Original Article
Association between High Levels of Expression of the TRK Gene and Favorable Outcome in Human Neuroblastoma
N Engl J Med 1993; 328:847-854March 25, 1993
- Abstract
Background and Methods
The nerve growth factor receptor is expressed in some neuroblastomas, in which its primary component is encoded by the TRK proto-oncogene. To determine the relation of the expression of TRK messenger RNA in neuroblastomas to other clinical and laboratory variables, we studied frozen tumor samples from 77 patients. In addition, we tested two primary neuroblastomas that expressed TRK for responsiveness to nerve growth factor.
Results
TRK expression strongly correlated with favorable tumor stage (I, II, and IVS vs. III and IV), younger age (<1 year vs. ≥ 1 year), normal N-myc copy number, and low level of N-myc expression. N-myc amplification (indicated by a high copy number) correlated with advanced tumor stage, older age, an adrenal site of the primary tumor, low level of expression of TRK, and high level of expression of N-myc. Analysis of five-year cumulative-survival rates demonstrated an association of a very favorable outcome with a high level of TRK expression (86 percent vs. 14 percent) and with normal N-myc copy number (84 percent vs. 0 percent). Univariate analysis showed that these two variables were the most powerful predictors of outcome (chi-square = 51.30, P<0.001; and chi-square = 93.61, P<0.001, respectively). TRK expression still had significant prognostic value when the analysis was restricted to tumors without N-myc amplification. In primary cultures of neuroblastoma cells expressing TRK, exposure to nerve growth factor induced early gene expression and neurite outgrowth, but deprivation of nerve growth factor led to neuronal cell death.
Conclusions
A high level of expression of the TRK proto-oncogene in a neuroblastoma is strongly predictive of a favorable outcome. A tumor with a functional nerve growth factor receptor may be dependent on the neurotrophin nerve growth factor for survival and may regress in its absence, allowing a new approach to the treatment of certain patients with neuroblastoma. .
Media in This Article
Figure 1
Densitometric Analysis of Expression of TRK and LNGFR in mRNA in Tumor Samples from 77 Patients with Neuroblastomas, According to Tumor Stage and N-myc Copy Number.Figure 2
Cumulative-Survival Curves of Patients with Neuroblastoma, According to Expression of TRK, LNGFR, and N-myc mRNA and N-myc Amplification.Article Activity
- Article
Neuroblastoma is one of the most common malignant tumors among children, yet the prognosis of patients with advanced disease is still very poor. The tumor originates from the sympathoadrenal lineage of the neural crest1. The ability to differentiate both in vivo and in vitro is one of the most interesting characteristics of neuroblastomas, and this differentiation may involve the interaction between the neurotrophin nerve growth factor (NGF) and its receptor2-12. Morphologic differentiation induced by NGF has been observed in a limited number of primary cultures of neuroblastoma,4,6 but most neuroblastoma cell lines are unresponsive to NGF5,8,10-12. In a previous study, we found multiple defects of expression and function of a component of the NGF receptor in neuroblastoma cell lines,11 but the role of the NGF-receptor pathway in the pathogenesis of neuroblastomas has been uncertain.
There are two classes of NGF receptors that bind NGF with either high or low affinity13,14. The low-affinity NGF-receptor (LNGFR) gene encodes a transmembrane protein, which is glycosylated so that it yields a protein of about 75 kd (p75LNGFR)15,16. However, no known biologic responses are mediated solely by the LNGFR17. The high-affinity NGF receptor appears to be a heteromeric complex that includes p75LNGFR and p140 proto-TRK, the product of the proto-oncogene TRK (also known as TRKA)18,19. This transmembrane glycoprotein is a tyrosine kinase that is expressed selectively in the developing nervous system20. The biologic responsiveness to NGF depends on interactions with p140proto-TRK, but at present it is unclear whether this protein exerts full biologic activity alone or acts as part of a high-affinity receptor21-24.
TRK is expressed in many primary neuroblastomas and is associated inversely with amplification of the N-myc proto-oncogene25. We studied the expression of TRK and LNGFR and attempted to relate the expression of these genes to clinical and biologic variables, to assess the importance of the expression of NGF receptors in neuroblastomas. In addition, we tested the function of the NGF receptor in vitro in primary neuroblastomas that expressed TRK. We found that TRK expression is a powerful prognostic marker that identifies a favorable group of tumors. We also found that NGF induces terminal neuronal differentiation in these cells, but that deprivation of NGF leads to neuronal cell death.
Methods
Patients and Therapy
We studied tumors from 77 children with neuroblastomas that had been diagnosed in Japan and the United States from 1982 to 199125. Sixty-three patients were identified at Kyushu Neuroblastoma Study Group institutions and cooperative hospitals in Japan; the tumors of 27 of these patients were found during a mass screening program for neuroblastoma26. Thirteen patients were identified at Washington University in St. Louis or at other institutions of the Pediatric Oncology Group, and one was identified elsewhere25. The selection of tumors for study was based solely on the availability of a sufficient amount of tumor tissue from which to prepare DNA and messenger RNA (mRNA) for the analyses described below.
All diagnoses of neuroblastoma were confirmed by histologic assessment of a tumor specimen obtained at surgery. The histologic features of the tumors were classified as described previously27. There were 59 neuroblastomas and 18 ganglioneuroblastomas, all of which were considered neuroblastomas in these analyses. The tumors were staged according to the system of Evans et al28. Twenty patients (13 identified by mass screening) had stage I tumors, 14 (9 identified by mass screening) had stage II tumors, 15 (5 identified by mass screening) had stage III tumors, 16 had stage IV tumors, and 12 had stage IVS tumors. In addition to the tumors from the 77 patients, ganglioneuromas from 5 patients were included as differentiated tumors in the comparison of gene expression with tumor histology, but these patients were not included in the survival analysis.
Patients were treated according to previously described protocols29-35. Despite differences between the protocols for treating the Japanese patients and those for treating the patients studied by the Pediatric Oncology Group, the drugs and doses used in the protocols were quite similar, and the stage-specific survival rates of the two groups did not differ significantly (data not shown). The median follow-up period after diagnosis was 36 months (range, 8 to 116). None of the patients underwent bone marrow transplantation.
Tumor Specimens and Cell Lines
Sixty of the 77 neuroblastoma samples were obtained from untreated patients. Fifteen Japanese patients with advanced disease received one or two courses of chemotherapy before tumor removal. Two tumor samples were obtained from metastases (a lymph node and a liver nodule), and the rest were obtained from the primary tumors. The tumor tissues were immediately frozen and stored at -70 °C until used. Three human neuroblastoma cell lines -- SK-N-SH (NSH), SH-SY5Y (SY5Y), and NMB -- as well as a rat pheochromocytoma line, PC12, have been described previously36,37 and were grown as described25.
Southern and Northern Blot Analyses
The Nu-myc copy number was determined by Southern blot analysis38,39. A normal N-myc copy number is defined as 1 copy per haploid genome (i.e., 2 per cell); a copy number above 3 per haploid genome was considered to indicate N-myc amplification, but most tumors with such amplification had 50 to 100 copies or more38,39. Total RNA was extracted from 0.5 to 1.0 g of frozen tumor tissue or cultured cells40. Expression of TRK, LNGFR, S100, and N-myc mRNA was measured by Northern blot analysis, normalized to the level of expression of β-actin, and quantitated in arbitrary density units25. For some analyses, the tumors were grouped into those with a low level of expression (<100 density units) and those with a high level (≥ 100 density units).
The following probes were gifts: the TRK probe from Luis Parada,23 the LNGFR probe from Moses Chao,15 and the N-myc probe from J. Michael Bishop38. Expression of S100-β was used as a marker for Schwann cells41. The S100-β probe was prepared by polymerase-chain-reaction (PCR) amplification and subcloning, based on a published sequence42. PCR amplification with total human DNA as a template resulted in a 778-base-pair fragment (primers, 5'TCAAAGAGCAGGAGGTTGTG3' and 5'GACTTGAATCGCATGGGTCA3'). To assess the function of the NGF receptor in primary cultures, we measured the induction of expression of the early-response genes FOS43-45 and NGFI-A46. All probes were labeled by means of the random-hexamer primer technique47.
Primary Culture of Neuroblastoma
Tumor cells were dissociated from tumor tissue obtained at surgery6. Aliquots of cells in collagen-coated wells were divided into three groups: a control group (in standard medium), an NGF-treated group (with 100 ng of mouse NGF per milliliter), and an NGF-depleted group (with 40 units of anti-NGF antiserum per milliliter). The NGF and antiserum48 were provided by Eugene M. Johnson. The cells were grown at 37 °C, and the culture medium was changed every two or three days. For the studies of expression, the cells were grown in standard medium for 36 hours, treated with NGF for 40 minutes, and then immediately harvested, frozen, and stored at -70 °C for analysis.
Statistical Analysis
Statistical analyses were performed at the Pediatric Oncology Group Statistical Office with SAS software. Associations between pairs of categorical variables were assessed with Pearson's chi-square statistic. The continuous variables of groups were compared by the Wilcoxon rank-sum test. Survival probabilities in various subgroups were estimated according to the method of Kaplan and Meier49. Survival of groups was compared by log-rank tests,50 with adjustment for N-myc amplification by Cox regression51.
Results
Expression of TRK, LNGFR, and N-myc
Expression of TRK mRNA was detected in 70 of the 77 neuroblastomas (91 percent), and LNGFR was expressed in 67 (87 percent) (Figure 1Figure 1
Densitometric Analysis of Expression of TRK and LNGFR in mRNA in Tumor Samples from 77 Patients with Neuroblastomas, According to Tumor Stage and N-myc Copy Number.). However, a high level of expression (≥ 100 density units) of TRK was observed in 82 percent (63 tumors), but comparable levels of LNGFR expression were found only in 36 percent (28 tumors). The median level of TRK expression in tumors in stages I, II, and IVS was 1544 density units (46 tumors), whereas that in tumors in stages III and IV was 402 density units (31 tumors)(P<0.001) (Figure 1A). Eleven tumors with N-myc amplification had an extremely low median level of TRK expression (0 density units), as compared with tumors without amplification (1352 density units; P = 0.003). When tumors with N-myc amplification were excluded, there was still a significant difference between the two tumor-stage groups in the level of TRK expression (P = 0.016).The median level of LNGFR expression was 22 density units in stage I, II and IVS tumors (46 tumors) and 7 density units in stage III and IV tumors (31 tumors) (Figure 1B). The tendency of stage I, II, and IVS tumors to have higher levels of LNGFR expression only approached significance (P = 0.076). Tumors with N-myc amplification showed low levels of LNGFR expression, as compared with tumors without amplification (median, 3 density units [11 tumors] vs. 15 density units [66 tumors]; P<0.001). The expression of TRK in the reference neuroblastoma cell lines NSH, SY5Y, and NMB was 21, 110, and 0 density units, respectively, and the expression of LNGFR was 7, 6, and 0 density units, respectively (data not shown). N-myc was expressed at very high levels in all tumors with N-myc amplification (median level in 11 tumors with amplification vs. median in 66 without amplification, 940 vs. 10 density units; P<0.001). However, a moderate level of expression was also observed in some tumors without amplification, and the level of expression was independent of tumor stage. The pattern of expression of TRK, LNGFR, and N-myc in tumors identified by mass screening was not significantly different from that in tumors diagnosed because of clinical symptoms.
Age, Tumor Histology, and Pattern of Gene Expression
We analyzed the relation between the patient's age, the histologic grade of differentiation, and the expression of TRK, LNGFR, S100-β, and N-myc. The expression of S100-β was considered a marker of Schwann cells, which are found frequently in differentiated ganglioneuroblastomas and ganglioneuromas41. Among the tumors from infants (patients less than one year old), histologically undifferentiated neuroblastomas accounted for 88 percent of tumors (42 of 48), although almost all such tumors are curable. The TRK proto-oncogene was expressed strongly in 94 percent (45) of these tumors, whereas LNGFR was expressed strongly in only 33 percent (16 tumors). Nevertheless, there was no correlation between the histologic grade of differentiation and the level of expression of TRK, LNGFR, S100-β, and N-myc in the infants.
In contrast, the proportion of histologically differentiated ganglioneuromas and ganglioneuroblastomas was higher (50 percent, or 17 of 34 tumors) among patients more than one year of age. The level of expression of LNGFR and S100-β was high among differentiated tumors (P = 0.012 and P<0.001, respectively), whereas the level of N-myc was high among undifferentiated tumors (P = 0.019). Interestingly, the level of expression of TRK did not correlate significantly with the histologic grade of differentiation (P>0.1). The five ganglioneuromas were obtained from patients more than one year of age, and all expressed both LNGFR and S100-β strongly, but they did not express N-myc.
