Original Article
Brief Report
Primary Infection with Zidovudine-Resistant Human Immunodeficiency Virus Type 1
N Engl J Med 1993; 328:1163-1165April 22, 1993
- Article
Strains of human immunodeficiency virus type 1 (HIV-1) with reduced sensitivity to zidovudine have been isolated from patients treated with this drug for six months or more1. Resistance to zidovudine is associated with late-stage disease, low CD4 lymphocyte counts, longer antiretroviral therapy, and specific mutations in the reverse transcriptase gene of HIV-12,3. The clinical importance of infections with resistant HIV-1 isolates is not well understood. We describe a patient with symptomatic HIV-1 infection who had primary infection with a virus resistant to zidovudine, according to both phenotypic and genotypic analyses.
Case Report
The patient was a 20-year-old homosexual man who had been in good health until 10 days before hospitalization, when fatigue, fever (temperature reaching 38.5 °C), generalized lymphadenopathy, and mild sore throat developed. He indicated that he had tested negative for HIV-1 antibodies one year before while in the military and one month earlier at a local facility. He reported no previous exposure to zidovudine or other antiretroviral agents. The patient reported recent sexual contact with three male partners. It was subsequently determined that one partner was HIV-1-positive and was receiving zidovudine.
On physical examination, the patient had cervical lymphadenopathy, a marked splenomegaly, diffuse erythema of his face and back, swelling of his lips, and giant urticaria on his arms and chest. Initial laboratory studies included a white-cell count of 23,600 per cubic millimeter (23.6 × 109 per liter) with 14 percent total neutrophils, 10 percent band forms, 60 percent lymphocytes, 20 percent monocytes, and 5 percent basophils. Eighty percent of the white cells were mononuclear, with marked atypical morphologic features. The hematocrit was 0.41, the mean corpuscular volume 84 micrometers3, and the platelet count 125 × 103 per cubic millimeter (125 × 109 per liter). The serum was positive for HIV-1 antibodies on enzyme-linked immunoassay, and the Western blot assay showed weakly reactive p24, p66, gp120, and gp160 bands. An assay for serum HIV-1 antigen was also positive. Serum zidovudine levels were measured retrospectively in a base-line serum sample and were found to be negative by radioimmunoassay.
Seven days later, the patient's white-cell count had risen to 31,000 per cubic millimeter (31 × 109 per liter), with 76 percent lymphocytes (68 percent of them atypical). The absolute CD4 lymphocyte count was 944 per cubic millimeter (0.944 × 109 per liter), with a helper-suppressor lymphocyte ratio of 0.09. A diagnosis of probable acute retroviral infection was made. Treatment with zidovudine was started at a dose of 500 mg daily. The patient returned to the clinic three months later with persistent low-grade fevers (to 38 °C). He had continued to take zidovudine but had used only a two-month supply of medication over a three-month period. His absolute CD4 cell count had fallen to 314 per cubic millimeter (0.314 × 109 per liter), and additional bands (p17, p31, p51, and gp 41) were observed in the Western blot assay. He was started on a course of long-term zidovudine therapy (500 mg daily). Eleven months after his first visit, the absolute CD4 count was 300 per cubic millimeter (0.300 × 109 per liter), with a helper-suppressor lymphocyte ratio of 0.18. Didanosine therapy was substituted for zidovudine. Fifteen months after his first visit, the patient's CD4 lymphocyte count was 457 per cubic millimeter (0.457 × 109 per liter).
Methods
Sequential samples of serum and blood collected in tubes containing heparin were obtained from the patient for determination of HIV-1 antigen and HIV-1 cultures of peripheral-blood mononuclear cells and plasma fractions. HIV-1 antigen determinations were performed with a commercially available enzyme immunoassay (Abbott Laboratories, North Chicago, Ill.). Peripheral-blood mononuclear cells and plasma were cultured for HIV-1 as described elsewhere,4 with quantitation performed according to the consensus protocols developed by the Virology Committee of the AIDS Clinical Trials Group. Titers of infectious HIV-1 were expressed as tissue-culture-infective doses per million peripheral-blood mononuclear cells or per milliliter of plasma. Tests of susceptibility to zidovudine were performed by a method of reverse transcriptase inhibition described elsewhere5,6. The results were expressed as 50 percent inhibitory concentrations (IC50) of zidovudine. In this assay, IC50 values of HIV-1 strains from patients not treated with zidovudine are less than 0.34 μmol per liter6. Isolates with IC50 values greater than 1 μmol per liter are considered highly resistant to zidovudine. Molecular analyses of HIV-1 strains obtained from the patient before and after the completion of four months of zidovudine therapy were performed according to methods published elsewhere7. Proviral DNA was amplified with sense (5'GCCATGGTCGACGGAAGAAATCTGTTGACTCAG3') and antisense (5'TGACGTCGACTCATTGACAGTCCAGCT3') primers flanking an 850-bp segment of codons 1 through 250 of the reverse transcriptase gene of HIV-1. Amplified DNA was cloned in Escherichia coli and sequenced with an automated DNA sequencer (Applied Biosystems, Foster City, Calif.).
