymerase-chain-reaction (PCR) amplification of the glycogen synthase gene using primers kindly provided by Dr. Groop. The presence of the A₁ and A₂ alleles was compared in the diabetic patients and 52 normal subjects with no family history of diabetes.

The frequency of the A₁ allele was significantly higher (96 percent vs. 88 percent) and that of the A₂ allele significantly lower (4 percent vs. 12 percent) among the patients with diabetes than among the normal subjects (P = 0.006 by chi-square analysis). Furthermore, the frequency of the A₁ allele among the 92 diabetic patients who had a personal and family history of both diabetes and hypertension was significantly higher than in the control group (P = 0.023). The 19 diabetic patients (8 percent) with the A₂ allele and the 212 patients (92 percent) who were homozygous (A₁A₁) were similar with respect to the prevalence of hypertension; plasma glucose, insulin, high-density lipoprotein cholesterol, and triglyceride concentrations; and body-mass index.

In contrast to the results in Finland, the XbaI polymorphism of the glycogen synthase gene was not associated with NIDDM in the French population, and French patients with the A₂ allele did not have a clinical profile suggesting marked insulin resistance.

Habib Zouali
Gilberto Velho, M.D., Ph.D.
Philippe Froguel, M.D., Ph.D.
Centre d'Etude du Polymorphisme Humain, 75010 Paris, France

1 References

1. 1

   Groop LC, Kankuri M, Schalin-Jantti C, et al. Association between polymorphism of the glycogen synthase gene and non-insulin-dependent diabetes mellitus. N Engl J Med 1993;328:10-14
   Full Text | Web of Science | Medline

To the Editor:

Genetic factors are important in the pathogenesis of NIDDM, and mutations of the insulin, insulin-receptor, and glucokinase genes have been identified in patients with NIDDM1,2. However, these mutations are present in only a few patients with the disease. In subjects from Finland, Groop and coworkers identified two polymorphic alleles by XbaI digestion, A₁ and A₂ 3. The A₂ allele was present in 30 percent of patients with NIDDM, as compared with 8 percent of normal subjects. In addition, the A₂ allele was associated with a strong family history of NIDDM.

We assessed the frequency of the A₁ and A₂ alleles in 45 normal subjects and 95 patients with NIDDM in Japan. The normal subjects ranged in age from 18 to 60 years and had normal glucose tolerance and a negative family history of diabetes. The diabetic patients were 25 to 40 years old at the time of diagnosis and had at least two family members with NIDDM. Using PCR on genomic DNA from leukocytes from these subjects, we amplified a region of the genomic DNA encompassing the site of the XbaI polymorphism (302 base pairs upstream in the intron from position 1970 of the complementary DNA4) with two exon primers 5'CTGGACTGGAAATACCTAGG3' (1946 to 1965) and 5'TGTGGCGCGCAGACATATAG3' (1991 to 1972) flanking the intron. The A₁ and A₂ alleles were defined by XbaI digestion of the PCR product so that the A₁ allele lacked the XbaI site and the A₂ allele possessed the XbaI site.

The A₂ allele was found in 4 (9 percent) of the 45 normal subjects and 9 (9 percent) of the 95 patients with NIDDM. Thus, although the frequency of the A₂ allele is similar in normal subjects in Japan and Finland, we found no increase in the frequency of the A₂ allele among the Japanese patients with NIDDM. This may be due to an ethnic difference in the genetic background for NIDDM. In fact, Japanese patients with NIDDM generally have a decreased rather than an increased plasma insulin response to the administration of glucose5. Alternatively, the degree of linkage disequilibrium between the XbaI polymorphism and the presumptive disease-causing mutation in the glycogen synthase gene or another gene may be different in the Japanese population.

Takashi Kadowaki, M.D.
University of Tokyo, Tokyo 113, Japan

Hiroko Kadowaki, M.D.
Institute for Diabetes Care and Research, Asahi Life Foundation, Tokyo 100, Japan

Yoshio Yazaki, M.D.
University of Tokyo, Tokyo 113, Japan

5 References

1. 1

   Taylor SI, Kadowaki T, Kadowaki H, Accili D, Cama A, McKeon C. Mutations in insulin-receptor gene in insulin-resistant patients. Diabetes Care 1990;13:257-279
   CrossRef | Web of Science | Medline

2. 2

   Permutt MA, Chiu KC, Tanizawa Y. Glucokinase and NIDDM: a candidate gene that paid off. Diabetes 1992;41:1367-1372
   CrossRef | Web of Science | Medline

3. 3

   Groop LC, Kankuri M, Schalin-Jantti C, et al. Association between polymorphism of the glycogen synthase gene and non-insulin-dependent diabetes mellitus. N Engl J Med 1993;328:10-14
   Full Text | Web of Science | Medline

4. 4

   Browner MF, Nakano K, Bang AG, Fletterick RJ. Human muscle glycogen synthase cDNA sequence: a negatively charged protein with an asymmetric charge distribution. Proc Natl Acad Sci U S A 1989;86:1443-1447
   CrossRef | Web of Science | Medline

5. 5

   Kadowaki T, Miyake Y, Hagura R, et al. Risk factors for worsening to diabetes in subjects with impaired glucose tolerance. Diabetologia 1984;26:44-49
   CrossRef | Web of Science | Medline

Author/Editor Response

The authors reply:

To the Editor: The information presented on the prevalence of the XbaI polymorphism of the glycogen synthase gene in patients with NIDDM in France and Japan underscores the need to obtain data from other ethnic groups. There even seem to be differences within Finland. We have not found an increased frequency of the A₂ allele among patients with NIDDM from the Swedish minority living in western Finland. We do not know why the frequency of the A₂ allele is increased in the Finnish population.