Gene Expression and Survival
The cumulative-survival curves in the groups with high and low levels of expression of TRK and LNGFR, as well as amplification and expression of N-myc, are shown in Figure 2Figure 2
Cumulative-Survival Curves of Patients with Neuroblastoma, According to Expression of TRK, LNGFR, and N-myc mRNA and N-myc Amplification.. The expression of TRK correlated strongly with survival (Figure 2A) (P<0.001): the five-year cumulative-survival rate of the group with a high level of TRK expression was 86 percent, whereas that of the group with a low level of TRK expression was 14 percent. N-myc amplification correlated significantly with poor survival (P<0.001) (Figure 2B). Although survival was significantly better when the level of expression of LNGFR was high (Figure 2C) and that of the expression of N-myc was low (Figure 2D), the prognostic power of these biologic variables was not as great as that of TRK expression or N-myc amplification (see below).We analyzed survival according to the pattern of expression of both TRK and LNGFR. The group with high levels of expression of both TRK and LNGFR had the best five-year survival rate (92 percent), and the group with low levels of expression of both genes had the worst (9 percent). However, neither high nor low levels of expression of LNGFR significantly influenced survival after correction for the expression of TRK (data not shown). Figure 3Figure 3
Cumulative Survival According to Expression of TRK mRNA and N-myc Amplification Combined. shows the effect of the combination of TRK expression and N-myc amplification on cumulative survival. The group with high levels of TRK expression and no N-myc amplification (62 patients) had a cumulative five-year survival of 87 percent. Four patients whose tumors had a normal N-myc copy number had a low level of expression of TRK, and their survival was significantly worse than that of the group with a high level of TRK expression (P = 0.03) (Figure 3). All 11 patients with N-myc amplification had low levels of expression of TRK except 1 patient (not shown in Figure 3), who had high levels of TRK expression. The tumor of this patient was regressing at the time of biopsy, but a recurrence was fatal25,52; all 11 of these patients died within two years after diagnosis.We analyzed the effect on survival of the expression of TRK, LNGFR, and S100-β, as compared with the effect of the patient's age, tumor stage, primary tumor site, and tumor histology, as well as amplification and expression of N-myc (Table 1Table 1
Univariate and Multivariate Analysis of Clinical and Laboratory Variables and Survival in 77 Patients with Neuroblastomas.). On the basis of this univariate analysis, N-myc amplification and TRK expression were significant factors (chi-square = 93.61 and 51.30, respectively; P<0.001 for each), as were stage and age (chi-square = 23.30 and 21.67, respectively; P<0.001 for each); tumor site, N-myc expression, and LNGFR expression were not as significant (Table 1). When outcome was adjusted for the effect of N-myc amplification, TRK expression was no longer significant among all the patients studied, but it did remain significant among the patients without N-myc amplification (chi-square = 4.56; P = 0.03); stage and age remained significant (Table 1), but after adjustment for stage no other factors had prognostic value.Expression and Function of NGF Receptor in Primary Tumors
The above studies indicated that most neuroblastomas from patients with a favorable prognosis (particularly infants) had high levels of expression of both TRK and LNGFR. To determine whether the NGF-receptor pathway was functional in these tumors, we established primary cultures of neuroblastomas from two such patients. Patient 1 was a 14-month-old girl with a posterior mediastinal mass, and Patient 2 was a 2-month-old girl with an intrapelvic tumor.
The levels of TRK expression and LNGFR expression in tumor tissue from Patient 1 were 411 and 1260 density units, respectively, and the levels in tissue from Patient 2 were 1307 and 580 density units, respectively. The adherent tumor cells from Patient 1 in medium containing NGF developed substantial neurite extension by day 6, which reached a maximum on day 13, and the differentiated cells survived more than one month (data not shown). However, in medium depleted of NGF some adherent cells extended a few short neurites, but all cells ultimately died within two weeks in vitro.
The primary tumor cells from Patient 2 responded to NGF more quickly. The NGF-treated cells showed numerous neurites by day 2, which grew further by day 7, and these cells survived more than 100 days. In addition, NGF induced the expression of the early-response genes, FOS and NGFI-A, in these cells (Figure 4Figure 4
Induction of the Expression of FOS and NGFI-A by NGF Treatment of Primary Culture Cells from Patient 2.). However, tumor cells cultured in standard medium or in NGF-depleted medium began dying after day 4, and all had died by day 14. The tumor cells grown in NGF-depleted medium died more rapidly than those grown in standard medium.Discussion
Neuroblastomas are derived from the sympathoadrenal progenitors of the neural crest. The expression of the components of the NGF receptor in these progenitors, as well as their responsiveness to NGF, is developmentally regulated. The earliest progenitors express neither component,53,54 but subsequently NGF receptor is expressed on migrating neural-crest cells55. Identifiable fetal sympathetic ganglia and adrenal medullary cells bind NGF with high and low affinity and presumably express both TRK and LNGFR20,55-59. These cells soon become dependent on NGF for their survival, and they differentiate in its presence. However, complete neuronal differentiation may require additional factors53,54. Deprivation of neurotrophic factor may lead to programmed cell death at this stage60,61. Finally, cells that undergo morphologic differentiation become relatively independent of NGF for their survival and will not die rapidly if it is withdrawn61-63.
Our studies indicate that the level of TRK expression is high in the majority of neuroblastomas, particularly in those of infants and patients in the earlier stages of disease. In addition, a high level of TRK expression correlates strongly with a favorable outcome. However, the pattern of expression of LNGFR and its prognostic importance are less clear. The heterogeneity of expression of TRK and LNGFR in neuroblastomas is consistent with the pattern of expression in sympathoadrenal precursors, and it may reflect arrested differentiation at these stages, as suggested by other investigators using different developmental markers64,65.
We observed several clear patterns of expression of neural-crest-related genes that correlated with distinct histologic patterns and clinical behaviors of the tumors. At the end of the spectrum containing the most immature tumors were neuroblastomas with N-myc amplification. These tumors had high levels of N-myc but low levels or no expression of TRK, LNGFR, and S100-β, and they were the most undifferentiated tumors histologically. These tumors are most likely to become established cell lines in vitro, and they appear to be neither responsive to NGF nor dependent on it for survival. They may mimic the most immature sympathoadrenal precursors53,54.
The next group was made up of tumors without N-myc amplification that expressed TRK, usually with LNGFR. Characteristically, neuroblastomas in infants were undifferentiated histologically, but these tumors had the highest levels of TRK expression, usually with moderate levels of LNGFR expression. S100-β expression usually was low or absent, a finding consistent with the paucity of Schwann cells in these tumors. The level of N-myc expression frequently was high, especially in tumors of infants. These tumors probably express functional NGF receptors, which would make at least some of them both dependent on NGF and responsive to it. These conclusions are supported by our in vitro studies, in which the tumor cells responded to NGF by inducing early-response genes and by terminal differentiation in the sustained presence of NGF. Furthermore, the cells died if NGF was absent or antiserum to NGF was present in the medium, probably as a result of programmed cell death triggered by deprivation of this neurotrophic factor60.
The end of the spectrum containing the most-differentiated tumors is represented by ganglioneuromas, which were found exclusively in patients more than one year of age. These tumors were characterized by high levels of expression of LNGFR and S100-β, reflecting the substantial Schwann-cell component. N-myc expression was very low or absent, and TRK expression was variable, perhaps reflecting the heterogeneity in the number of ganglion cells in these tumors. The finding of ganglioneuromas exclusively in patients more than one year old may indicate that differentiation in vivo is a slower process or that other neurotrophic factors are required.
A variety of other clinical and biologic variables have been proposed as prognostic factors for neuroblastoma, including cellular DNA content or chromosome number (ploidy) as a favorable marker66-70 and N-myc amplification as a marker of poor outcome38,39,70-73. Since the level of TRK expression was high in infants with early-stage tumors, this may represent a biologic mechanism that would explain the favorable behavior of hyperdiploid tumors. Conversely, the virtual absence of TRK expression in tumors with N-myc amplification25 may render these cells unresponsive whether or not NGF is present.
Assessment of TRK expression and of N-myc copy number may provide complementary prognostic information, which in turn may be helpful in determining the most appropriate duration and intensity of treatment. More important, both of these factors may have a role in the pathogenesis of neuroblastoma. Cells expressing functional NGF receptor may be susceptible to either programmed cell death leading to tumor regression, especially in infants, or to differentiation leading to a benign ganglioneuroma, especially in older children. Future therapeutic approaches may be aimed at activating or antagonizing the NGF-receptor pathway to induce differentiation or regression in these tumors. Tumors with N-myc amplification may be particularly aggressive because very high levels of N-myc give them a growth advantage and may also block their differentiation into NGF-dependent or NGF-responsive cells. Such a blockade would require some alternative approach to therapy.
Supported in part by grants (CA-49712, CA-39771, and CA-05587 [to Dr. Brodeur]) from the National Cancer Institute, by a grant (to Dr. Nakagawara) from the National Cancer Institute-Japanese Foundation of Cancer Research Cooperative Cancer Research Program, and by funds from the Ronald McDonald Children's Charities (to Dr. Brodeur).
We are indebted to Drs. Keiichi Ikeda, Sachiyo Suita, Hiroshi Ohgami, Hideko Tasaka, Sumio Miyazaki, Yoshifumi Sera, Hiroshi Akiyama, and Kiyoshi Kawakami (Kyushu Neuroblastoma Study Group institutions), Dr. Takashi Yokoyama (Hiroshima University Hospital), Dr. Akira Kuwano (Yamaguchi University Hospital), Dr. Kazuhiro Kume (Matsuyama Red Cross Hospital), Drs. Paul Bowman, Randall Craver, Joseph Dickerman, Donald Fernbach, Vita Land, Ruprecht Nitchke, and Teresa Vietti (Pediatric Oncology Group institutions), and Dr. Audrey Evans (Children's Hospital of Philadelphia) for contributing neuroblastoma samples for these studies; to Helen Marshall for technical assistance; and to Peter S. White, Jill L. Hiemstra, and Richard B. Schuessler for advice.
Source Information
From the Department of Pediatrics, Washington University School of Medicine, St. Louis (A.N., M.A.-N., N.J.S., C.G.A., G.M.B.), the Pediatric Oncology Group Statistical Office, Gainesville, Fla. (A.B.C.), and the Pediatric Oncology Group, St. Louis (G.M.B., A.B.C.).
Address reprint requests to Dr. Brodeur at the Department of Pediatrics, Washington University School of Medicine, 1 Children's Place, St. Louis, MO 63110.
- References
References
1
Bolande RP . The neurocristopathies: a unifying concept of disease arising in neural crest maldevelopment. Hum Pathol 1974;5:409-429
CrossRef | Web of Science2
Goldstein MN ,Burdman JA ,Journey LJ . Long-term tissue culture of neuroblastomas. II. Morphologic evidence for differentiation and maturation. J Natl Cancer Inst 1964;32:165-199
Web of Science | Medline3
Bill AH ,Seibert ES ,Beckwith JB ,Hartmann JR . Nerve growth factor and nerve growth-stimulating activity in sera from normal and neuroblastoma patients. J Natl Cancer Inst 1969;43:1221-1230
Web of Science | Medline4
Waris T ,Rechardt L ,Waris P . Differentiation of neuroblastoma cells induced by nerve growth factor in vitro. Experientia 1973;29:1128-1129
CrossRef | Medline5
Sonnenfeld KH ,Ishii DN . Nerve growth factor effects and receptors in cultured human neuroblastoma cell lines. J Neurosci Res 1982;8:375-391
CrossRef | Web of Science | Medline6
Tischler AS ,Slayton VW ,Costopoulos DS ,Leape LL ,DeLellis RA ,Wolfe HJ . Nerve growth factor may function as a survival factor for human neuroblastoma cells in culture. Cancer 1984;54:1344-1347
CrossRef | Web of Science | Medline7
Sonnenfeld KH ,Ishii DN . Fast and slow nerve growth factor binding sites in human neuroblastoma and rat pheochromocytoma cell lines: relationship of sites to each other and to neurite formation. J Neurosci 1985;5:1717-1728
Web of Science | Medline8
Marchetti D ,Perez-Polo JR . Nerve growth factor receptors in human neuroblastoma cells. J Neurochem 1987;49:475-486
CrossRef | Web of Science | Medline9
Haskell BE ,Stach RW ,Werrbach-Perez K ,Perez-Polo JR . Effect of retinoic acid on nerve growth factor receptors. Cell Tissue Res 1987;247:67-73
CrossRef | Medline10
Matsushima H ,Bogenmann E . Nerve growth factor (NGF) induces neuronal differentiation in neuroblastoma cells transfected with the NGF receptor cDNA. Mol Cell Biol 1990;10:5015-5020
Web of Science | Medline11
Azar CG ,Scavarda NJ ,Reynolds CP ,Brodeur GM . Multiple defects of the nerve growth factor receptor in human neuroblastomas. Cell Growth Differ 1990;1:421-428
Medline12
Reddy UR ,Venkatakrishnan G ,Roy AK , et al. Characterization of two neuroblastoma cell lines expressing recombinant nerve growth factor receptors. J Neurochem 1991;56:67-74
CrossRef | Web of Science | Medline13
Sutter A ,Riopelle RJ ,Harris-Warrick RM ,Shooter EM . Nerve growth factor receptors: characterization of two distinct classes of binding sites on chick embryo sensory ganglia cells. J Biol Chem 1979;254:5972-5982
Web of Science | Medline14
Green SH ,Greene LA . A single Mr ≤ 103,000 125I-β-nerve growth factor-affinity-labeled species represents both the low and high affinity forms of the nerve growth factor receptor. J Biol Chem 1986;261:15316-15326
Web of Science | Medline15
Chao MV ,Bothwell MA ,Ross AH , et al. Gene transfer and molecular cloning of the human NGF receptor. Science 1986;232:518-521
CrossRef | Web of Science | Medline16
Radeke MJ ,Misko TP ,Hsu C ,Herzenberg LA ,Shooter EM . Gene transfer and molecular cloning of the rat nerve growth factor receptor. Nature 1987;325:593-597
CrossRef | Web of Science | Medline17
Hempstead BL ,Patil N ,Olson K ,Chao MV . Molecular analysis of the nerve growth factor receptor. Cold Spring Harb Symp Quant Biol 1988;53:477-485
Web of Science | Medline18
Ragsdale C ,Woodgett J . trking Neurotrophic receptors. Nature 1991;350:660-661
CrossRef | Web of Science | Medline19
Bothwell M . Keeping track of neurotrophin receptors. Cell 1991;65:915-918
CrossRef | Web of Science | Medline20
Martin-Zanca D ,Barbacid M ,Parada LF . Expression of the trk proto-oncogene is restricted to the sensory cranial and spinal ganglia of neural crest origin in mouse development. Genes Dev 1990;4:683-694
CrossRef | Web of Science | Medline21
Hempstead BL ,Martin-Zanca D ,Kaplan DR ,Parada LF ,Chao MV . High-affinity NGF binding requires coexpression of the trk proto-oncogene and the low-affinity NGF receptor. Nature 1991;350:678-683
CrossRef | Web of Science | Medline22
Klein R ,Jing S ,Nanduri V ,O'Rourke E ,Barbacid M . The trk proto-oncogene encodes a receptor for nerve growth factor. Cell 1991;65:189-197
CrossRef | Web of Science | Medline23
Kaplan DR ,Martin-Zanca D ,Parada LF . Tyrosine phosphorylation and tyrosine kinase activity of the trk proto-oncogene product induced by NGF. Nature 1991;350:158-160
CrossRef | Web of Science | Medline24
Kaplan DR ,Hempstead BL ,Martin-Zanca D ,Chao MV ,Parada LF . The trk proto-oncogene product: a signal transducing receptor for nerve growth factor. Science 1991;252:554-558
CrossRef | Web of Science | Medline25
Nakagawara A ,Arima M ,Azar CG ,Scavarda NJ ,Brodeur GM . Inverse relationship between trk expression and N-myc amplification in human neuroblastomas. Cancer Res 1992;52:1364-1368
Web of Science | Medline26
Takeda T . History and current status of neuroblastoma screening in Japan. Med Pediatr Oncol 1989;17:361-363
CrossRef | Medline27
Ota K, Shimizu K. Histological classification and atlas of tumours in infancy and childhood: a report from the Committee on the Histological Classification of Childhood Tumours of the Japanese Pathological Society. Tokyo, Japan: Kanahara Publisher, 1980.
