Original Article
Familial Hyperglycemia Due to Mutations in Glucokinase -- Definition of a Subtype of Diabetes Mellitus
N Engl J Med 1993; 328:697-702March 11, 1993
- Abstract
Background and Methods
Non-insulin-dependent diabetes mellitus (NIDDM) is a genetically heterogeneous disorder. Maturity-onset diabetes of the young, a form of NIDDM with an early age of onset and autosomal dominant inheritance, can result from mutations in glucokinase, a key enzyme of glucose metabolism in beta cells and the liver. We studied 32 French families with maturity-onset diabetes of the young as well as 21 families with late-onset NIDDM to determine the frequency and clinical features of mutations of glucokinase. Fasting plasma glucose concentrations and oral glucose-tolerance tests were used to determine metabolic status. DNA was isolated from lymphocytes, and DNA polymorphisms in the glucokinase gene were tested for linkage with diabetes. Individual exons of the glucokinase gene from one affected member in each family were amplified by the polymerase chain reaction and screened for mutations by analysis of the conformation-dependent polymorphisms of single-stranded DNA and by DNA sequencing.
Results
We found substantial evidence of linkage between the glucokinase locus and maturity-onset diabetes of the young but not between this locus and late-onset NIDDM. Sixteen mutations were identified in 18 of the 32 families with maturity-onset diabetes of the young, but none were found in families with late-onset NIDDM. They included 10 mutations that resulted in an amino acid substitution, 3 that resulted in the synthesis of a truncated protein, and 3 that affected RNA processing. The affected subjects with glucokinase mutations usually had mild hyperglycemia that began during childhood, whereas in subjects with maturity-onset diabetes of the young not due to glucokinase mutations, hyperglycemia usually appeared after puberty.
Conclusions
Mutations in glucokinase are the primary cause of hyperglycemia in a substantial fraction of French patients with maturity-onset diabetes of the young and result in a relatively mild form of NIDDM that can be diagnosed in childhood.
Media in This Article
Figure 1
Allele-Specific Amplification of the Glu-to-Gln Mutation at Codon 300 in 13 Members of the Third Generation of Family F51.Figure 2
Cosegregation of the Glu-to-Gln Mutation at Codon 300 in the Glucokinase Gene with the Gene for Maturity-Onset Diabetes of the Young (MODY) in Family F51.Article Activity
- Article
Non-insulin-dependent diabetes mellitus (NIDDM) is a heterogeneous disorder of glucose homeostasis characterized by defects in the secretion and action of insulin. The familial aggregation of NIDDM and high concordance rate in identical twins indicate the important contribution of heredity to its development1. Recent genetic studies of families with maturity-onset diabetes of the young, a form of NIDDM characterized by an age at onset of less than 25 years and autosomal dominant inheritance, have localized diabetes-susceptibility genes to chromosomes 7 and 202-4. Although the identity of the gene on chromosome 20 is not known, mutations in the glucokinase gene on chromosome 7 have been identified and shown to be the cause of diabetes in four French families5,6.
The glycolytic enzyme glucokinase is expressed only in liver and pancreatic beta cells and has a key role in the regulation of glucose homeostasis. In hepatocytes, the phosphorylation of glucose by glucokinase facilitates the uptake and metabolism of glucose by maintaining a gradient for glucose transport into these cells. In pancreatic beta cells, glucokinase appears to make up part of the glucose-sensing mechanism and to be involved in the regulation of insulin secretion7-9.
The aim of this study was to determine the contribution of mutations in the glucokinase gene to the development of NIDDM and the frequency of mutations in the glucokinase gene in patients with maturity-onset diabetes of the young as compared with that in patients with late-onset NIDDM. Molecular genetic and clinical studies were performed in 53 French families in which familial transmission of diabetes was strong, including 32 families with maturity-onset diabetes of the young and 21 families with late-onset NIDDM. We looked for linkage between polymorphisms in the glucokinase gene and NIDDM and screened the glucokinase gene for mutations in one affected member from each family.
Methods
Families
Information on family history and clinical data were obtained from 801 members of 53 white French families with NIDDM,10 in which at least two subjects in consecutive generations had been given a diagnosis of diabetes mellitus based on criteria from the World Health Organization11. These included 32 families with maturity-onset diabetes of the young, defined as NIDDM that developed before the age of 25 years and was inherited in an autosomal dominant fashion in at least two family members,12 and 21 families with late-onset NIDDM, in which the transmission of diabetes was consistent with an autosomal dominant mode of inheritance. Fasting plasma glucose concentrations were measured in all subjects. In addition, 65 percent of the affected members of both groups who did not have overt diabetes underwent oral glucose-tolerance testing. For the purposes of the linkage analysis, 220 of the 551 subjects with maturity-onset diabetes of the young and 115 of the 250 subjects with late-onset NIDDM were considered to be affected. These included subjects with overt NIDDM and subjects with impaired glucose tolerance,11 as well as subjects with mild fasting hyperglycemia, which was defined as a fasting plasma glucose concentration between 110 and 140 mg per deciliter (between 6.1 and 7.8 mmol per liter) on two separate occasions and a plasma glucose concentration of less than 140 mg per deciliter two hours after the oral administration of glucose during a glucose-tolerance test. A fasting plasma glucose concentration of more than 110 mg per deciliter represents a value 2 SD above the mean normal value for the French population13. Clinical data were obtained for each subject during a standardized clinical examination performed at the Endocrinology Service of Hopital Saint-Louis or by the subject's personal physician.