One or more specific diabetes-susceptibility genes may be present in Finnish patients with NIDDM, who have a high risk of coronary artery disease1. Apolipoprotein E is a candidate for such a unique Finnish gene, and the apolipoprotein E phenotypes E_4/4 and E_4/3 are associated with increased risk of coronary artery disease in men with NIDDM1. Interestingly, the glycogen synthase gene has been assigned to chromosome 19, band q13.3 adjacent to the apolipoprotein E and apolipoprotein C-II gene cluster2. Assuming that we defined the A₁ and A₂ alleles in the same way, the finding of increased frequency of the A₁ allele among patients with NIDDM in France is surprising but interesting. About 60 percent of Finnish patients with NIDDM have hypertension, and insulin resistance seems to occur only in the presence of hypertension3. The association between the A₂ allele and hypertension was also present among 94 unrelated, nondiabetic first-degree relatives of patients with NIDDM (22 percent vs. 6 percent, P<0.05).

As we pointed out in our article,4 the A₂ allele is unlikely to have functional implications for glycogen synthase. Screening of the region coding for the vast majority of the phosphorylation sites in 50 patients with NIDDM, a large number of whom had the A₂ allele, with single-stranded conformational polymorphism revealed no consistent polymorphism. Expression of the gene in skeletal-muscle-biopsy specimens from patients with the A₂ allele was normal. Therefore, the XbaI polymorphism of the glycogen synthase gene can only be considered as a marker for NIDDM in some populations.

Leif Groop, M.D.
Camilla Schalin-Jantti, M.D.
Markku Lehto, Ph.D.
Helsinki University, SF-00170 Helsinki, Finland

4 References

1. 1

   Laakso M, Kesaniemi A, Kervinen K, Jauhiainen M, Pyorala K. Relation of coronary heart disease and apolipoprotein E phenotype in patients with non-insulin dependent diabetes. BMJ 1991;303:1159-1162
   CrossRef | Web of Science | Medline

2. 2

   Lehto M, Stoffel M, Groop L, et al. Assignment of the gene encoding glycogen synthase (GYS) to human chromosome 19, band q13.3. Genomics (in press).
   

3. 3

   Groop L, Ekstrand A, Forsblom C, et al. Insulin resistance, hypertension and microalbuminuria in patients with Type 2 (non-insulin-dependent) diabetes mellitus. Diabetologia (in press).
   

4. 4

   Groop LC, Kankuri M, Schalin-Jantti C, et al. Association between polymorphism of the glycogen synthase gene and non-insulin-dependent diabetes mellitus. N Engl J Med 1993;328:10-14
   Full Text | Web of Science | Medline

Citing Articles (23)

Citing Articles

1. 1

   Kenneth Cusi, Ralph A. Defronzo. 2011. Pathogenesis of Type 2 Diabetes. .
   CrossRef

2. 2

   Martine Vaxillaire, Philippe Froguel. 2010. The Genetics of Type 2 Diabetes: From Candidate Gene Biology to Genome-Wide Studies. , 191-214.
   CrossRef

3. 3

   MARK A. SPERLING, STUART A. WEINZIMER, WILLIAM V. TAMBORLANE. 2008. Diabetes Mellitus. , 374-421.
   CrossRef

4. 4

   S. Schinner, W. A. Scherbaum, S. R. Bornstein, A. Barthel. (2005) Molecular mechanisms of insulin resistance. Diabetic Medicine 22:6, 674-682
   CrossRef

5. 5

   I. Barroso. (2005) Genetics of Type 2 diabetes. Diabetic Medicine 22:5, 517-535
   CrossRef

6. 6

   Lars Hansen, Oluf Pedersen. (2005) Genetics of type 2 diabetes mellitus: status and perspectives. Diabetes, Obesity and Metabolism 7:2, 122-135
   CrossRef

7. 7

   M. Vaxillaire, C. Dina, S. Lobbens, A. Dechaume, V. Vasseur-Delannoy, N. Helbecque, G. Charpentier, P. Froguel. (2005) Effect of common polymorphisms in the HNF4? promoter on susceptibility to type 2 diabetes in the French Caucasian population. Diabetologia 48:3, 440-444
   CrossRef

8. 8

   J. Fredriksson, M. Ridderstrale, L. Groop, M. Orho-Melander. (2004) Characterization of the human skeletal muscle glycogen synthase gene (GYS1) promoter. European Journal of Clinical Investigation 34:2, 113-121
   CrossRef