28
Evans AE ,D'Angio GJ ,Randolph JA . A proposed staging for children with neuroblastoma: children's cancer study group A. Cancer 1971;27:374-378
CrossRef | Web of Science | Medline29
Nakagawara A ,Zaizen Y ,Ikeda K , et al. Different genomic and metabolic patterns between mass screening-positive and mass screening-negative later-presenting neuroblastomas. Cancer 1991;68:2037-2044
CrossRef | Web of Science | Medline30
Green AA ,Hayes FA ,Hustu HO . Sequential cyclophosphamide and doxorubicin for induction of complete remission in children with disseminated neuroblastoma. Cancer 1981;48:2310-2317
CrossRef | Web of Science | Medline31
Ikeda K ,Nakagawara A ,Yano H , et al. Improved survival rates in children over 1 year of age with stage III or IV neuroblastoma following an intensive chemotherapeutic regimen. J Pediatr Surg 1989;24:189-193
CrossRef | Web of Science | Medline32
Bowman LC ,Castleberry RP ,Altshuler G , et al. Therapy based on DNA index (DI) for infants with unresectable and disseminated neuroblastoma (NB): preliminary results of the Pediatric Oncology Group “Better Risk” study. Med Pediatr Oncol 1990;18:364-364 abstract.33
Castleberry RP ,Kun LE ,Shuster JJ , et al. Radiotherapy improves the outlook for patients older than 1 year with Pediatric Oncology Group stage C neuroblastoma. J Clin Oncol 1991;9:789-795
Web of Science | Medline34
Nitschke R ,Smith EI ,Altshuler G , et al. Postoperative treatment of nonmetastatic visible residual neuroblastoma: a Pediatric Oncology Group study. J Clin Oncol 1991;9:1181-1188
Web of Science | Medline35
Graham-Pole J ,Casper J ,Elfenbein G , et al. High-dose chemoradiotherapy supported by marrow infusions for advanced neuroblastoma: a Pediatric Oncology Group study. J Clin Oncol 1991;9:152-158[Erratum, J Clin Oncol 1991;9:1094.]
Web of Science | Medline36
Reynolds CP, Tomayko MM, Donner L, et al. Biological classification of cell lines derived from human extra-cranial neural tumors. In: Evans AE, D'Angio GJ, Knudson AG, Seeger RC, eds. Advances in neuroblastoma research 2: proceedings of the Fourth Symposium on Advances in Neuroblastoma Research, Philadelphia, May 14-16, 1987. Vol. 271 of Progress in clinical and biological research. New York: Alan R. Liss, 1988:291-306.
37
Greene LA ,Tischler AS . Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor. Proc Natl Acad Sci U S A 1976;73:2424-2428
CrossRef | Web of Science | Medline38
Brodeur GM ,Seeger RC ,Schwab M ,Varmus HE ,Bishop JM . Amplification of N-myc in untreated human neuroblastomas correlates with advanced disease stage. Science 1984;224:1121-1124
CrossRef | Web of Science | Medline39
Seeger RC ,Brodeur GM ,Sather H , et al. Association of multiple copies of the N-myc oncogene with rapid progression of neuroblastomas. N Engl J Med 1985;313:1111-1116
Full Text | Web of Science | Medline40
Chomczynski P ,Sacchi N . Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162:156-159
CrossRef | Web of Science | Medline41
Shimada H ,Aoyama C ,Chiba T ,Newton WA Jr . Prognostic subgroups for undifferentiated neuroblastoma: immunohistochemical study with anti-S-100 protein antibody. Hum Pathol 1985;16:471-476
CrossRef | Web of Science | Medline42
Saiki RK ,Gelfand DH ,Stoffel S , et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 1988;239:487-491
CrossRef | Web of Science | Medline43
Greenberg ME ,Greene LA ,Ziff EB . Nerve growth factor and epidermal growth factor induce rapid transient changes in proto-oncogene transcription in PC12 cells. J Biol Chem 1985;260:14101-14110
Web of Science | Medline44
Curran T ,Morgan JI . Superinduction of c-fos by nerve growth factor in the presence of peripherally active benzodiazepines. Science 1985;229:1265-1268
CrossRef | Web of Science | Medline45
Milbrandt J . Nerve growth factor rapidly induces c-fos mRNA in PC12 rat pheochromocytoma cells. Proc Natl Acad Sci U S A 1986;83:4789-4793
CrossRef | Web of Science | Medline46
Milbrandt J . A nerve growth factor-induced gene encodes a possible transcriptional regulatory factor. Science 1987;238:797-799
CrossRef | Web of Science | Medline47
Feinberg AP ,Vogelstein B . Addendum to: A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal Biochem 1984;137:266-267
CrossRef | Web of Science | Medline48
Ruit KG ,Elliott JL ,Osborne PA ,Yan Q ,Snider WD . Selective dependence of mammalian dorsal root ganglion neurons on nerve growth factor during embryonic development. Neuron 1992;8:573-587
CrossRef | Web of Science | Medline49
Kaplan EL ,Meier P . Nonparametric estimation from incomplete observations. J Am Stat Assoc 1958;53:457-481
CrossRef | Web of Science50
Mantel N . Evaluation of survival data and two new rank order statistics arising in its consideration. Cancer Chemother Rep 1966;50:163-170
Medline51
Cox DR . Regression models and life-tables. J R Stat Soc [B] 1972;34:187-22052
Nakagawara A ,Sasazuki T ,Akiyama H , et al. N-myc oncogene and stage IV-S neuroblastoma: preliminary observations on ten cases. Cancer 1990;65:1960-1967
CrossRef | Web of Science | Medline53
Stemple DL ,Mahanthappa NK ,Anderson DJ . Basic FGF induces neuronal differentiation, cell division, and NGF dependence in chromaffin cells: a sequence of events in sympathetic development. Neuron 1988;1:517-525
CrossRef | Web of Science | Medline54
Birren SJ ,Anderson DJ . A v-myc-immortalized sympathoadrenal progenitor cell line in which neuronal differentiation is initiated by FGF but not NGF. Neuron 1990;4:189-201
CrossRef | Web of Science | Medline55
Heuer JG ,Fatemie-Nainie S ,Wheeler EF ,Bothwell M . Structure and developmental expression of the chicken NGF receptor. Dev Biol 1990;137:287-304
CrossRef | Web of Science | Medline56
Godfrey EW ,Shooter EM . Nerve growth factor receptors on chick embryo sympathetic ganglion cells: binding characteristics and development. J Neurosci 1986;6:2543-2550
Web of Science | Medline57
Yan Q ,Johnson EM Jr . A quantitative study of the developmental expression of nerve growth factor (NGF) receptor in rats. Dev Biol 1987;121:139-148
CrossRef | Web of Science | Medline58
Yan Q ,Johnson EM Jr . An immunohistochemical study of the nerve growth factor receptor in developing rats. J Neurosci 1988;8:3481-3498
Web of Science | Medline59
Baker DL ,Molenaar WM ,Trojanowski JQ , et al. Nerve growth factor receptor expression in peripheral and central neuroectodermal tumors, other pediatric brain tumors, and during development of the adrenal gland. Am J Pathol 1991;139:115-122
Web of Science | Medline60
Martin DP ,Schmidt RE ,DiStefano PS ,Lowry OH ,Carter JG ,Johnson EM Jr . Inhibitors of protein synthesis and RNA synthesis prevent neuronal death caused by nerve growth factor deprivation. J Cell Biol 1988;106:829-844
CrossRef | Web of Science | Medline61
Koike T ,Tanaka S . Evidence that nerve growth factor dependence of sympathetic neurons for survival in vitro may be determined by levels of cytoplasmic free Ca2+. Proc Natl Acad Sci U S A 1991;88:3892-3896
CrossRef | Web of Science | Medline62
Levi-Montalcini R . The nerve growth factor 35 years later. Science 1987;237:1154-1162
CrossRef | Web of Science | Medline63
Eichler ME ,Rich KM . Death of sensory ganglion neurons after acute withdrawal of nerve growth factor in dissociated cell cultures. Brain Res 1989;482:340-346
CrossRef | Web of Science | Medline64
Tsokos M ,Scarpa S ,Ross RA ,Triche TJ . Differentiation of human neuroblastoma recapitulates neural crest development: study of morphology, neurotransmitter enzymes, and extracellular matrix proteins. Am J Pathol 1987;128:484-496
Web of Science | Medline65
Cooper MJ ,Hutchins GM ,Cohen PS ,Helman LJ ,Mennie RJ ,Israel MA . Human neuroblastoma tumor cell lines correspond to the arrested differentiation of chromaffin adrenal medullary neuroblasts. Cell Growth Differ 1990;1:149-159
Medline66
Look AT ,Hayes FA ,Nitschke R ,McWilliams NB ,Green AA . Cellular DNA content as a predictor of response to chemotherapy in infants with unresectable neuroblastoma. N Engl J Med 1984;311:231-235
Full Text | Web of Science | Medline67
Hayashi Y ,Hanada R ,Yamamoto K ,Bessho F . Chromosome findings and prognosis in neuroblastoma. Cancer Genet Cytogenet 1987;29:175-177
CrossRef | Web of Science | Medline68
Kaneko Y ,Kanda N ,Maseki N , et al. Different karyotypic patterns in early and advanced stage neuroblastomas. Cancer Res 1987;47:311-318
Web of Science | Medline69
Taylor SR ,Blatt J ,Costantino JP ,Roederer M ,Murphy RF . Flow cytometric DNA analysis of neuroblastoma and ganglioneuroma: a 10-year retrospective study. Cancer 1988;62:749-754
CrossRef | Web of Science | Medline70
Look AT ,Hayes FA ,Shuster JJ , et al. Clinical relevance of tumor cell ploidy and N-myc gene amplification in childhood neuroblastoma: a Pediatric Oncology Group study. J Clin Oncol 1991;9:581-591
Web of Science | Medline71
Bartram CR ,Berthold F . Amplification and expression of the N-myc gene in neuroblastoma. Eur J Pediatr 1987;146:162-165
CrossRef | Web of Science | Medline72
Nakagawara A ,Ikeda K ,Tsuda T ,Higashi K . N-myc oncogene amplification and prognostic factors of neuroblastoma in children. J Pediatr Surg 1987;22:895-898
CrossRef | Web of Science | Medline73
Slavc I ,Ellenbogen R ,Jung W-H , et al. myc Gene amplification and expression in primary human neuroblastoma. Cancer Res 1990;50:1459-1463
Web of Science | Medline
- Citing Articles (213)
Citing Articles
1
Andrew M. Davidoff. (2012) Neuroblastoma. Seminars in Pediatric Surgery 21:1, 2-14
CrossRef2
Yu-Yin Shih, Akira Nakagawara, Hsinyu Lee, Hsueh-Fen Juan, Yung-Ming Jeng, Dong-Tsamn Lin, Yung-Li Yang, Yeou-Guang Tsay, Min-Chuan Huang, Chien-Yuan Pan, Wen-Ming Hsu, Yung-Feng Liao. (2011) Calreticulin Mediates Nerve Growth Factor-Induced Neuronal Differentiation. Journal of Molecular Neuroscience