Results
As shown in Table 1Table 1
Viral Studies in a Patient with Symptomatic HIV-1 Infection., blood specimens were collected before the start of zidovudine therapy and sequentially during treatment. HIV-1 antigen was detected in the serum obtained before therapy. Subsequent serum samples showed increasing concentrations of HIV-1 antigen over time. The HIV-1 titers in peripheral-blood mononuclear cells were 167 tissue-culture-infective doses per million cells before zidovudine therapy and did not change substantially during follow-up. Plasma HIV-1 titers were 3172 tissue-culture-infective doses per milliliter at base line, and declined to 1 tissue-culture-infective dose per milliliter after 17 weeks of zidovudine therapy. HIV-1 isolates obtained before and after four months of zidovudine therapy were analyzed for their susceptibility to zidovudine (Table 2Table 2
Phenotypic and Genotypic Characteristics of HIV-1 Isolates Obtained from the Patient before and after Zidovudine Therapy.). The IC50 of the isolate obtained before therapy was 0.86 μmol per liter. The isolate obtained 17 weeks later was highly resistant to zidovudine, with an IC50 of 2.90 μmol per liter. Molecular studies demonstrated that the initial and 17-week isolates contained a Thr-to-Tyr mutation at position 215 but no other mutations known to contribute to zidovudine resistance (Table 2). Both HIV-1 isolates had a majority of clones in which Tyr215 was present, but one clone containing Phe215 was detected for each isolate.Discussion
We describe a patient with primary HIV-1 infection caused by a virus already resistant to zidovudine. In addition to decreased susceptibility to zidovudine in vitro, the HIV-1 strain isolated before the start of zidovudine therapy contained a mutation in position 215 of the reverse transcriptase gene. The presence of the mutation at position 215 has been associated with resistance to zidovudine,7-11 and the mutation has not been found by direct probing or sequencing with the polymerase chain reaction in 98 isolates obtained from HIV-1-infected persons before zidovudine therapy3,8-10,12. Our patient reported no previous use of zidovudine, his serum was negative for the drug, and his mean corpuscular volume was normal at base line13. Because one of his sexual partners was receiving zidovudine (and therefore could have been harboring a high percentage of resistant HIV-1 variants), we suggest that he acquired a zidovudine-resistant virus. Absolute evidence of primary HIV-1 infection (i.e., completely documented seroconversion in sequential serum samples) was lacking in the case of our patient; however, his clinical presentation, the appearance of new bands in Western blot assays of sequential serum samples, and a normal CD4 lymphocyte count at base line in conjunction with the presence of serum antigenemia and plasma viremia all strongly suggest that this was a primary HIV-1 infection.
Our patient harbored a large viral load, as indicated by the high titers of HIV-1 in his plasma before he received zidovudine and the persistence during therapy of plasma viremia, with unchanged titers of infectious HIV-1 in peripheral-blood mononuclear cells and increasing concentrations of serum HIV-1 antigen. These findings contrast with earlier studies in patients with primary HIV-1 infection that describe rapid spontaneous decreases in the HIV-1 antigen concentration in serum and decreases in titers of infectious HIV-114,15. We postulate that the high viral load and the prolonged acute retroviral syndrome in our patient were direct consequences of infection with a zidovudine-resistant virus.
This report shows that horizontal transmission of a zidovudine-resistant strain of HIV-1 is possible. This may have a bearing on the clinical approach to newly infected persons, who could have acquired a resistant strain of the virus. Large numbers of HIV-1-infected patients are now receiving long-term antiretroviral treatment with zidovudine, with an estimated 89 percent of those with late-stage HIV-1 infection and 31 percent of those with early-stage infection harboring some resistant clones 12 months after the start of therapy2. Because the incidence of new HIV-1 infections in the United States has been estimated to be 40,000 annually,16 it is likely that some will be caused by zidovudine-resistant viruses. HIV-1 isolates resistant to didanosine and zalcitabine have also been identified,5,17 and therefore the possibility of primary acquisition of viruses resistant to these compounds should also be considered in newly infected persons.
There are no guidelines for the treatment of primary HIV-1 infection with antiretroviral drugs. Tindall et al.18 recently described 11 patients with primary HIV-1 infections who were treated with 1000 mg of zidovudine daily for an average of 56 days (range, 28 to 111).The study showed no apparent early clinical benefit associated with the use of zidovudine in these patients as compared with a group of historical controls. Although HIV-1 antigen determinations and cultures of peripheral-blood mononuclear cells and plasma fractions were included in the study, tests of the susceptibility of viral isolates to zidovudine were not performed, and long-term follow-up was not included.
During the acute phase of HIV-1 infection there is a large viral burden, with elevated titers of highly cytopathic HIV-1 in the plasma and peripheral-blood mononuclear-cell fractions of infected persons14,15. It is possible that zidovudine therapy during the early phases of HIV-1 infection could lower the initial viral load and conceivably alter the natural history of progression. Alternatively, one could speculate that the administration of zidovudine during this highly replicative phase of HIV-1 infection might select drug-resistant viruses, interfere with normal immune responses,19 and favor faster progression of the disease. Moreover, if the acute infection were caused by an isolate with decreased sensitivity to zidovudine, treatment could result in the rapid emergence of a highly resistant virus, as suggested in the patient we have described. Thus, the decision to treat primary HIV-1 infection must await the results of carefully designed prospective trials that incorporate susceptibility studies of HIV-1 isolates.
Presented at the 32nd Interscience Conference on Antimicrobial Agents and Chemotherapy, Anaheim, Calif., October 13, 1992.
Supported by grants (AM13083 and AI27761) from the National Institutes of Health and by grants from the Minnesota Medical Foundation. The opinions expressed herein are those of the authors and do not necessarily reflect those of the Department of the Army, the Department of the Navy, or the Department of Defense.
We are indebted to Eric Sanders-Buell for assistance in sequencing the reverse transcriptase clones, to Carolyn Beatty for measuring zidovudine levels, to Teri Pattison for assistance in the preparation of the manuscript, and to Ralph Heussner for editorial advice.
Source Information
From the Departments of Laboratory Medicine and Pathology, Medicine, and Pediatrics, University of Minnesota Medical School, and the AIDS Clinical Trials Unit, Minneapolis (A.E., K.J.S., H.H.B.); the Naval Medical Research Institute and Division of Retrovirology, Walter Reed Army Institute of Research, Washington, D.β(D.L.M.); the Henry M. Jackson Foundation Research Laboratory, Rockville, Md. (F.E.M.); Group Health Inc., Riverside Medical Center, Minneapolis (D.G.S.); and St. Paul Ramsey Medical Center, St. Paul, Minn. (K.H.).