9. 9

   Ralph A. DeFronzo, Lawrence Mandarino, Eleuterio Ferrannini. 2003. Metabolic and Molecular Pathogenesis of Type 2 Diabetes Mellitus. .
   CrossRef

10. 10

    Koka Motoyama, Masanori Emoto, Hideki Tahara, Miyoko Komatsu, Tetsuo Shoji, Masaaki Inaba, Yoshiki Nishizawa. (2003) Association of muscle glycogen synthase polymorphism with insulin resistance in type 2 diabetic patients. Metabolism 52:7, 895-899
    CrossRef

11. 11

    A. Perez-Martin, E. Raynaud, J. Mercier. (2001) Insulin resistance and associated metabolic abnormalities in muscle: effects of exercise. Obesity Reviews 2:1, 47-59
    CrossRef

12. 12

    M. Fenger, P. Poulsen, H. Beck-Nielsen, A. Vaag. (2000) Impact of the Xba1-polymorphism of the human muscle glycogen synthase gene on parameters of the insulin resistance syndrome in a Danish twin population.. Diabetic Medicine 17:10, 735-740
    CrossRef

13. 13

    Hee-Sook Jun, Hak Yeon Bae, Byoung Rai Lee, Kwang Sam Koh, Young Soo Kim, Kwan Woo Lee, Hyun-man Kim, Ji-Won Yoon. (1999) Pathogenesis of non-insulin-dependent (type II) diabetes mellitus (NIDDM) – genetic predisposition and metabolic abnormalities. Advanced Drug Delivery Reviews 35:2-3, 157-177
    CrossRef

14. 14

    J. Rissanen, J. Pihlajamäki, S. Heikkinen, P. Kekäläinen, L. Mykkänen, J. Kuusisto, A. Kolle, M. Laakso. (1997) New variants in the glycogen synthase gene (Gln71His, Met416Val) in patients with NIDDM from eastern Finland. Diabetologia 40:11, 1313-1319
    CrossRef

15. 15

    Sandra J. Hasstedt, Michael Hoffman, Mark F. Leppert, Steven C. Elbein. (1997) Recessive Inheritance of Obesity in Familial Non—Insulin-Dependent Diabetes Mellitus, and Lack of Linkage to Nine Candidate Genes. The American Journal of Human Genetics 61:3, 668-677
    CrossRef

16. 16

    Gulja Babadjanova, Bruno Allolio, Felix Beuschlein, Alexander Chuchalin, Martin Reincke. (1997) Polymorphism of the glycogen synthase gene and non—insulin-dependent diabetes mellitus in the Russian population. Metabolism 46:2, 121-122
    CrossRef

17. 17

    Leif C. Groop, Tiinamaija Tuomi. (1997) Non-insulin-dependent Diabetes Mellitus - A Collision between Thrifty Genes and an Affluent Society. Annals of Medicine 29:1, 37-53
    CrossRef

18. 18

    Michael Ristow, Kay Busch, Helmut Schatz, Andreas Pfeiffer. (1996) Restricted geographical extension of the association of a glucagon receptor gene mutation (Gly40Ser) with non-insulin-dependent diabetes mellitus. Diabetes Research and Clinical Practice 32:3, 183-185
    CrossRef

19. 19

    T. Fujisawa, H. Ikegami, E. Yamato, K. Takekawa, Y. Nakagawa, Y. Hamada, T. Oga, H. Ueda, M. Shintani, M. Fukuda, T. Ogihara. (1996) Association of Trp64Arg mutation of the ?3-adrenergic-receptor with NIDDM and body weight gain. Diabetologia 39:3, 349-352
    CrossRef

20. 20

    C. Ronald Kahn, M.D, David Vicent, M.D, Alessandro Doria, M.D., Ph.D. (1996) GENETICS OF NON-INSULIN-DEPENDENT (TYPE-II) DIABETES MELLITUS. Annual Review of Medicine 47:1, 509-531
    CrossRef

21. 21

    T. Fujisawa, H. Ikegami, E. Yamato, K. Takekawa, Y. Nakagawa, Y. Hamada, H. Ueda, M. Fukuda, T. Ogihara. (1995) A mutation in the glucagon receptor gene (Gly40Ser): heterogeneity in the association with diabetes mellitus. Diabetologia 38:8, 983-985
    CrossRef

22. 22

    C. Laurino, S. Bertolinib, R. Cordera. (1994) Linkage analysis does not support a role for glucokinase gene in the aetiology of type 2 diabetes mellitus among North Western Italians. Molecular and Cellular Endocrinology 104:2, 147-151
    CrossRef

23. 23

    H. Kuroyama, T. Sanke, S. Ohagi, M. Furuta, H. Furuta, K. Nanjo. (1994) Simple tandem repeat DNA polymorphism in the human glycogen synthase gene is associated with NIDDM in Japanese subjects. Diabetologia 37:5, 536-539
    CrossRef