CrossRef3
C. S. Verissimo, J. J. Molenaar, C. P. Fitzsimons, E. Vreugdenhil. (2011) Neuroblastoma therapy: what is in the pipeline?. Endocrine Related Cancer 18:6, R213-R231
CrossRef4
Ulrica K. Westermark, Margareta Wilhelm, Anna Frenzel, Marie Arsenian Henriksson. (2011) The MYCN oncogene and differentiation in neuroblastoma. Seminars in Cancer Biology 21:4, 256-266
CrossRef5
Jane E. Minturn, Audrey E. Evans, Judith G. Villablanca, Gregory A. Yanik, Julie R. Park, Suzanne Shusterman, Susan Groshen, Edward T. Hellriegel, Debra Bensen-Kennedy, Katherine K. Matthay, Garrett M. Brodeur, John M. Maris. (2011) Phase I trial of lestaurtinib for children with refractory neuroblastoma: a new approaches to neuroblastoma therapy consortium study. Cancer Chemotherapy and Pharmacology 68:4, 1057-1065
CrossRef6
Sofie A. Mohlin, Caroline Wigerup, Sven Påhlman. (2011) Neuroblastoma aggressiveness in relation to sympathetic neuronal differentiation stage. Seminars in Cancer Biology 21:4, 276-282
CrossRef7
Winnie Fung, Muhammed Yaser Hasan, Amos Hong Pheng Loh, Joyce Horng Yiing Chua, Yong Min Hwee, Louise Knight, Hwang Wei Sek, Chan Mei Yoke, Seow Wan Tew, Anette S. Jacobsen, Chui Chan Hon. (2011) Gene Expression of TRK Neurotrophin Receptors in Advanced Neuroblastomas in Singapore—A Pilot Study. Pediatric Hematology-Oncology 28:7, 571-578
CrossRef8
Yohko Kyo, Takeo Tanaka, Kunihiko Hayashi, Tomoko Iehara, Michio Kaneko, Hajime Hosoi, Tohru Sugimoto, Minoru Hamasaki, Masao Kobayashi, Tadashi Sawada. (2011) Identification of therapy-sensitive and therapy-resistant neuroblastoma subtypes in stages III, IVs and IV. Cancer Letters 306:1, 27-33
CrossRef9
Z Liu, X Yang, Z Li, C McMahon, C Sizer, L Barenboim-Stapleton, V Bliskovsky, B Mock, T Ried, W B London, J Maris, J Khan, C J Thiele. (2011) CASZ1, a candidate tumor-suppressor gene, suppresses neuroblastoma tumor growth through reprogramming gene expression. Cell Death and Differentiation 18:7, 1174-1183
CrossRef10
Ruth Ho, Jane E. Minturn, Anisha M. Simpson, Radhika Iyer, Jennifer E. Light, Audrey E. Evans, Garrett M. Brodeur. (2011) The effect of P75 on Trk receptors in neuroblastomas. Cancer Letters 305:1, 76-85
CrossRef11
Daniela Raguer Valadão de Souza, Sabri Saeed Sanabani, Ana Carolina Mamana Fernandes de Souza, Vicente Filho Odone, Sidnei Epelman, Israel Bendit. (2011) Prognostic impact of MYCN, DDX1, TrkA, and TrkC gene transcripts expression in neuroblastoma. Pediatric Blood & Cancer 56:5, 749-756
CrossRef12
Mathias Rhein, Adrian Schwarzer, Min Yang, Volkhard Kaever, Martijn Brugman, Johann Meyer, Arnold Ganser, Christopher Baum, Zhixiong Li. (2011) Leukemias induced by altered TRK-signaling are sensitive to mTOR inhibitors in preclinical models. Annals of Hematology 90:3, 283-292
CrossRef13
Rebecca J. Deyell, Edward F. Attiyeh. (2011) Advances in the understanding of constitutional and somatic genomic alterations in neuroblastoma. Cancer Genetics 204:3, 113-121
CrossRef14
Jennifer E. Light, Hiroshi Koyama, Jane E. Minturn, Ruth Ho, Anisha M. Simpson, Radhika Iyer, Jennifer L. Mangino, Venkatadri Kolla, Wendy B. London, Garrett M. Brodeur. (2011) Clinical significance of NTRK family gene expression in neuroblastomas. Pediatric Blood & Cancern/a-n/a
CrossRef15
Cheryl M. Coffin, Jessica M. Comstock, Jeremy C. Wallentine. 2011. Immunohistology of Pediatric Neoplasms. , 662-689.
CrossRef16
Zhijie Li, Doo-Yi Oh, Katsuya Nakamura, Carol J. Thiele. (2011) Perifosine-induced inhibition of akt attenuates brain-derived neurotrophic factor/TrkB-induced chemoresistance in neuroblastoma in vivo. Cancern/a-n/a
CrossRef17
Don Eslin, Umesh T. Sankpal, Chris Lee, Robert M. Sutphin, Pius Maliakal, Erika Currier, Giselle Sholler, Moeez Khan, Riyaz Basha. (2011) Tolfenamic acid inhibits neuroblastoma cell proliferation and induces apoptosis: A novel therapeutic agent for neuroblastoma. Molecular Carcinogenesisn/a-n/a
CrossRef18
Tomoro Hishiki, Takeshi Saito, Keita Terui, Yoshiharu Sato, Ayako Takenouchi, Eriko Yahata, Sachie Ono, Akira Nakagawara, Takehiko Kamijo, Yohko Nakamura, Tadashi Matsunaga, Hideo Yoshida. (2010) Reevaluation of trkA expression as a biological marker of neuroblastoma by high-sensitivity expression analysis—a study of 106 primary neuroblastomas treated in a single institute. Journal of Pediatric Surgery 45:12, 2293-2298
CrossRef19
Miki Ohira, Akira Nakagawara. (2010) Global genomic and RNA profiles for novel risk stratification of neuroblastoma. Cancer Science 101:11, 2295-2301
CrossRef20
G. M. Brodeur. (2010) Getting Into the AKT. JNCI Journal of the National Cancer Institute 102:11, 747-749
CrossRef21
M. Filippou, A. Vassiliou, G. Sakellaris. (2010) Neuroblastoma in childhood. Hellenic Journal of Surgery 82:3, 184-191
CrossRef22
Muriel Bassili, Elena Birman, Nina F. Schor, H. Uri Saragovi. (2010) Differential roles of Trk and p75 neurotrophin receptors in tumorigenesis and chemoresistance ex vivo and in vivo. Cancer Chemotherapy and Pharmacology 65:6, 1047-1056
CrossRef23
Julie R. Park, Angelika Eggert, Huib Caron. (2010) Neuroblastoma: Biology, Prognosis, and Treatment. Hematology/Oncology Clinics of North America 24:1, 65-86
CrossRef24
Caroline Brunetto de Farias, Denis Broock Rosemberg, Tiago Elias Heinen, Patricia Koehler-Santos, Ana Lucia Abujamra, Flávio Kapczinski, Algemir Lunardi Brunetto, Patricia Ashton-Prolla, Luise Meurer, Maurício Reis Bogo, Daniel C. Damin, Gilberto Schwartsmann, Rafael Roesler. (2010) BDNF/TrkB Content and Interaction with Gastrin-Releasing Peptide Receptor Blockade in Colorectal Cancer. Oncology 79:5-6, 430-439
CrossRef25
Woong Jae Yun, Soo Hee Kim, Eun Shin, Ja June Jang, Kyoungbun Lee. (2009) Human neuroblastoma cell line SNU-NB1 loses sensitivity to brain-derived neurotrophic factor during establishment. Basic and Applied Pathology 2:4, 131-136
CrossRef26
Abraham Fong, Julie R. Park. (2009) HIGH-RISK NEUROBLASTOMA: A Therapy in Evolution. Pediatric Hematology-Oncology 26:8, 539-548
CrossRef27
Manish Mani Subramaniam, Marta Piqueras, Samuel Navarro, Rosa Noguera. (2009) Aberrant copy numbers of ALK gene is a frequent genetic alteration in neuroblastomas. Human Pathology 40:11, 1638-1642
CrossRef28
André Oberthuer, Jessica Theissen, Frank Westermann, Barbara Hero, Matthias Fischer. (2009) Molecular characterization and classification of neuroblastoma. Future Oncology 5:5, 625-639
CrossRef29
Johannes H. Schulte, Falk Pentek, Wolfgang Hartmann, Alexander Schramm, Nicolaus Friedrichs, Ingrid Øra, Jan Koster, Rogier Versteeg, Jutta Kirfel, Reinhard Buettner, Angelika Eggert. (2009) The low-affinity neurotrophin receptor, p75, is upregulated in ganglioneuroblastoma/ganglioneuroma and reduces tumorigenicity of neuroblastoma cells in vivo. International Journal of Cancer 124:10, 2488-2494
CrossRef30
F Cimmino, J H Schulte, M Zollo, J Koster, R Versteeg, A Iolascon, A Eggert, A Schramm. (2009) Galectin-1 is a major effector of TrkB-mediated neuroblastoma aggressiveness. Oncogene 28:19, 2015-2023
CrossRef31
John Inge Johnsen, Per Kogner, Ami Albihn, Marie Arsenian Henriksson. (2009) Embryonal neural tumours and cell death. Apoptosis 14:4, 424-438
CrossRef32
Z. Li, G. Beutel, M. Rhein, J. Meyer, C. Koenecke, T. Neumann, M. Yang, J. Krauter, N. von Neuhoff, M. Heuser, H. Diedrich, G. Gohring, L. Wilkens, B. Schlegelberger, A. Ganser, C. Baum. (2009) High-affinity neurotrophin receptors and ligands promote leukemogenesis. Blood 113:9, 2028-2037
CrossRef33
I Miyake, M Ohira, A Nakagawara, R Sakai. (2009) Distinct role of ShcC docking protein in the differentiation of neuroblastoma. Oncogene 28:5, 662-673
CrossRef34
Qiang-song TONG, Guo-song JIANG, Li-duan ZHENG, Shao-tao TANG, Jia-bin CAI, Yuan LIU, Fu-qing ZENG, Ji-hua DONG. (2008) Natural jasmonates of different structures suppress the growth of human neuroblastoma cell line SH-SY5Y and its mechanisms 1. Acta Pharmacologica Sinica 29:7, 861-869
CrossRef35
Qiang-Song Tong, Guo-Song Jiang, Li-Duan Zheng, Shao-Tao Tang, Jia-bin Cai, Yuan Liu, Fu-Qing Zeng, Ji-Hua Dong. (2008) Methyl jasmonate downregulates expression of proliferating cell nuclear antigen and induces apoptosis in human neuroblastoma cell lines. Anti-Cancer Drugs 19:6, 573-581
CrossRef36
Eun-Ju Chang, Young Sun Im, EunDuck P. Kay, Jong Youl Kim, Jong Eun Lee, Hyung Keun Lee. (2008) The role of nerve growth factor in hyperosmolar stress induced apoptosis. Journal of Cellular Physiology 216:1, 69-77
CrossRef37
Grigore Cernaianu, Philipp Brandmaier, Gabriele Scholz, Oliver Pelz Ackermann, Ruediger Alt, Karin Rothe, Michael Cross, Helmut Witzigmann, Ralf B. Tröbs. (2008) All-trans retinoic acid arrests neuroblastoma cells in a dormant state. Subsequent nerve growth factor/brain-derived neurotrophic factor treatment adds modest benefit. Journal of Pediatric Surgery 43:7, 1284-1294
CrossRef38
S Nowacki, M Skowron, A Oberthuer, A Fagin, H Voth, B Brors, F Westermann, A Eggert, B Hero, F Berthold, M Fischer. (2008) Expression of the tumour suppressor gene CADM1 is associated with favourable outcome and inhibits cell survival in neuroblastoma. Oncogene 27:23, 3329-3338
CrossRef39
Anna Geer, Lena-Maria Carlson, Per Kogner, Jelena Levitskaya. (2008) Soluble factors released by activated cytotoxic T lymphocytes interfere with death receptor pathways in neuroblastoma. Cancer Immunology, Immunotherapy 57:5, 731-743
CrossRef40
Barbara Sitek, Burghardt Scheibe, Klaus Jung, Alexander Schramm, Kai St
hler. 2008. Difference Gel Electrophoresis (DIGE). .