Address reprint requests to Dr. Balfour at Box 437 UMHC, Harvard St. at E. River Rd., Minneapolis, MN 55455.
- References
References
1
Larder BA ,Darby G ,Richman DD . HIV with reduced sensitivity to zidovudine (AZT) isolated during prolonged therapy. Science 1989;243:1731-1734
CrossRef | Web of Science | Medline2
Richman DD ,Grimes JM ,Lagakos SW . Effect of stage of disease and drug dose on zidovudine susceptibilities of isolates of human immunodeficiency virus. J Acquir Immune Defic Syndr 1990;3:743-746
Web of Science | Medline3
Larder BA ,Kemp SD . Multiple mutations in HIV-1 reverse transcriptase confer high-level resistance to zidovudine (AZT). Science 1989;246:1155-1158
CrossRef | Web of Science | Medline4
Erice A ,Sannerud KJ ,Leske VL ,Aeppli D ,Balfour HH Jr . Sensitive microculture method for isolation of human immunodeficiency virus type 1 from blood leukocytes. J Clin Microbiol 1992;30:444-448
Web of Science | Medline5
St Clair MH ,Martin JL ,Tudor-Williams G , et al. Resistance to ddI and sensitivity to AZT induced by a mutation in HIV-1 reverse transcriptase. Science 1991;253:1557-1559
CrossRef | Web of Science | Medline6
Tudor-Williams G ,St Clair MH ,McKinney RE , et al. HIV-1 sensitivity to zidovudine and clinical outcome in children. Lancet 1992;339:15-19
CrossRef | Web of Science | Medline7
Mayers DL ,McCutchan FE ,Sanders-Buell EE , et al. Characterization of HIV isolates arising after prolonged zidovudine therapy. J Acquir Immune Defic Syndr 1992;5:749-759
Web of Science | Medline8
Richman DD ,Guatelli JC ,Grimes J ,Tsiatis A ,Gingeras T . Detection of mutations associated with zidovudine resistance in human immunodeficiency virus by use of the polymerase chain reaction. J Infect Dis 1991;164:1075-1081
CrossRef | Web of Science | Medline9
Boucher CA ,O'Sullivan E ,Mulder JW , et al. Ordered appearance of zidovudine resistance mutations during treatment of 18 human immunodeficiency virus-positive subjects. J Infect Dis 1992;165:105-110
CrossRef | Web of Science | Medline10
Jung M ,Agut H ,Candotti D ,Ingrand D ,Katlama C ,Huraux JM . Susceptibility of HIV-1 isolates to zidovudine: correlation between widely applicable culture test and PCR analysis. J Acquir Immune Defic Syndr 1992;5:359-364
Web of Science | Medline11
Japour AJ ,Chatis PA ,Eigenrauch HA ,Crumpacker CS . Detection of human immunodeficiency virus type 1 clinical isolates with reduced sensitivity to zidovudine and dideoxyinosine by RNA . RNA hybridization. Proc Natl Acad Sci U S A 1991;88:3092-3096
CrossRef | Web of Science | Medline12
Fitzgibbon JE ,Howell RM ,Schwartzer TA ,Gocke DJ ,Dubin DT . In vivo prevalence of azidothymidine (AZT) resistance mutations in an AIDS patient before and after AZT therapy. AIDS Res Hum Retroviruses 1991;7:265-269
CrossRef | Web of Science | Medline13
Lim L, Grimes J, Volberding P, Lagakos S, Krogstad D, Sadler B. Compliance with study medication in a randomized trial of zidovudine (ACTG 019). In: Abstracts of the Sixth International Conference on AIDS, San Francisco, June 20-24, 1990. Vol. 3. San Francisco: University of California, 1990:285. abstract.
14
Clark SJ ,Saag MS ,Decker WD , et al. High titers of cytopathic virus in plasma of patients with symptomatic primary HIV-1 infection. N Engl J Med 1991;324:954-960
Full Text | Web of Science | Medline15
Daar ES ,Moudgil T ,Meyer RD ,Ho DD . Transient high levels of viremia in patients with primary human immunodeficiency virus type 1 infection. N Engl J Med 1991;324:961-964
Full Text | Web of Science | Medline16
Estimates of HIV prevalence and projected AIDS cases: summary of a workshop, October 31-November 1, 1989MMWR Morb Mortal Wkly Rep 1990;39:110-2, 117
Medline17
Fitzgibbon JE ,Howell RM ,Haberzettl CA ,Sperber SJ ,Gocke DJ ,Dubin DT . Human immunodeficiency virus type 1 pol gene mutations which cause decreased susceptibility to 2',3'-dideoxycytidine. Antimicrob Agents Chemother 1992;36:153-157
Web of Science | Medline18
Tindall B ,Gaines H ,Imrie A , et al. Zidovudine in the management of primary HIV-1 infection. AIDS 1991;5:477-484
CrossRef | Web of Science | Medline19
Heagy W ,Crumpacker C ,Lopez PA ,Finberg RW . Inhibition of immune functions by antiviral drugs. J Clin Invest 1991;87:1916-1924
CrossRef | Web of Science | Medline
- Citing Articles (90)
Citing Articles
1
S. Sungkanuparph, R. Oyomopito, S. Sirivichayakul, T. Sirisanthana, P. C. K. Li, P. Kantipong, C. K. C. Lee, A. Kamarulzaman, L. Messerschmidt, M. G. Law, P. Phanuphak, . (2011) HIV-1 Drug Resistance Mutations Among Antiretroviral-Naive HIV-1-Infected Patients in Asia: Results From the TREAT Asia Studies to Evaluate Resistance-Monitoring Study. Clinical Infectious Diseases 52:8, 1053-1057
CrossRef2
Wendy Murillo, Gabriela Paz-Bailey, Sonia Morales, Edgar Monterroso, Mayte Paredes, Trudy Dobbs, Bharat S. Parekh, Jan Albert, Ivette Lorenzana de Rivera. (2010) Transmitted drug resistance and type of infection in newly diagnosed HIV-1 individuals in Honduras. Journal of Clinical Virology 49:4, 239-244
CrossRef3
Eduardo Sprinz, Eduardo M. Netto, Maria Patelli J.S. Lima, Juvênao J.D. Furtado, Margareth da Eira, Roberto Zajdenverg, José V. Madruga, David S. Lewi, Alcyone A. Machado, Rogério J. Pedro, Marcelo A. Soares. (2009) Primary Antiretroviral Drug Resistance among HIV Type 1-Infected Individuals in Brazil. AIDS Research and Human Retroviruses 25:9, 861-867
CrossRef4
Babafemi Taiwo. (2009) Understanding transmitted HIV resistance through the experience in the USA. International Journal of Infectious Diseases 13:5, 552-559
CrossRef5
Emmanouil Magiorkinis, Maria Detsika, Angelos Hatzakis, Dimitrios Paraskevis. (2009) Monitoring HIV drug resistance in treatment-naive individuals: molecular indicators, epidemiology and clinical implications. HIV Therapy 3:4, 369-390
CrossRef6
Melanie Balduin, Mark Oette, Martin P. Däumer, Daniel Hoffmann, Herbert J. Pfister, Rolf Kaiser. (2009) Prevalence of minor variants of HIV strains at reverse transcriptase position 103 in therapy-naïve patients and their impact on the virological failure. Journal of Clinical Virology 45:1, 34-38
CrossRef7
Lydia N Drumright, Simon DW Frost. (2008) Sexual networks and the transmission of drug-resistant HIV. Current Opinion in Infectious Diseases 21:6, 644-652
CrossRef8
Laila Darwich, Anna Esteve, Lidia Ruiz, Roger Paredes, Rocio Bellido, Cecilia Cabrera, Joan Romeu, Margarita Bofill, Bonaventura Clotet, Javier Martinez-Picado. (2008) Drug-Resistance Mutations Number and K70R or T215Y/F Substitutions Predict Treatment Resumption during Guided Treatment Interruptions. AIDS Research and Human Retroviruses 24:5, 725-732
CrossRef9
Dominique J. Pepper, Graeme A. Meintjes, Helen McIlleron, Robert J. Wilkinson. (2007) Combined therapy for tuberculosis and HIV-1: the challenge for drug discovery. Drug Discovery Today 12:21-22, 980-989
CrossRef10
Raphael Lwembe, Washingtone Ochieng, Annie Panikulam, Charles O. Mongoina, Tresa Palakudy, Yusuke Koizumi, Seiji Kageyama, Naohiko Yamamoto, Tatsuo Shioda, Rachel Musoke, Mary Owens, Elijah M. Songok, Frederick A. Okoth, Hiroshi Ichimura. (2007) Anti-retroviral drug resistance-associated mutations among non-subtype B HIV-1-infected Kenyan children with treatment failure. Journal of Medical Virology 79:7, 865-872
CrossRef11
Susan H Eshleman, Marla Husnik, Sarah Hudelson, Deborah Donnell, Yijian Huang, Wei Huang, Stephen Hart, Brooks Jackson, Thomas Coates, Margaret Chesney, Beryl Koblin. (2007) Antiretroviral drug resistance, HIV-1 tropism, and HIV-1 subtype among men who have sex with men with recent HIV-1 infection. AIDS 21:9, 1165-1174
CrossRef12
Mark Oette, Rolf Kaiser, Martin D??umer, Ruth Petch, Gerd F??tkenheuer, Horst Carls, J??rgen Kurt Rockstroh, Dirk Schmal??er, J??rgen Stechel, Torsten Feldt, Herbert Pfister, Dieter H??ussinger. (2006) Primary HIV Drug Resistance and Efficacy of First-Line Antiretroviral Therapy Guided by Resistance Testing. JAIDS Journal of Acquired Immune Deficiency Syndromes 41:5, 573-581
CrossRef13
Nitin K SAKSENA, Bin WANG, Megan STEAIN, Rong Ge YANG, Lin Qi ZHANG. (2005) Snapshot of HIV pathogenesis in China. Cell Research 15:11-12, 953-961
CrossRef14
Bernard Masquelier, Krishnan Bhaskaran, Deenan Pillay, Robert Gifford, Eric Balestre, Louise Bruun J??rgensen, Court Pedersen, Lia van der Hoek, Maria Prins, Claudia Balotta, Benedetta Longo, Claudia K??cherer, Gabriele Poggensee, Marta Ortiz, Carmen de Mendoza, John Gill, Herv?? Fleury, Kholoud Porter. (2005) Prevalence of Transmitted HIV-1 Drug Resistance and the Role of Resistance Algorithms. JAIDS Journal of Acquired Immune Deficiency Syndromes 40:5, 505-511
CrossRef15
Karin J Metzner, Pia Rauch, Hauke Walter, Christoph Boesecke, Bernhard Zöllner, Heiko Jessen, Knud Schewe, Stefan Fenske, Holger Gellermann, Hans-Jürgen Stellbrink. (2005) Detection of minor populations of drug-resistant HIV-1 in acute seroconverters. AIDS 19:16, 1819-1825
CrossRef16
E Girardi, F N Lauria, G Ippolito. (2005) HIV/AIDS in 2004: the epidemiologist's point of view. Cell Death and Differentiation 12, 837-844
CrossRef17