CrossRef41
Beatrice Nico, Domenica Mangieri, Vincenzo Benagiano, Enrico Crivellato, Domenico Ribatti. (2008) Nerve growth factor as an angiogenic factor. Microvascular Research 75:2, 135-141
CrossRef42
Piruz Nahreini, Xiang-Dong Yan, Cynthia P. Andreatta, Kedar N. Prasad, Neil W. Toribara. (2008) Identifying altered gene expression in neuroblastoma cells preceding apoptosis. Journal of Cancer Research and Clinical Oncology 134:3, 411-419
CrossRef43
Kenneth D. Swanson, Jordan M. Winter, Marcelo Reis, Mohamed Bentires-Alj, Heidi Greulich, Rupinder Grewal, Ralph H. Hruban, Charles J. Yeo, Yosuf Yassin, Oleg Iartchouk, Kate Montgomery, Susan P. Whitman, Michael A. Caligiuri, Mignon L. Loh, D. Gary Gilliland, A. Thomas Look, Raju Kucherlapati, Scott E. Kern, Matthew Meyerson, Benjamin G. Neel. (2008) SOS1 mutations are rare in human malignancies: Implications for Noonan syndrome patients. Genes, Chromosomes and Cancer 47:3, 253-259
CrossRef44
Julie R. Park, Angelika Eggert, Huib Caron. (2008) Neuroblastoma: Biology, Prognosis, and Treatment. Pediatric Clinics of North America 55:1, 97-120
CrossRef45
Harald Stephan, Johannes L. Zakrzewski, Réka Bölöni, Corinna Grasemann, Dietmar R. Lohmann, Angelika Eggert. (2008) Neurotrophin receptor expression in human primary retinoblastomas and retinoblastoma cell lines. Pediatric Blood & Cancer 50:2, 218-222
CrossRef46
N Tomioka, S Oba, M Ohira, A Misra, J Fridlyand, S Ishii, Y Nakamura, E Isogai, T Hirata, Y Yoshida, S Todo, Y Kaneko, D G Albertson, D Pinkel, B G Feuerstein, A Nakagawara. (2008) Novel risk stratification of patients with neuroblastoma by genomic signature, which is independent of molecular signature. Oncogene 27:4, 441-449
CrossRef47
S. Pai Balaji, Nithyananda Shetty, Anita Mahadevan, S. K. Shankar. (2008) A 21-MONTH-OLD CHILD WITH ACUTE SPASTIC PARAPAPRESIS. Brain Pathology 18:1, 143-143
CrossRef48
Michal Nowicki, Aneta Konwerska, Danuta Ostalska-Nowicka, Katarzyna Derwich, Bogdan Miskowiak, Beata Kondraciuk, Dariusz Samulak, Martin Witt. (2008) Vascular endothelial growth factor (VEGF)-C — a potent risk factor in children diagnosed with stadium 4 neuroblastoma. Folia Histochemica et Cytobiologica 46:4, 493-499
CrossRef49
Zhijie Li, Carol J Thiele. (2007) Targeting Akt to increase the sensitivity of neuroblastoma to chemotherapy: lessons learned from the brain-derived neurotrophic factor/TrkB signal transduction pathway. Expert Opinion on Therapeutic Targets 11:12, 1611-1621
CrossRef50
Suguru Fukahori, Hirohisa Yano, Makoto Tsuneoka, Yoshiaki Tanaka, Minoru Yagi, Michihiko Kuwano, Tatsuro Tajiri, Tomoaki Taguchi, Masazumi Tsuneyoshi, Masamichi Kojiro. (2007) Immunohistochemical expressions of Cap43 and Mina53 proteins in neuroblastoma. Journal of Pediatric Surgery 42:11, 1831-1840
CrossRef51
V. Castel, E. Grau, R. Noguera, F. Martínez. (2007) Molecular biology of neuroblastoma. Clinical and Translational Oncology 9:8, 478-483
CrossRef52
Erdener Ozer, Oguz Altungoz, Mehtat Unlu, Nevim Aygun, Sait Tumer, Nur Olgun. (2007) Association of MYCN Amplification and 1p Deletion in Neuroblastomas with High Tumor Vascularity. Applied Immunohistochemistry & Molecular Morphology 15:2, 181-186
CrossRef53
John M Maris, Michael D Hogarty, Rochelle Bagatell, Susan L Cohn. (2007) Neuroblastoma. The Lancet 369:9579, 2106-2120
CrossRef54
André Oberthuer, Patrick Warnat, Yvonne Kahlert, Frank Westermann, Rüdiger Spitz, Benedikt Brors, Barbara Hero, Roland Eils, Manfred Schwab, Frank Berthold, Matthias Fischer. (2007) Classification of neuroblastoma patients by published gene-expression markers reveals a low sensitivity for unfavorable courses of MYCN non-amplified disease. Cancer Letters 250:2, 250-267
CrossRef55
Anders Edsjö, Linda Holmquist, Sven Påhlman. (2007) Neuroblastoma as an experimental model for neuronal differentiation and hypoxia-induced tumor cell dedifferentiation. Seminars in Cancer Biology 17:3, 248-256
CrossRef56
Masanobu Abe, Frank Westermann, Akira Nakagawara, Tsuyoshi Takato, Manfred Schwab, Toshikazu Ushijima. (2007) Marked and independent prognostic significance of the CpG island methylator phenotype in neuroblastomas. Cancer Letters 247:2, 253-258
CrossRef57
William M.W. Cheung, Patrick W.K. Chu, Yok L. Kwong. (2007) Effects of arsenic trioxide on the cellular proliferation, apoptosis and differentiation of human neuroblastoma cells. Cancer Letters 246:1-2, 122-128
CrossRef58
Z Li, J Zhang, Z Liu, C-W Woo, C J Thiele. (2007) Downregulation of Bim by brain-derived neurotrophic factor activation of TrkB protects neuroblastoma cells from paclitaxel but not etoposide or cisplatin-induced cell death. Cell Death and Differentiation 14:2, 318-326
CrossRef59
Susumu Ootsuka, Satoru Asami, Takae Sasaki, Yoshikazu Yoshida, Norimichi Nemoto, Hiroyuki Shichino, Motoaki Chin, Hideo Mugishima, Takashi Suzuki. (2007) Analyses of Novel Prognostic Factors in Neuroblastoma Patients. Biological & Pharmaceutical Bulletin 30:12, 2294-2299
CrossRef60
Yusuke Yamaguchi, Keiichi Tabata, Satoru Asami, Muneharu Miyake, Takashi Suzuki. (2007) A Novel Cyclophane Compound, CPPy, Facilitates NGF-Induced TrkA Signal Transduction and Induces Cell Differentiation in Neuroblastoma. Biological & Pharmaceutical Bulletin 30:4, 638-643
CrossRef61
J Zhang, W Yan, X Chen. (2006) p53 is required for nerve growth factor-mediated differentiation of PC12 cells via regulation of TrkA levels. Cell Death and Differentiation 13:12, 2118-2128
CrossRef62
Hiroyuki Shimada, Atsuko Nakagawa. (2006) Pathology of the Peripheral Neuroblastic Tumors. Laboratory Medicine 37:11, 684-689
CrossRef63
Alex Krüttgen, Imke Schneider, Joachim Weis. (2006) The Dark Side of the NGF Family: Neurotrophins in Neoplasias. Brain Pathology 16:4, 304-310
CrossRef64
S. Asgharzadeh, R. Pique-Regi, R. Sposto, H. Wang, Y. Yang, H. Shimada, K. Matthay, J. Buckley, A. Ortega, R. C. Seeger. (2006) Prognostic Significance of Gene Expression Profiles of Metastatic Neuroblastomas Lacking MYCN Gene Amplification. JNCI Journal of the National Cancer Institute 98:17, 1193-1203
CrossRef65
H Niizuma, Y Nakamura, T Ozaki, H Nakanishi, M Ohira, E Isogai, H Kageyama, M Imaizumi, A Nakagawara. (2006) Bcl-2 is a key regulator for the retinoic acid-induced apoptotic cell death in neuroblastoma. Oncogene 25:36, 5046-5055
CrossRef66
Y Ren, H M Chan, J Fan, Y Xie, Y X Chen, W Li, G P Jiang, Q Liu, A Meinhardt, P K H Tam. (2006) Inhibition of tumor growth and metastasis in vitro and in vivo by targeting macrophage migration inhibitory factor in human neuroblastoma. Oncogene 25:25, 3501-3508
CrossRef67
Nadia. Gabellini, V. Masola, S. Quartesan, B. Oselladore, C. Nobile, R. Michelucci, M. Curtarello, C. Parolin, G. Palù. (2006) Increased expression ofLGI1 gene triggers growth inhibition and apoptosis of neuroblastoma cells. Journal of Cellular Physiology 207:3, 711-721
CrossRef68
Takashi Ohta, Takao Watanabe, Yoichi Katayama, Jun Kurihara, Atsuo Yoshino, Hiroshi Nishimoto, Hiroshi Kishimoto. (2006) TrkA expression is associated with an elevated level of apoptosis in classic medulloblastomas. Neuropathology 26:3, 170-177
CrossRef69
Sunghoon Kim, Dai H. Chung. (2006) Pediatric Solid Malignancies: Neuroblastoma and Wilms' Tumor. Surgical Clinics of North America 86:2, 469-487
CrossRef70
T Machida, T Fujita, M L Ooo, M Ohira, E Isogai, M Mihara, J Hirato, D Tomotsune, T Hirata, M Fujimori, W Adachi, A Nakagawara. (2006) Increased expression of proapoptotic BMCC1, a novel gene with the BNIP2 and Cdc42GAP homology (BCH) domain, is associated with favorable prognosis in human neuroblastomas. Oncogene 25:13, 1931-1942
CrossRef71
Wen-Ming Hsu, Yung-Ming Jen, Hsinyu Lee, Min-Liang Kuo, Po-Nien Tsao, Chiung-Nien Chen, Dar-Ming Lai, Ming-Tsan Lin, Hong-Shiee Lai, Wei-Jao Chen, Fon-Jou Hsieh. (2006) The Influence of Biologic Factors on the Surgical Decision in Advanced Neuroblastoma. Annals of Surgical Oncology 13:2, 238-244
CrossRef72
John Matthew Maris. 2006. Neuroblastoma. .
CrossRef73
Vera van Limpt, Alvin Chan, Alexander Schramm, Angelika Eggert, Rogier Versteeg. (2005) Phox2B mutations and the Delta–Notch pathway in neuroblastoma. Cancer Letters 228:1-2, 59-63
CrossRef74
Shuqing Liu, Yufeng Tian, Alexandre Chlenski, Qiwei Yang, Helen R. Salwen, Susan L. Cohn. (2005) ‘Cross-talk’ between Schwannian stroma and neuroblasts promotes neuroblastoma tumor differentiation and inhibits angiogenesis. Cancer Letters 228:1-2, 125-131
CrossRef75
Alexander Schramm, Johannes H. Schulte, Kathy Astrahantseff, Ognjan Apostolov, Vera van Limpt, Hauke Sieverts, Steffi Kuhfittig-Kulle, Petra Pfeiffer, Rogier Versteeg, Angelika Eggert. (2005) Biological effects of TrkA and TrkB receptor signaling in neuroblastoma. Cancer Letters 228:1-2, 143-153
CrossRef76
Miki Ohira, Shigeyuki Oba, Yoko Nakamura, Takahiro Hirata, Shin Ishii, Akira Nakagawara. (2005) A review of DNA microarray analysis of human neuroblastomas. Cancer Letters 228:1-2, 5-11
CrossRef77
Junko Okabe-Kado, Takashi Kasukabe, Yoshio Honma, Ryoji Hanada, Akira Nakagawara, Yasuhiko Kaneko. (2005) Clinical significance of serum NM23-H1 protein in neuroblastoma. Cancer Science 96:10, 653-660
CrossRef78
Takeo Tanaka, Tomoko Iehara, Tohru Sugimoto, Minoru Hamasaki, Satoshi Teramukai, Yoshiaki Tsuchida, Michio Kaneko, Tadashi Sawada. (2005) Diversity in neuroblastomas and discrimination of the risk to progress. Cancer Letters 228:1-2, 267-270
CrossRef79
Nina Felice Schor. (2005) The p75 neurotrophin receptor in human development and disease. Progress in Neurobiology 77:3, 201-214
CrossRef80
Hiroyuki Shimada, Jeffrey Bonadio, Hideki Sano. (2005) Neuroblastoma and Related Tumors. Pathology Case Reviews 10:5, 252-256
CrossRef81
Yuko Osajima-Hakomori, Izumi Miyake, Miki Ohira, Akira Nakagawara, Atsuko Nakagawa, Ryuichi Sakai. (2005) Biological Role of Anaplastic Lymphoma Kinase in Neuroblastoma. The American Journal of Pathology 167:1, 213-222
CrossRef82
Miki Ohira, Shigeyuki Oba, Yohko Nakamura, Eriko Isogai, Setsuko Kaneko, Atsuko Nakagawa, Takahiro Hirata, Hiroyuki Kubo, Takeshi Goto, Saichi Yamada, Yasuko Yoshida, Misa Fuchioka, Shin Ishii, Akira Nakagawara. (2005) Expression profiling using a tumor-specific cDNA microarray predicts the prognosis of intermediate risk neuroblastomas. Cancer Cell 7:4, 337-350
CrossRef83
Jin-Young Ahn, Lami Kang, Hyun-Jeong Kim, Hyejin Kang, Sung-Hoon Kim, Je-Yong Kim, Seung Ki Kim, Kyu-Chang Wang, Byung Kyu Cho, Kwang-Woo Lee, Jae-Kyu Roh, Manho Kim. (2005) Induction method of tyrosine kinase A-mediated cell death in rat pheochromocytoma. Biotechnology Letters 27:8, 583-587
CrossRef84
Wen-Ming Hsu, Fon-Jou Hsieh, Yung-Ming Jeng, Min-Liang Kuo, Po-Nien Tsao, Hsinyu Lee, Ming-Tsan Lin, Hong-Shiee Lai, Chiung-Nien Chen, Dar-Ming Lai, Wei-Jao Chen. (2005) GRP78 expression correlates with histologic differentiation and favorable prognosis in neuroblastic tumors. International Journal of Cancer 113:6, 920-927
CrossRef85
W. Clay Gustafson, Brittany B. Berry, B. Mark Evers, Dai H. Chung. (2005) Role of Gastrointestinal Hormones in Neuroblastoma. World Journal of Surgery 29:3, 281-286
CrossRef86
John M Maris. (2005) The biologic basis for neuroblastoma heterogeneity and risk stratification. Current Opinion in Pediatrics 17:1, 7-13
CrossRef87
Rie Ito, Satoru Asami, Shigeyasu Motohashi, Susumu Ootsuka, Yusuke Yamaguchi, Motoaki Chin, Hiroyuki Shichino, Yukihiro Yoshida, Norimichi Nemoto, Hideo Mugishima, Takashi Suzuki. (2005) Significance of Survivin mRNA Expression in Prognosis of Neuroblastoma. Biological & Pharmaceutical Bulletin 28:4, 565-568
CrossRef88
Mignon L. Loh, Katherine K. Matthay. 2005. Congenital Malignant Disorders. , 1437-1470.
CrossRef89
Chiaki Kato, Kou Miyazaki, Atsuko Nakagawa, Miki Ohira, Yohko Nakamura, Toshinori Ozaki, Toshio Imai, Akira Nakagawara. (2004) Low expression of human tubulin tyrosine ligase and suppressed tubulin tyrosination/detyrosination cycle are associated with impaired neuronal differentiation in neuroblastomas with poor prognosis. International Journal of Cancer 112:3, 365-375
CrossRef90
A. Antonelli, A. Chiaretti, M. Piastra, E. Vigneti, L. Aloe. (2004) In vitro human ependymoblastoma cells differentiate after exposure to nerve growth factor. Journal of Neurocytology 33:5, 503-515
CrossRef91
S Hettmer, R McCarter, S Ladisch, K Kaucic. (2004) Alterations in neuroblastoma ganglioside synthesis by induction of GD1b synthase by retinoic acid. British Journal of Cancer
CrossRef92
Junko Takita, Masami Ishii, Shuichi Tsutsumi, Yukichi Tanaka, Keisuke Kato, Yasunori Toyoda, Ryoji Hanada, Keiko Yamamoto, Yasuhide Hayashi, Hiroyuki Aburatani. (2004) Gene expression profiling and identification of novel prognostic marker genes in neuroblastoma. Genes, Chromosomes and Cancer 40:2, 120-132
CrossRef93
Max M. van Noesel, Rogier Versteeg. (2004) Pediatric neuroblastomas: genetic and epigenetic ‘Danse Macabre’. Gene 325, 1-15
CrossRef94
Robert E Goldsby, Katherine K Matthay. (2004) Neuroblastoma. Pediatric Drugs 6:2, 107-122
CrossRef95
Rie Ito, Satoru Asami, Shigeki Kagawa, Shigeyasu Motohashi, Hiroyuki Shichino, Motoaki Chin, Yukihiro Yoshida, Norimichi Nemoto, Hideo Mugishima, Takashi Suzuki. (2004) Usefulness of Tyrosine Hydroxylase mRNA for Diagnosis and Detection of Minimal Residual Disease in Neuroblastoma. Biological & Pharmaceutical Bulletin 27:3, 315-318
CrossRef96
Keith L Lee, Jian F Ma, Linda D Shortliffe. (2003) Neuroblastoma: Management, recurrence, and follow-up. Urologic Clinics of North America 30:4, 881-890
CrossRef97
Patrick W. K. Chu, William M. W. Cheung, Yok L. Kwong. (2003) Differential effects of 9-cis, 13-cis and all-trans retinoic acids on the neuronal differentiation of human neuroblastoma cells. NeuroReport 14:15, 1935-1939
CrossRef98
Manfred Schwab, Frank Westermann, Barbara Hero, Frank Berthold. (2003) Neuroblastoma: biology and molecular and chromosomal pathology. The Lancet Oncology 4:8, 472-480
CrossRef99
John M. Maris, Robert P. Castleberry. (2003) Chemotherapy for Neuroblastoma: Is It All or None?. Journal of Pediatric Hematology/Oncology 25:7, 512-514
CrossRef100
Yohko Nakamura, Toshinori Ozaki, Haruhiko Koseki, Akira Nakagawara, Shigeru Sakiyama. (2003) Accumulation of p27KIP1 is associated with BMP2-induced growth arrest and neuronal differentiation of human neuroblastoma-derived cell lines. Biochemical and Biophysical Research Communications 307:1, 206-213
CrossRef101
Miki Ohira, Aiko Morohashi, Yohko Nakamura, Eriko Isogai, Kazushige Furuya, Shiho Hamano, Taiichi Machida, Mineyoshi Aoyama, Masayuki Fukumura, Kou Miyazaki, Yutaka Suzuki, Sumio Sugano, Junko Hirato, Akira Nakagawara. (2003) Neuroblastoma oligo-capping cDNA project: toward the understanding of the genesis and biology of neuroblastoma. Cancer Letters 197:1-2, 63-68
CrossRef102
Luisella Alberti, Cristiana Carniti, Claudia Miranda, Emanuela Roccato, Marco A. Pierotti. (2003) RET and NTRK1 proto-oncogenes in human diseases. Journal of Cellular Physiology 195:2, 168-186
CrossRef103
Jerry Jaboin, Audrey Hong, Chong Jai Kim, Carol J. Thiele. (2003) Cisplatin-induced cytotoxicity is blocked by brain-derived neurotrophic factor activation of TrkB signal transduction path in neuroblastoma. Cancer Letters 193:1, 109-114
CrossRef104
Shashi Wadhwa, Tapas C. Nag, Anupam Jindal, Rahul Kushwaha, Ashok K. Mahapatra, Chitra Sarkar. (2003) Expression of the neurotrophin receptors Trk A and Trk B in adult human astrocytoma and glioblastoma. Journal of Biosciences 28:2, 181-188
CrossRef105
Mahesh B. Lachyankar, Peter J. Condon, Marie-Claire Daou, Asit K. De, John B. Levine, Axel Obermeier, Alonzo H. Ross. (2003) Novel functional interactions between Trk kinase and p75 neurotrophin receptor in neuroblastoma cells. Journal of Neuroscience Research 71:2, 157-172
CrossRef106
Nobumoto Tomioka, Hirofumi Kobayashi, Hajime Kageyama, Miki Ohira, Yohko Nakamura, Fumiaki Sasaki, Satoru Todo, Akira Nakagawara, Yasuhiko Kaneko. (2003) Chromosomes that show partial loss or gain in near-diploid tumors coincide with chromosomes that show whole loss or gain in near-triploid tumors: Evidence suggesting the involvement of the same genes in the tumorigenesis of high- and low-risk neuroblastomas. Genes, Chromosomes and Cancer 36:2, 139-150
CrossRef107
Howard M Katzenstein. (2003) The Role of Angiogenesis in Neuroblastoma. American Journal of Cancer 2:4, 237-244
CrossRef108
Erol Ta??demiro??lu, ??nci Ayan, Roy A. Patchell. (2002) Dumbbell Neuroblastomas. Neurosurgery Quarterly 12:2, 142-159
CrossRef109
Sunghoon Kim, Wanqin Hu, David R. Kelly, Mark R. Hellmich, B. Mark Evers, Dai H. Chung. (2002) Gastrin-Releasing Peptide Is a Growth Factor for Human Neuroblastomas. Annals of Surgery 235:5, 621-630
CrossRef110
H Ikeda, T Iehara, Y Tsuchida, M Kaneko, J Hata, H Naito, M Iwafuchi, N Ohnuma, H Mugishima, Y Toyoda, M Hamazaki, J Mimaya, S Kondo, K Kawa, A Okada, E Hiyama, S Suita, H Takamatsu. (2002) Experience with International Neuroblastoma Staging System and Pathology Classification. British Journal of Cancer 86:7, 1110-1116
CrossRef111
Shoko Goto, Shunsuke Umehara, Robert B. Gerbing, Daniel O. Stram, Garrett M. Brodeur, Robert C. Seeger, John N. Lukens, Katherine K. Matthay, Hiroyuki Shimada. (2001) Histopathology (International Neuroblastoma Pathology Classification) and MYCN status in patients with peripheral neuroblastic tumors. Cancer 92:10, 2699-2708
CrossRef112
Akira Tanaka, Tomoko Kamiakito, Yoji Hakamata, Akiko Fujii, Ken Kuriki, Masashi Fukayama. (2001) Extensive neuronal localization and neurotrophic function of fibroblast growth factor 8 in the nervous system. Brain Research 912:2, 105-115
CrossRef113
Akira Nakagawara. (2001) Trk receptor tyrosine kinases: A bridge between cancer and neural development. Cancer Letters 169:2, 107-114
CrossRef114
Ninette Cohen, David R. Betts, Luba Trakhtenbrot, Felix K. Niggli, Ninette Amariglio, Frida Brok-Simoni, Gideon Rechavi, Dafna Meitar. (2001) Detection of unidentified chromosome abnormalities in human neuroblastoma by spectral karyotyping (SKY). Genes, Chromosomes and Cancer 31:3, 201-208
CrossRef115
Jörg Dötsch, Reinald Repp, Wolfgang Rascher, Holger Christiansen. (2001) Diagnostic and scientific applications of TaqMan real-time PCR in neuroblastomas. Expert Review of Molecular Diagnostics 1:2, 233-238
CrossRef116
Eckhard Bergmann, Michael Wanzel, Axel Weber, Inhee Shin, Holger Christiansen, Martin Eilers. (2001) Expression of P27KIP1 is prognostic and independent ofMYCN amplification in human neuroblastoma. International Journal of Cancer 95:3, 176-183
CrossRef117
Mineyoshi Aoyama, Kiyofumi Asai, Tomotane Shishikura, Takemasa Kawamoto, Taishi Miyachi, Takashi Yokoi, Hajime Togari, Yoshiro Wada, Taiji Kato, Akira Nakagawara. (2001) Human neuroblastomas with unfavorable biologies express high levels of brain-derived neurotrophic factor mRNA and a variety of its variants. Cancer Letters 164:1, 51-60
CrossRef118
Tohru Sugimoto, Hiroshi Kuroda, Yoshihiro Horii, Hiroshi Moritake, Takeo Tanaka, Seisuke Hattori. (2001) Signal Transduction Pathways through TRK-A and TRK-B Receptors in Human Neuroblastoma Cells. Cancer Science 92:2, 152-160
CrossRef119
Eiso Hiyama, Keiko Hiyama, Kazuhiro Ohtsu, Hiroaki Yamaoka, Ikuko Fukuba, Yuichiro Matsuura, Takashi Yokoyama. (2001) Biological characteristics of neuroblastoma with partial deletion in the short arm of chromosome 1. Medical and Pediatric Oncology 36:1, 67-74
CrossRef120
Shigno Ichimiya, Yoshinori Nimura, Naohiko Seki, Toshifumi Ozaki, Takahiro Nagase, Akira Nakagawara. (2001) Downregulation ofhASH1 is associated with the retinoic acid-induced differentiation of human neuroblastoma cell lines. Medical and Pediatric Oncology 36:1, 132-134
CrossRef121
Xao X. Tang, Audrey E. Evans, Huaqing Zhao, Avital Cnaan, Garrett M. Brodeur, Naohiko Ikegaki. (2001) Association amongEPHB2, TrkA, andMYCN expression in low-stage neuroblastomas. Medical and Pediatric Oncology 36:1, 80-82
CrossRef122
Masue Imaizumi, Arata Watanabe, Atsushi Kikuta, Toshikuni Takano, Etsuro Ito, Toshiyuki Shimizu, Shigeru Tsuchiya, Kazuie Iinuma, Tasuke Konno, Ryoji Ohi, Yutaka Hayashi, The Tohoku Neuroblastoma Study Grou. (2001) Improved Survival of Children with Advanced Neuroblastoma Treated by Intensified Therapy Including Myeloablative Chemotherapy with Stem Cell Transplantation: A Retrospective Analysis from the Tohoku Neuroblastoma Study Group.. The Tohoku Journal of Experimental Medicine 195:2, 73-83
CrossRef123
Angelika Eggert, Naohiko Ikegaki, Xing-ge Liu, Tom T. Chou, Garrett M. Brodeur. (2001) TrkA signal transduction pathways in neuroblastoma. Medical and Pediatric Oncology 36:1, 108-110