Carmen de Mendoza, Carmen Rodriguez, Jose Maria Eiros, Javier Colomina, Federico Garcia, Pilar Leiva, Julian Torre‐Cisneros, Jesus Aguero, Jose Pedreira, Isabel Viciana, Angelica Corral, Jorge del Romero, Raul Ortiz de Lejarazu, Vincent Soriano. (2005) Antiretroviral Recommendations May Influence the Rate of Transmission of Drug‐Resistant HIV Type 1. Clinical Infectious Diseases 41:2, 227-232
CrossRef18
Susan J. Little, Davey M. Smith. (2005) Editorial Commentary: HIV Treatment Decisions and Transmitted Drug Resistance. Clinical Infectious Diseases 41:2, 233-235
CrossRef19
Eric S. Daar, Douglas D. Richman. (2005) Confronting the Emergence of Drug-Resistant HIV Type 1: Impact of Antiretroviral Therapy on Individual and Population Resistance. AIDS Research and Human Retroviruses 21:5, 343-357
CrossRef20
Tyler French, Linda Weiss, Mark Waters, James Tesoriero, Ruth Finkelstein, Bruce Agins. (2005) Correlation of a Brief Perceived Stress Measure With Nonadherence to Antiretroviral Therapy Over Time. JAIDS Journal of Acquired Immune Deficiency Syndromes 38:5, 590-597
CrossRef21
Inge Derdelinckx, Kristel Van Laethem, Bart Maes, Yoeri Schrooten, St??phane De Wit, Eric Florence, Katrien Fransen, Sergio Garc??a Ribas, Denise Marissens, Michel Moutschen, Dolores Vaira, Georges Zissis, Marc Van Ranst, Eric Van Wijngaerden, Anne-Mieke Vandamme. (2004) Current Levels of Drug Resistance Among Therapy-Naive HIV-Infected Patients Have Significant Impact on Treatment Response. JAIDS Journal of Acquired Immune Deficiency Syndromes 37:5, 1664-1666
CrossRef22
Suk-Yin Chan, Todd Hulgan, Richard T. D’Aquila. (2004) The role of baseline HIV-1 resistance testing in patients with established infection. Current Infectious Disease Reports 6:3, 243-249
CrossRef23
Clavel, François, Hance, Allan J., . (2004) HIV Drug Resistance. New England Journal of Medicine 350:10, 1023-1035
Full Text24
Rami Kantor, David Katzenstein. (2004) Drug resistance in non-subtype B HIV-1. Journal of Clinical Virology 29:3, 152-159
CrossRef25
C. Bradley Hare, James O. Kahn. (2004) Primary HIV infection. Current Infectious Disease Reports 6:1, 65-71
CrossRef26
Sang Won Park, Hong Bin Kim, Young Ju Choi, Nam Jung Kim, Myoung Don Oh, Kang Won Choe. (2003) Genotypic Resistance of Antiretroviral Drugs among Drug-Naive HIV Type 1 Patients with the Background of Long-Term Access-Easy Zidovudine Therapy. AIDS Research and Human Retroviruses 19:11, 1039-1043
CrossRef27
James Tesoriero, Tyler French, Linda Weiss, Mark Waters, Ruth Finkelstein, Bruce Agins. (2003) Stability of Adherence to Highly Active Antiretroviral Therapy Over Time Among Clients Enrolled in the Treatment Adherence Demonstration Project. JAIDS Journal of Acquired Immune Deficiency Syndromes 33:4, 484-493
CrossRef28
Little, Susan J., Holte, Sarah, Routy, Jean-Pierre, Daar, Eric S., Markowitz, Marty, Collier, Ann C., Koup, Richard A., Mellors, John W., Connick, Elizabeth, Conway, Brian, Kilby, Michael, Wang, Lei, Whitcomb, Jeannette M., Hellmann, Nicholas S., Richman, Douglas D., . (2002) Antiretroviral-Drug Resistance among Patients Recently Infected with HIV. New England Journal of Medicine 347:6, 385-394
Full Text29
Usha Sambamoorthi, Ayse Akincigil, Elizabeth McSpiritt, Stephen Crystal. (2002) Zidovudine Use During Pregnancy Among HIV-Infected Women on Medicaid. JAIDS Journal of Acquired Immune Deficiency Syndromes 30:4, 429-439
CrossRef30
Monica Nolan, Mary Glenn Fowler, Lynne M. Mofenson. (2002) Antiretroviral Prophylaxis of Perinatal HIV-1 Transmission and the Potential Impact of Antiretroviral Resistance. JAIDS Journal of Acquired Immune Deficiency Syndromes 30:2, 216-229
CrossRef31
E. Magiorkinis, D. Paraskevis, G. Magiorkinis, S. Chryssou, M. Chini, M. Lazanas, V. Paparizos, G. Saroglou, A. Antoniadou, E. Giamarellou, A. Karafoulidou, A. Hatzakis. (2002) Mutations associated with genotypic resistance to antiretroviral therapy in treatment naı̈ve HIV-1 infected patients in Greece. Virus Research 85:1, 109-115
CrossRef32
Martine Harzic, Isabelle Pellegrin, Christiane Deveau, Marie-Laure Chaix, Béatrice Dubeaux, Isabelle Garrigue, Nicole Ngo, Christine Rouzioux, Cécile Goujard, Bruno Hoen, Daniel Sereni, Jean-François Delfraissy, Laurence Meyer. (2002) Genotypic drug resistance during HIV-1 primary infection in France (1996–1999): frequency and response to treatment. AIDS 16:5, 793-796
CrossRef33
Daisy M. Machado, Eric L. Delwart, Ricardo S. Diaz, Carlos F. de Oliveira, Katia Alves, Bhupat D. Rawal, Marian Sullivan, Marta Gwinn, Kenneth A. Clark, Michael P. Busch. (2002) Use of the sensitive/less-sensitive (detuned) EIA strategy for targeting genetic analysis of HIV-1 to recently infected blood donors. AIDS 16:1, 113-119