CrossRef124
Shingo Ichimiya, Yoshinori Nimura, Hajime Kageyama, Naoyuki Takada, Masao Sunahara, Tomotane Shishikura, Yohko Nakamura, Shigeru Sakiyama, Naohiko Seki, Miki Ohira, Yasuhiko Kaneko, Frank McKeon, Daniel Caput, Akira Nakagawara. (2001) Genetic analysis ofp73 localized at chromosome 1p36.3 in primary neuroblastomas. Medical and Pediatric Oncology 36:1, 42-44
CrossRef125
Shigeyuki Furuta, Miki Ohira, Taiichi Machida, Shiho Hamano, Akira Nakagawara. (2000) Analysis of loss of heterozygosity at 16p12-p13 (familial neuroblastoma locus) in 470 neuroblastomas including both sporadic and mass screening tumors. Medical and Pediatric Oncology 35:6, 531-533
CrossRef126
Angelika Eggert, Michael A. Grotzer, Naohiko Ikegaki, Xing-ge Liu, Audrey E. Evans, Garrett M. Brodeur. (2000) Expression of neurotrophin receptor TrkA inhibits angiogenesis in neuroblastoma. Medical and Pediatric Oncology 35:6, 569-572
CrossRef127
Angelika Eggert, Ruth Ho, Naohiko Ikegaki, Xing-ge Liu, Garrett M. Brodeur. (2000) Different effects of TrkA expression in neuroblastoma cell lines with or withoutMYCN amplification. Medical and Pediatric Oncology 35:6, 623-627
CrossRef128
Miki Ohira, Tomotane Shishikura, Takemasa Kawamoto, Hiroyuki Inuzuka, Aiko Morohashi, Hajime Takayasu, Hajime Kageyama, Naoyuki Takada, Masato Takahashi, Shigeru Sakiyama, Yutaka Suzuki, Sumio Sugano, Hidekazu Kuma, Iwao Nozawa, Akira Nakagawara. (2000) Hunting the subset-specific genes of neuroblastoma: Expression profiling and differential screening of the full-length-enriched oligo-capping cDNA libraries. Medical and Pediatric Oncology 35:6, 547-549
CrossRef129
Takemasa Kawamoto, Tomotane Shishikura, Miki Ohira, Hajime Takayasu, Aiko Morohashi, Naoyuki Takada, Masato Takahashi, Yutaka Suzuki, Sumio Sugano, Tomokatsu Hori, Akira Nakagawara. (2000) Association between favorable neuroblastoma and high expression of the novel metalloproteinase gene,nbla3145/XCE, cloned by differential screening of the full-length-enriched oligo-capping neuroblastoma cDNA libraries. Medical and Pediatric Oncology 35:6, 628-631
CrossRef130
Jay L Grosfeld. (2000) Risk-based management of solid tumors in children. The American Journal of Surgery 180:5, 322-327
CrossRef131
Frederick Alexander. (2000) NEUROBLASTOMA. Urologic Clinics of North America 27:3, 383-392
CrossRef132
P THIESSE, M HANY, V COMBARET, D RANCHEREVINCE, E BOUFFET, C BERGERON. (2000) Assessment of percutaneous fine needle aspiration cytology as a technique to provide diagnostic and prognostic information in neuroblastoma. European Journal of Cancer 36:12, 1544-1551
CrossRef133
Frank Berthold, Barbara Hero. (2000) Neuroblastoma. Drugs 59:6, 1261-1277
CrossRef134
Akane Shikata, Takuma Shikata, Yasuhiro Sotozono, Hajime Hosoi, Takafumi Matsumura, Tohru Sugimoto, Tadashi Sawada. (2000) Neuronal differentiation in human neuroblastoma cells by nerve growth factor following TrkA up-regulation by interferon-?. Medical and Pediatric Oncology 34:6, 394-401
CrossRef135
Carlos S. Alvarado, Wendy B. London, A. Thomas Look, Garrett M. Brodeur, Dale H Altmiller, Paul S. Thorner, Vijay V. Joshi, Susan T. Rowe, Michael B. Nash, E. Ide Smith, Robert P. Castleberry, Susan L. Cohn. (2000) Natural History and Biology of Stage A Neuroblastoma: A Pediatric Oncology Group Study. Journal of Pediatric Hematology/Oncology 22:3, 197-205
CrossRef136
Eiso Hiyama, Takashi Yokoyama, Keiko Hiyama, Hiroaki Yamaoka, Yuichiro Matsuura, Shin-ichiro Nishimura, Kazuhiro Ueda. (2000) Multifocal neuroblastoma. Cancer 88:8, 1955-1963
CrossRef137
Raquel Castellon, Bernard L. Mirkin. (2000) Retroviral transfer of the ?-nerve growth factor gene into murine neuroectodermal tumor cells modulates cell proliferation rate, neurite formation, and NGF binding site expression. Journal of Neuroscience Research 59:2, 265-275
CrossRef138
John N. Lukens. (1999) Neuroblastoma in the neonate. Seminars in Perinatology 23:4, 263-273
CrossRef139
Mohammed Akhtar, M. Anwar Iqbal, Walid Mourad, M. Ashraf Ali. (1999) Fine-needle aspiration biopsy diagnosis of small round cell tumors of childhood: A comprehensive approach. Diagnostic Cytopathology 21:2, 81-91
CrossRef140
Susan L. Cohn. (1999) Diagnosis and Classification of the Small Round-Cell Tumors of Childhood. The American Journal of Pathology 155:1, 11-15
CrossRef141
Misako Hirai, Sadao Yoshida, Hironobu Kashiwagi, Tomonori Kawamura, Tomoyoshi Ishikawa, Michio Kaneko, Haruo Ohkawa, Akira Nakagawara, Masanao Miwa, Kazuhiko Uchida. (1999) 1q23 gain is associated with progressive neuroblastoma resistant to aggressive treatment. Genes, Chromosomes and Cancer 25:3, 261-269
CrossRef142
R. J. Packer, P. Cogen, G. Vezina, L. B. Rorke. (1999) Medulloblastoma: Clinical and biologic aspects. Neuro-Oncology 1:3, 232-250
CrossRef143
Bown, Nick, Cotterill, Simon, Łastowska, Maria, O'Neill, Seamus, Pearson, Andrew D.J., Plantaz, Dominique, Meddeb, Mounira, Danglot, Gisele, Brinkschmidt, Christian, Christiansen, Holger, Laureys, Genevieve, Nicholson, James, Bernheim, Alain, Betts, David R., Vandesompele, Jo, Van Roy, Nadine, Speleman, Frank, . (1999) Gain of Chromosome Arm 17q and Adverse Outcome in Patients with Neuroblastoma. New England Journal of Medicine 340:25, 1954-1961
Full Text144
Mark R. Iantosca, Clifton E. McPherson, Shih-Yieh Ho, Gerald D. Maxwell. (1999) Bone morphogenetic proteins-2 and -4 attenuate apoptosis in a cerebellar primitive neuroectodermal tumor cell line. Journal of Neuroscience Research 56:3, 248-258
CrossRef145
Gerald M. Haase, Carlos Perez, James B. Atkinson. (1999) Current aspects of biology, risk assessment, and treatment of neuroblastoma. Seminars in Surgical Oncology 16:2, 91-104
CrossRef146
Pello, Guate, Naves, Escaf, Vega. (1999) Neurotrophins and neurotrophin receptors in some neural crest-derived tumours (ganglioneuroma, phaeochromocytoma and paraganglioma). Histopathology 34:3, 216-225
CrossRef147
Yasuhiko Kaneko, Hirofumi Kobayashi, Nobuo Maseki, Akira Nakagawara, Masaharu Sakurai. (1999) Disomy 1 with terminal 1 p deletion is frequent in mass-screening-negative/late-presenting neuroblastomas in young children, but not in mass-screening-positive neuroblastomas in infants. International Journal of Cancer 80:1, 54-59
CrossRef148
Masae Sakakibara, Shoichi Koizumi, Yutaka Saikawa, Hideo Wada, Tsuyoshi Ichihara, Hiroshi Sato, Seiki Horita, Hideo Mugishima, Yasuhiko Kaneko, Kenichi Koike. (1999) Membrane-type matrix metalloproteinase-1 expression and activation of gelatinase A as prognostic markers in advanced pediatric neuroblastoma. Cancer 85:1, 231-239
CrossRef149
Shunji Nishio, Yasuhiro Hamada, Akira Nakagawara, Sei Haga, Satoshi Suzuki1 and Masashi Fukui. (1999) Thoracic paravertebral ganglioneuroma with high immunohistochemical expression of TrkA. Neuropathology 19:1, 51-56
CrossRef150
Yoshihiro Horii, Hiroshi Kuroda, Tohru Sugimoto. (1998) Frequent detection of TrkA expression in human neuroblastoma cell lines. Pediatrics International 40:6, 644-646
CrossRef151
Tadashi Matsunaga, Hiroshi Shirasawa, Tomoro Hishiki, Hideki Enomoto, Katsunori Kouchi, Yasuhiro Ohtsuka, Jun Iwai, Hideo Yoshida, Masahiro Tanabe, Susumu Kobayashi, Takehide Asano, Takao Etoh, Yoshisuke Nishi, Naomi Ohnuma. (1998) Expression of MRP and cMOAT in Childhood Neuroblastomas and Malignant Liver Tumors and Its Relevance to Clinical Behavior. Cancer Science 89:12, 1276-1283
CrossRef152
Jacques Estève, Pascal Roy, Frank Chauvin, Thierry Philip. (1998) Screening for neuroblastoma in children: elements for a statistical evaluation. Medical and Pediatric Oncology 31:5, 401-407
CrossRef153
Takeo Tanaka, Tohru Sugimoto, Tadashi Sawada. (1998) Prognostic discrimination among neuroblastomas according to ha-ras/trk A gene expression. Cancer 83:8, 1626-1633
CrossRef154
Sanjay Shah, Y. Ravindranath. (1998) Neuroblastoma. The Indian Journal of Pediatrics 65:5, 691-705
CrossRef155
William G Woods. (1998) Unravelling mysteries of neuroblastoma. The Lancet 352:9129, 667
CrossRef156
Akira Nakagawara. (1998) Topical Topic: The NGF story and neuroblastoma. Medical and Pediatric Oncology 31:2, 113-115
CrossRef157
Michio Kaneko, Hirokazu Nishihira, Hideo Mugishima, Naomi Ohnuma, Koonosuke Nakada, Keisei Kawa, Masahiro Fukuzawa, Sachiyo Suita, Yoshihisa Sera, Yoshiaki Tsuchida. (1998) Stratification of treatment of stage 4 neuroblastoma patients based on N-myc amplification status. Medical and Pediatric Oncology 31:1, 1-7
CrossRef158
Tadashi Matsunaga, Hiroshi Shirasawa, Hideki Enomoto, Hideo Yoshida, Jun Iwai, Masahiro Tanabe, Kenji Kawamura, Takao Etoh, Naomi Ohnuma. (1998) Neuronalsrc andtrk A protooncogene expression in neuroblastomas and patient prognosis. International Journal of Cancer 79:3, 226-231
CrossRef159
Lisa B. Kenney, Barry A. Miller, Lynn A. Gloeckler Ries, H. Stacy Nicholson, Julianne Byrne, Gregory H. Reaman. (1998) Increased incidence of cancer in infants in the U.
CrossRef160
T SVENSSON, M RYDEN, F SCHILLING, C DOMINICI, R SEHGAL, C IBANEZ, P KOGNER. (1997) Coexpression of mRNA for the full-length neurotrophin receptor trk-C and trk-A in favourable neuroblastoma. European Journal of Cancer 33:12, 2058-2063
CrossRef161
E LUCARELLI, D KAPLAN, C THIELE. (1997) Activation of trk-A but not trk-B signal transduction pathway inhibits growth of Neuroblastoma cells. European Journal of Cancer 33:12, 2068-2070
CrossRef162
E HIYAMA, K HIYAMA, K OHTSU, H YAMAOKA, T ICHIKAWA, J SHAY, T YOKOYAMA. (1997) Telomerase activity in neuroblastoma: is it a prognostic indicator of clinical behaviour?. European Journal of Cancer 33:12, 1932-1936
CrossRef163
K KRAMER, N CHEUNG, W GERALD, M LAQUAGLIA, B KUSHNER, J LECLERC, L LESAUTER, H SARAGOVI. (1997) Correlation of MYCN amplification, Trk-A and CD44 expression with clinical stage in 250 patients with neuroblastoma. European Journal of Cancer 33:12, 2098-2100
CrossRef164
K KRAMER, W GERALD, L LESAUTEUR, H SARAGOVI, N CHEUNG. (1997) Monoclonal antibody to human trk-A: diagnostic and therapeutic potential in neuroblastoma. European Journal of Cancer 33:12, 2090-2091
CrossRef165
D YAMASHIRO, X LIU, C LEE, A NAKAGAWARA, N IKEGAKI, L MCGREGOR, S BAYLIN, G BRODEUR. (1997) Expression and function of Trk-C in favourable human neuroblastomas. European Journal of Cancer 33:12, 2054-2057
CrossRef166
VIJAY V. JOSHI, GREGORY J. TSONGALIS. (1997) Correlation between Morphologic and Nonmorphologic Prognostic Markers of Neuroblastoma. Annals of the New York Academy of Sciences 824:1 Challenges an, 71-83
CrossRef167
Tomohiro Saito, Yukiko Tsunematsu, Morihiro Saeki, Toshiro Honna, Eiichi Masaki, Yoko Kojima, Jun Miyauchi. (1997) Trends of survival in neuroblastoma and independent risk factors for survival at a single institution. Medical and Pediatric Oncology 29:3, 197-205
CrossRef168
Reinaldo Manhani, Lilian Maria Cristofani, Vicente Filho, Israel Bendit. (1997) Concomitant p53 mutation and MYCN amplification in neuroblastoma. Medical and Pediatric Oncology 29:3, 206-207
CrossRef169
Anna Marie Camoratto, Jitesh P. Jani, Thelma S. Angeles, Anna C. Maroney, Christa Y. Sanders, Chikara Murakata, Nicola T. Neff, Jeffry L. Vaught, John T. Isaacs, Craig A. Dionne. (1997) CEP-751 inhibits trk receptor tyrosine kinase activityin vitro and exhibits anti-tumor activity. International Journal of Cancer 72:4, 673-679
CrossRef170
Janet Cowan, Yogeshwar Dayal, Stephen Schwaitzberg, Arthur Tischler. (1997) American Journal of Surgical Pathology 21:8, 957-963
CrossRef171
Patricia de Cremoux, Martine Thioux, Martine Peter, Philippe Vielh, Jean Michon, Olivier Delattre, Henri Magdelenat. (1997) Polymerase chain reaction compared with dot blotting for the determination of N-myc gene amplification in neuroblastoma. International Journal of Cancer 72:3, 518-521
CrossRef172
Melanie A. Comito, Van H. Savell, Michael B. Cohen. (1997) CD44 Expression in Neuroblastoma and Related Tumors. Journal of Pediatric Hematology/Oncology 19:4, 292-296
CrossRef173
Jun-ichi Satoh, Motohiro Yukitake, Kazuhiro Kurohara, Yasuo Kuroda. (1997) Retinoic acid-induced neuronal differentiation regulates expression of mRNAs for neurotrophins and neurotrophin receptors in a human embryonal carcinoma cell line NTera2. Neuropathology 17:2, 80-88
CrossRef174
Moritz M. Ziegler, Hiroyuki Ishizu, Eisuke Nagabuchi, Naoyuki Takada, Gajra Arya. (1997) A comparative review of the immunobiology of murine neuroblastoma and human neuroblastoma. Cancer 79:9, 1757-1766
CrossRef175
Thomas A. Seemayer, James L. Harper, Derek Shickell, Thomas G. Gross. (1997) Cytodifferentiation of a Wilms' tumor pulmonary metastasis. Cancer 79:8, 1629-1634
CrossRef176
David R Kaplan, Freda D Miller. (1997) Signal transduction by the neutrophin receptors. Current Opinion in Cell Biology 9:2, 213-221
CrossRef177
Lucy Balian Rorke, John Q. Trojanowski, Virginia MY Lee, Robert A. Zimmerman, Leslie N. Sutton, Jaclyn A. Biegel, Joel W. Goldwein, Roger J. Packer. (1997) Primitive Neuroectodermal Tumors of the Central Nervous System. Brain Pathology 7:2, 765-784
CrossRef178
C. M. Kullendorff, L. G. Strömblad. (1997) Spontaneous regression of intraspinal neuroblastoma. Pediatric Surgery International 12:4, 305-307
CrossRef179
Garrett M. Brodeur, John M. Maris, Darrell J. Yamashiro, Michael D. Hogarty, Peter S. White. (1997) Biology and Genetics of Human Neuroblastomas. Journal of Pediatric Hematology/Oncology 19:2, 93-101
CrossRef180
Albert A. Geldof, Mariska A. T. Kleijn, B. Ramanath Rao, W. W. Newling. (1997) Nerve growth factor stimulates in vitro invasive capacity of DU145 human prostatic cancer cells. Journal of Cancer Research and Clinical Oncology 123:2, 107-112
CrossRef181
Enrique Nogueira, Samuel Navarro, Antonio Pellín, Antonio Llombart-Bosch. (1997) Activation of TRK Genes in Ewingʼs Sarcoma Trk A Receptor Expression Linked to Neural Differentiation. Diagnostic Molecular Pathology 6:1, 10-16
CrossRef182
Rose J. Papac. (1996) Spontaneous regression of cancer. Cancer Treatment Reviews 22:6, 395-423
CrossRef183
Lynne LeSauteur, Nai-Kong V. Cheung, Robert Lisbona, H. Uri Saragovl. (1996) Small molecule nerve growth factor analogs image receptors in vivo. Nature Biotechnology 14:9, 1120-1123
CrossRef184
A Craft. (1996) Screening for neuroblastoma: 20 years and still no answer. European Journal of Cancer 32:9, 1540-1543
CrossRef185
Liliana C. Goumnerova. (1996) Growth factor receptors and medulloblastoma. Journal of Neuro-Oncology 29:1, 85-89
CrossRef186
Brodeur, Garrett M., . (1996) Schwann Cells as Antineuroblastoma Agents. New England Journal of Medicine 334:23, 1537-1539
Full Text187
Aurel Lupulescu. (1996) The role of hormones, growth factors and vitamins in carcinogenesis. Critical Reviews in Oncology/Hematology 23:2, 95-130
CrossRef188
H Chan. (1996) Diagnosis and reversal of multidrug resistance in paediatric cancers. European Journal of Cancer 32:6, 1051-1061
CrossRef189
Jeanette Ridge, Douglas A. Terle, Evgenia Dragunsky, Inessa Levenbook. (1996) Effects of γ-IFN and NGF on subpopulations in a human neuroblastoma cell line: Flow cytometric and morphological analysis. In Vitro Cellular & Developmental Biology - Animal 32:4, 238-248
CrossRef190
Reinhold Kerbl, Christian E. Urban, Herwig Lackner, Gerald Höfler, Inge M. Ambros, Manfred Ratschek, Peter F. Ambros. (1996) Connatal localized neuroblastoma: The case to delay treatment. Cancer 77:7, 1395-1401
CrossRef191
K. R. E. Pohl, J. Pritchard, J. Wilson. (1996) Neurological sequelae of the dancing eye syndrome. European Journal of Pediatrics 155:3, 237-244
CrossRef192
AIDAN P. McMANUS, BARRY A. GUSTERSON, C. ROSS PINKERTON, JANET M. SHIPLEY. (1996) REVIEW ARTICLE. THE MOLECULAR PATHOLOGY OF SMALL ROUND-CELL TUMOURS—RELEVANCE TO DIAGNOSIS, PROGNOSIS, AND CLASSIFICATION. The Journal of Pathology 178:2, 116-121
CrossRef193
Norris, Murray D., Bordow, Sharon B., Marshall, Glenn M., Haber, Paul S., Cohn, Susan L., Haber, Michelle, . (1996) Expression of the Gene for Multidrug-Resistance–Associated Protein and Outcome in Patients with Neuroblastoma. New England Journal of Medicine 334:4, 231-238
Full Text194
Amos Toren, Mathilda Mandel, Justeen Passwell, Miriam Biniaminov, Yoram Neumann, Eester Rosenthal, George Kende, Gili Kende, Frida Brok-Simoni. (1996) Lack of N-MYC-Amplification and Normal Karyotype in Stage IV-N Neuroblastoma. Acta Oncologica 35:4, 496-498
CrossRef195
Mark R. Powis, S.J. Keith Holmes. (1995) Paediatric surgical oncology. European Journal of Surgical Oncology (EJSO) 21:6, 669-678
CrossRef196
Takeo Tanaka, Eiso Hiyama, Tohru Sugimoto, Tadashi Sawada, Masahiro Tanabe, Noriaki Ida. (1995) trk A Gene expression in neuroblastoma. The clinical significance of an immunohistochemical study. Cancer 76:6, 1086-1095
CrossRef197
Julie Blatt, Mary J. Gula, Salvatore J. Orlando, Laura S. Finn, Dhirendra N. Misra, Paul S. Dickman. (1995) Indolent course of advanced neuroblastoma in children older than 6 years at diagnosis. Cancer 76:5, 890-894
CrossRef198
Alfonso Bellacosa, Daniela De Feo, Andrew K. Godwin, Daphne W. Bell, Jin Quan Cheng, Deborah A. Altomare, Minghong Wan, Louis Dubeau, Giovanni Scambia, Valeria Masciullo, Gabriella Ferrandina, Pierluigi Benedetti Panici, Salvatore Mancuso, Giovanni Neri, Joseph R. Testa. (1995) Molecular alterations of theAKT2 oncogene in ovarian and breast carcinomas. International Journal of Cancer 64:4, 280-285
CrossRef199
Howard L. Weiner. (1995) The Role of Growth Factor Receptors in Central Nervous System Development and Neoplasia. Neurosurgery 37:2, 179???194
CrossRef200
Howard L. Weiner. (1995) The Role of Growth Factor Receptors in Central Nervous System Development and Neoplasia. Neurosurgery 37:2, 179-194
CrossRef201
Jeff C. Hoehner, Fredrik Hedborg, Helena Jernberg Wiklund, Leif Olsen, Sven Påhlman. (1995) Cellular death in neuroblastoma:in situ correlation of apoptosis and bcl-2 expression. International Journal of Cancer 62:1, 19-24
CrossRef202
Valérie Combaret, Claude Turc-Carel, Philippe Thiesse, Anne-Catherine Rebillard, Didier Frappaz, Odile Haus, Thierry Philip, Marie C. Favrot. (1995) Sensitive detection of numerical and structural aberrations of chromosome 1 in neuroblastoma by interphase fluorescencein situ hybridization. comparison with restriction fragment length polymorphism and conventional cytogenetic analyses. International Journal of Cancer 61:2, 185-191
CrossRef203
TAKEO TANAKA, MASAHIRO TANABE, TOHRU SUGIMOTO, NORIAKI IDA, TADASHI SAWADA. (1995) Age-related profile of neuroblastoma: A comparison of tumors detected by mass-screening with those detected clinically. Pediatrics International 37:2, 154-159
CrossRef204
Garrett M. Brodeur. (1995) Do the ends justify the means?. Nature Medicine 1:3, 203-205
CrossRef205
Franz Hefti. (1994) Neurotrophic factor therapy for nervous system degenerative diseases. Journal of Neurobiology 25:11, 1418-1435
CrossRef206
John N. Lukens. (1994) Progress resulting from clinical trials: Solid tumors in childhood cancer. Cancer 74:S9, 2710-2718
CrossRef207
Thomas D. Miale, Komal Kirpekar. (1994) Neuroblastoma stage Iv-S. Medical Oncology 11:3-4, 89-100
CrossRef208
Willemina M Molenaar, John Q. Trojanowski. (1994) Primitive neuroectodermal tumors of the central nervous system in childhood: tumor biological aspects. Critical Reviews in Oncology/Hematology 17:1, 1-25
CrossRef209
Osamu Takeda, Chieko Homma, Nobuo Maseki, Masaharu Sakurai, Naotoshi Kanda, Manfred Schwab, Yusuke Nakamura, Yasuhiko Kaneko. (1994) There may be two tumor suppressor genes on chromosome arm Ip closely associated with biologically distinct subtypes of neuroblastoma. Genes, Chromosomes and Cancer 10:1, 30-39
CrossRef210
Timothy Weiner, William G. Cance. (1994) Molecular mechanisms involved in tumorigenesis and their surgical implications. The American Journal of Surgery 167:4, 428-434
CrossRef211
Pramila Ramani, Qi-Long Lu. (1994) Expression ofbcl-2 gene product in neuroblastoma. The Journal of Pathology 172:3, 273-278
CrossRef212
Akane Shikata, Tohru Sugimoto, Hajime Hosoi, Yasuhiro Sotozono, Takuma Shikata, Tadashi Sawada, Luis F. Parada. (1994) Increased Expression of trk Proto-oncogene by gamma-Interferon in Human Neuroblastoma Cell Lines. Cancer Science 85:2, 122-126
CrossRef213
Hiroyuki Iwata, Takahiro Ito, Tatsuro Mutoh, Yukio Ishiguro, Hengyi Xiao, Michinari Hamaguchi. (1994) Abundant but Inactive-state gpl40prototrk Is Expressed in Neuroblastomas of Patients with Good Prognosis. Cancer Science 85:1, 32-39
CrossRef