CrossRef34
S. Tariq Sadiq, Stephen Taylor, Steve Kaye, Julie Bennett, Ruth Johnstone, Patrick Byrne, Andrew J. Copas, Susan M. Drake, Deenan Pillay, Ian Weller. (2002) The effects of antiretroviral therapy on HIV-1 RNA loads in seminal plasma in HIV-positive patients with and without urethritis. AIDS 16:2, 219-225
CrossRef35
Stephen Crystal, Usha Sambamoorthi, Patrick J. Moynihan, Elizabeth McSpiritt. (2001) Initiation and Continuation of Newer Antiretroviral Treatments among Medicaid Recipients with AIDS. Journal of General Internal Medicine 16:12, 850-859
CrossRef36
Janis Faye Hutchinson. (2001) T
HE BIOLOGY AND EVOLUTION OF HIV. Annual Review of Anthropology 30:1, 85-108
CrossRef37
Diane Descamps, Vincent Calvez, Jacques Izopet, Claudine Buffet-Janvresse, Anne Schmuck, Philippe Colson, Annick Ruffault, Anne Maillard, Bernard Masquelier, Jacqueline Cottalorda, Martine Harzic, Françoise Brun-Vézinet, Dominique Costagliola. (2001) Prevalence of resistance mutations in antiretroviral-naive chronically HIV-infected patients in 1998: a French nationwide study. AIDS 15:14, 1777-1782
CrossRef38
Kathryn M McGrath, Noah G Hoffman, Wolfgang Resch, Julie A.E Nelson, Ronald Swanstrom. (2001) Using HIV-1 sequence variability to explore virus biology. Virus Research 76:2, 137-160
CrossRef39
Eun-Young Kim, Lotta Vrang, Bo Öberg, Thomas C. Merigan. (2001) Anti-HIV Type 1 Activity of 3′-Fluoro-3′-Deoxythymidine for Several Different Multidrug-Resistant Mutants. AIDS Research and Human Retroviruses 17:5, 401-407
CrossRef40
Steven G. Deeks. (2001) Nonnucleoside Reverse Transcriptase Inhibitor Resistance. JAIDS Journal of Acquired Immune Deficiency Syndromes 26, S25-S33
CrossRef41
Christopher S. Alexander, Winnie Dong, Keith Chan, Nathalie Jahnke, Michael V. O'Shaughnessy, Theresa Mo, Magdalena A. Piaseczny, Julio S. G. Montaner, P. Richard Harrigan. (2001) HIV protease and reverse transcriptase variation and therapy outcome in antiretroviral-naive individuals from a large North American cohort. AIDS 15:5, 601-607
CrossRef42
Steven G. Deeks. (2001) Nonnucleoside Reverse Transcriptase Inhibitor Resistance. Journal of Acquired Immune Deficiency SyndromesS25-S33
CrossRef43
Nicholas A. Kartsonis, Richard T. D'Aquila. (2000) CLINICAL MONITORING OF HIV-1 INFECTION IN THE ERA OF ANTIRETROVIRAL RESISTANCE TESTING. Infectious Disease Clinics of North America 14:4, 879-899
CrossRef44
Bluma Brenner, Mark A Wainberg, Horacio Salomon, Danielle Rouleau, André Dascal, Bonnie Spira, Rafik-Pierre Sekaly, Brian Conway, Jean-Pierre Routy. (2000) Resistance to antiretroviral drugs in patients with primary HIV-1 infection. International Journal of Antimicrobial Agents 16:4, 429-434
CrossRef45
Jacques Izopet, Patrice Massip, Corinne Souyris, Karine Sandres, B??n??dicte Puissant, Martine Obadia, Christophe Pasquier, Eric Bonnet, Bruno Marchou, Jacqueline Puel. (2000) Shift in HIV resistance genotype after treatment interruption and short-term antiviral effect following a new salvage regimen. AIDS 14:15, 2247-2255
CrossRef46
Peter L. Anderson, Saleem E. Noormohamed, Keith Henry, Richard C. Brundage, Henry H. Balfour, Courtney V. Fletcher. (2000) Semen and Serum Pharmacokinetics of Zidovudine and Zidovudine-Glucuronide in Men with HIV-1 Infection. Pharmacotherapy 20:8, 917-922
CrossRef47
Deenan Pillay, Stephen Taylor, Douglas D. Richman. (2000) Incidence and impact of resistance against approved antiretroviral drugs. Reviews in Medical Virology 10:4, 231-253
CrossRef48
Mary-Anne Trabaud, Karine Leriche-Guerin, Corinne Regis, Isabelle Bordes, Laurent Cotte, Jill Detmer, Janice Kolberg, Jacques Ritter, Christian Tr
po. (2000) Prevalence of primary resistance to zidovudine and lamivudine in drug-naive human immunodeficiency virus type-1 infected patients: High proportion of reverse transcriptase codon 215 mutant in circulating lymphocytes and free virus. Journal of Medical Virology 61:3, 352-359
CrossRef49
P. R. Harrigan, H. C. F. Cote. (2000) Clinical Utility of Testing Human Immunodeficiency Virus for Drug Resistance. Clinical Infectious Diseases 30:Supplement 2, S117-S122
CrossRef50
Catherine Tamalet, Christophe Pasquier, Nouara Yahi, Philippe Colson, Isabelle Poizot-Martin, G
CrossRef51
John D. Baxter, Douglas L. Mayers, Deborah N. Wentworth, James D. Neaton, Marie L. Hoover, Mark A. Winters, Sharon B. Mannheimer, Melanie A. Thompson, Donald I. Abrams, Barbara J. Brizz, John P. A. Ioannidis, Thomas C. Merigan. (2000) A randomized study of antiretroviral management based on plasma genotypic antiretroviral resistance testing in patients failing therapy. AIDS 14:9, F83-F93
CrossRef52
Scott A. Wegner, Stephanie K. Brodine, John R. Mascola, Sybil A. Tasker, Richard A. Shaffer, Monica J. Starkey, Anthony Barile, Gregory J. Martin, Naomi Aronson, Wesley W. Emmons, Kevin Stephan, Stuart Bloor, Johan Vingerhoets, Kurt Hertogs, Brendan Larder. (2000) Prevalence of genotypic and phenotypic resistance to anti-retroviral drugs in a cohort of therapy-na??ve HIV-1 infected US military personnel. AIDS 14:8, 1009-1015
CrossRef53
Philippe Vanhems, Rolland Gaudet, Bernard Hirschel, Allison Imrie, Brian Conway, Danielle Rouleau, Jeanette Vizzard, Luc Perrin, David A. Cooper, Sabine Yerly. (2000) Clinical features of acute HIV-1 infection: zidovudine-resistant isolates compared with zidovudine-sensitive isolates. AIDS 14:8, 1065
CrossRef54
Horacio Salomon, Mark A Wainberg, Bluma Brenner, Yudong Quan, Danielle Rouleau, Pierre Coté, Roger LeBlanc, Eric Lefebvre, Bonnie Spira, Chris Tsoukas, Rafik-Pierre Sekaly, Brian Conway, Douglas Mayers, Jean-Pierre Routy. (2000) Prevalence of HIV-1 resistant to antiretroviral drugs in 81 individuals newly infected by sexual contact or injecting drug use. AIDS 14:2, F17-F23
CrossRef55
Raymond Césaire, Georges Dos Santos, Sylvie Abel, Odile Bera, Guy Sobesky, André Cabié. (1999) Drug Resistance Mutations Among HIV-1 Strains From Antiretroviral-Naive Patients in Martinique, French West Indies. Journal of Acquired Immune Deficiency Syndromes 22:4, 401
CrossRef56
Raymond Césaire, Georges Dos Santos, Sylvie Abel, Odile Bera, Guy Sobesky, André Cabié. (1999) Drug Resistance Mutations Among HIV-1 Strains From Antiretroviral-Naive Patients in Martinique, French West Indies. JAIDS Journal of Acquired Immune Deficiency Syndromes 22:4, 401
CrossRef57
Gaetano Romano, Margaret Kasten, Giulia De Falco, Pietro Micheli, Kamel Khalili, Antonio Giordano. (1999) Regulatory functions of Cdk9 and of cyclin T1 in HIV Tat transactivation pathway gene expression. Journal of Cellular Biochemistry 75:3, 357-368
CrossRef58
Shaker Itani, John A. Bartlett. (1999) STRATEGIES OF ANTIRETROVIRAL THERAPY IN ADULTS. Urologic Clinics of North America 26:4, 809-820
CrossRef59
Christopher S. Alexander, Winnie Dong, Martin T. Schechter, Michael V. O‚Shaughnessy, Steffanie A. Strathdee, Theresa Mo, Julio S.G. Montaner, P. Richard Harrigan. (1999) Prevalence of primary HIV drug resistance among seroconverters during an explosive outbreak of HIV infection among injecting drug users. AIDS 13:8, 981-985
CrossRef60
Elisabeth Puchhammer-St
CrossRef61
Susan E. Krown, Dorothee Aeppli, Henry H. Balfour. (1999) Phase II, Randomized, Open-Label, Community-Based Trial to Compare the Safety and Activity of Combination Therapy With Recombinant Interferon-α2b and Zidovudine Versus Zidovudine Alone in Patients With Asymptomatic to Mildly Symptomatic HIV Infection. Journal of Acquired Immune Deficiency Syndromes and Human Retrovirology 20:3, 245-254
CrossRef62
David M. Segal, Mariela Perez, Paul Shapshak. (1999) Oxandrolone, Used for Treatment of Wasting Disease in HIV-1-Infected Patients, Does Not Diminish the Antiviral Activity of Deoxynucleoside Analogues in Lymphocyte and Macrophage Cell Cultures. Journal of Acquired Immune Deficiency Syndromes and Human Retrovirology 20:3, 215-219
CrossRef63
Markus Birk, Anders Sönnerborg. (1998) Variations in HIV-1 pol gene associated with reduced sensitivity to antiretroviral drugs in treatment-naive patients. AIDS 12:18, 2369-2375
CrossRef64
Thomas C Merigan. (1998) Use of PCR to measure HIV viral changes in drug-resistant genes in genital fluids. Journal of Reproductive Immunology 41:1-2, 177-185
CrossRef65
GILBERT R. KAUFMANN, CHRIS DUNCOMBE, JOHN ZAUNDERS, PHILIP CUNNINGHAM, DAVID COOPER. (1998) Primary HIV-1 Infection: A Review of Clinical Manifestations, Immunologic and Virologic Changes. AIDS Patient Care and STDs 12:10, 759-767
CrossRef66
PHILIPPE VANHEMS, CLAIRE LECOMTE, JACQUES FABRY. (1998) Primary HIV-1 Infection: Diagnosis and Prognostic Impact. AIDS Patient Care and STDs 12:10, 751-758
CrossRef67
Joseph J. Eron, Pietro L. Vernazza, David M. Johnston, Françoise Seillier-Moiseiwitsch, Timothy M. Alcorn, Susan A. Fiscus, Myron S. Cohen. (1998) Resistance of HIV-1 to antiretroviral agents in blood and seminal plasma. AIDS 12:15, F181-F189
CrossRef68
María Gómez-Cano, Amalia Rubio, Teresa Puig, Mayte Pérez-Olmeda, Lidia Ruiz, Vincent Soriano, Juan Antonio Pineda, Laura Zamora, Nuria Xaus, Bonaventura Clotet, Manuel Leal. (1998) Prevalence of genotypic resistance to nucleoside analogues in antiretroviral-naive and antiretroviral-experienced HIV-infected patients in Spain. AIDS 12:9, 1015-1020
CrossRef69
Hecht, Frederick M., Grant, Robert M., Petropoulos, Christos J., Dillon, Beth, Chesney, Margaret A., Tian, Huan, Hellmann, Nicholas S., Bandrapalli, Nirmala I., Digilio, Laura, Branson, Bernard, Kahn, James O., . (1998) Sexual Transmission of an HIV-1 Variant Resistant to Multiple Reverse-Transcriptase and Protease Inhibitors. New England Journal of Medicine 339:5, 307-311
Full Text70
Cohen, Oren J., Fauci, Anthony S., . (1998) Transmission of Multidrug-Resistant Human Immunodeficiency Virus — The Wake-Up Call. New England Journal of Medicine 339:5, 341-343
Full Text71
Maria Gomez-Cano, Amalia Rubio, Teresa Puig, Mayte Perez-Olmeda, Lidia Ruiz, Vincent Soriano, Juan Pineda, Laura Zamora, Nuria Xaus, Bonaventura Clotet, Manuel Leal. (1998) Aids 12:9, 1015-1020
CrossRef72
Seyoum Ayehunie, Amha Belay, Timothy W. Baba, Ruth M. Ruprecht. (1998) Inhibition of HIV-1 Replication by an Aqueous Extract of Spirulina platensis (Arthrospira platensis). Journal of Acquired Immune Deficiency Syndromes and Human Retrovirology 18:1, 7-12
CrossRef73
Amalia Rubio, Manuel Leal, Concha Rey, Juan Antonio Pineda, Armando Sanchez-Quijano, Eduardo Lissen. (1998) Short-term evolution of HIV-1 viraemia and CD4+ cell counts in patients who have a primary mutation to zidovudine. AIDS 12:4, 395-398
CrossRef74
GJ Moyle. (1997) Viral resistance patterns selected by antiretroviral drugs and their potential to guide treatment choice. Expert Opinion on Investigational Drugs 6:8, 943-964
CrossRef75
Pietro L. Vernazza, Bruce L. Gilliam, Markus Flepp, John R. Dyer, Andreas C. Frank, Susan A. Fiscus, Myron S. Cohen, Joseph J. Eron. (1997) Effect of antiviral treatment on the shedding of HIV-1 in semen. AIDS 11:10, 1249-1254
CrossRef76
Michele Crespo-Fierro. (1997) Compliance/adherence and care management in HIV disease. Journal of the Association of Nurses in AIDS care 8:4, 43-54
CrossRef77
A. Rubio, M. Leal, J. A. Pineda, A. Caruz, F. Luque, C. Rey, A. Sanchez-Quijano, E. Lissen. (1997) Increase in the frequency of mutation at codon 215 associated with zidovudine resistance in HIV-1-infected antiviral-naive patients from 1989 to 1996. AIDS 11:9, 1184-1186
CrossRef78
M. Zazzi, Marinunzia Catucci, A. Milito, Laura Romano, Giulietta Venturi, P. E. Valensin, P. Almi, Angela Gonnelli, Maria Rubino. (1996) Zidovudine resistance mutations and human immunodeficiency virus type 1 DNA burden: Longitudinal evaluation of six patients under treatment. Infection 24:6, 419-425
CrossRef79
A. R. McLean, S. D. W. Frost. (1995) Zidovudine and HIV: Mathematical models of within-host population dynamics. Reviews in Medical Virology 5:3, 141-147
CrossRef80
Marco Cusini. (1995) Transmission of HIV infection. Seminars in Dermatology 14:3, 202-204
CrossRef81
Susan E. Beekmann, David K. Henderson. (1995) HIV Infection in healthcare workers: Risk for infection and methods of prevention. Seminars in Dermatology 14:3, 212-218
CrossRef82
Alla Kucherenko, Michael T. Flavin, William A. Boulanger, Albert Khilevich, Robert L. Shone, John D. Rizzo, Abram K. Sheinkman, Ze-Qi Xu. (1995) Novel approach for synthesis of (±)-calanolide a and its anti-HIV activity. Tetrahedron Letters 36:31, 5475-5478
CrossRef83
R DAQUILA. (1995) HIV-1 chemotherapy and drug resistance. Clinical and Diagnostic Virology 3:4, 299-316
CrossRef84
David W. Kimberlin, Clayde S. Crumpacker, Stephen E. Straus, Karen K. Biron, W.Lawrence Drew, Frederick G. Hayden, Mark McKinlay, Douglas D. Richman, Richard J. Whitley. (1995) Antiviral resistance in clinical practice. Antiviral Research 26:4, 423-438
CrossRef85
Fitzgibbon, Joseph E.Gaur, SunandaFrenkel, Lawrence D.Laraque, FabienneEdlin, Brian R.Dubin, Donald T.. (1993) Transmission from One Child to Another of Human Immunodeficiency Virus Type 1 with a Zidovudine-Resistance Mutation. New England Journal of Medicine 329:25, 1835-1841
Full Text86
(1993) Primary Infection with Zidovudine-Resistant HIV. New England Journal of Medicine 329:15, 1123-1124
Full Text87
Bartlett, John G., . (1993) Zidovudine Now or Later?. New England Journal of Medicine 329:5, 351-352
Full Text88
Wood, Alastair J.J., , Hirsch, Martin S.D'Aquila, Richard T.. (1993) Therapy for Human Immunodeficiency Virus Infection. New England Journal of Medicine 328:23, 1686-1695
Full Text89
Richard Horton. (1993) Uncertain future for anti-HIV therapy. The Lancet 341:8860, 1587-1589
CrossRef90
Soeiro, Ruy, . (1993) A Tale of Two Mutants. New England Journal of Medicine 328:16, 1192-1193
Full Text
- Letters