Molecular Studies
DNA was prepared from peripheral-blood lymphocytes14. The genotypes of the subjects were established with use of the polymerase chain reaction (PCR) to detect the two previously described DNA polymorphisms in the glucokinase gene,3 as well as a third recently identified five-allele DNA polymorphism (GCK3) located approximately 4.3 kb upstream of exon 1a. GCK3 was detected with primers 5'GGTTATGTAGCATCAGGATG3' and 5'TCTCTCTGTCTCTGTGAGTC3'; the PCR product was 280 base pairs (bp). The AluVpA/PstI haplotypes in the adenosine deaminase gene, a marker for the diabetes-susceptibility gene on chromosome 20, were determined as described previously2,3.
Molecular scanning for mutations in the glucokinase gene was done by PCR amplification of genomic DNA followed by analysis of the conformation-dependent polymorphisms of single-stranded DNA or direct sequencing of the PCR product15,16. The amplified PCR products were sequenced with an Applied Biosystems DNA sequencer (model 373A, Foster City, Calif.) and a dideoxy-cycle-sequencing protocol in the presence of the specific primers6 together with fluorescent-labeled dideoxy terminators or after cloning into the HincII site of M13mp18 DNA17.
Specific amplification18 of normal and mutant alleles of the mutation in exon 8 in which glutamine is substituted for glutamic acid at codon 300 was performed with primers hGK8b6 (5'CTGAGATCCGGCATGTCTTG3') and F51-8-E (5'AGGTGGCAAGTACATGGGCG3') for the normal allele or with primer F51-8-Q (5'AGGTGGCAAGTACATGGGCC3') for the mutant allele. Exon 7 was amplified with exon 8 as an internal control. The PCR conditions consisted of denaturation at 94 °C for 5 minutes, followed by 35 cycles of denaturation at 94 °C for 1 minute, annealing and extension at 65 °C for 2 minutes, and a final 10 minutes of extension at 65 °C. The PCR products were separated by electrophoresis on 3 percent NuSieve agarose gel (FMC Bioproducts, Rockland, Me.).
Linkage Analyses
Linkage analyses were performed with the LINKAGE package of computer programs19. In analyzing families with maturity-onset diabetes of the young, we assumed an autosomal dominant model3. In analyzing families with late-onset NIDDM, we tested two models. The first was an autosomal dominant model with equal penetrance for susceptible heterozygotes and homozygotes, and the second was an intermediate model with different levels of penetrance for susceptible heterozygotes and homozygotes. For both models, we assumed three classes of penetrance related to age and body-mass index (the weight in kilograms divided by the square of the height in meters), a population prevalence for the disease gene of 1 percent, and a penetrance in the normal homozygotes of 1 percent. The liability classes and levels of penetrance used are summarized in Table 1Table 1
Models Used in Linkage Analyses in Families with Late-Onset NIDDM to Determine Penetrance, According to the Age at Onset and Body-Mass Index. 20.Statistical Analysis
The results are expressed as means ±SD. The statistical significance of the differences between groups was assessed with the Mann-Whitney U test (two-tailed) for nonparametric results and contingency-table chi-square analysis.
Results
Linkage Analyses in Diabetic Families
The analysis of linkage between DNA polymorphisms in the glucokinase gene and diabetes in the 32 families with maturity-onset diabetes of the young indicated odds of more than 1023:1 in favor of linkage (lod score, 23.9). However, analysis of the heterogeneity of linkage between maturity-onset diabetes of the young and the glucokinase gene with the computer program HOMOG21 showed relative odds in favor of genetic heterogeneity of 1.2 × 108 (P<0.001) and indicated that the disorder was linked to the glucokinase gene in only about 60 percent of the families (range, 35 to 80 percent). Because of the small size of most of the families studied, the linkage results provided formal evidence of linkage (i.e., a lod score exceeding 3.0, or odds in favor of linkage of more than 1000:1) between maturity-onset diabetes of the young and the glucokinase gene in only three families (F8, F51, and F393). The linkage studies also excluded glucokinase as the cause of maturity-onset diabetes of the young in four families (F30, F159, F213, and F257); in other words, the lod score was less than -2 or the odds against linkage exceeded 100:1 in each of these families. The 32 families with maturity-onset diabetes of the young were also tested for linkage between diabetes and DNA polymorphisms in the adenosine deaminase gene, which is a marker2 for the diabetes-susceptibility gene on chromosome 20; no evidence of linkage was found in any family. Moreover, this analysis excluded the diabetes-susceptibility gene on chromosome 20 as the probable cause of diabetes in three families (F159, F213, and F257). These linkage studies demonstrate that maturity-onset diabetes of the young is genetically heterogeneous and suggest that mutations in the glucokinase gene may be the primary cause of NIDDM in about 60 percent of families with this form of diabetes mellitus.
Analysis of linkage between the glucokinase gene and diabetes in the 21 families with late-onset NIDDM gave an overall lod score of -7.73 at a recombination fraction of 0.00, providing no evidence of linkage between the glucokinase locus and NIDDM in these families. No family had a positive lod score. These results were insensitive to changes in the genetic models.
Identification of Mutations in the Glucokinase Gene
Each of the 12 exons of the glucokinase gene6 in one diabetic member from each of the 32 families with maturity-onset diabetes of the young and from each of the 21 families with late-onset NIDDM was amplified by PCR and screened for mutations by analysis of the conformation-dependent polymorphisms of single-stranded DNA16. Whenever an abnormal pattern of polymorphisms was noted, that exon was sequenced to identify the DNA substitution responsible for the abnormal pattern, and the segregation of the mutation with diabetes was studied in other family members. The mutations identified in the glucokinase gene associated with NIDDM are shown in Table 2Table 2
Characterization of the Mutations and Polymorphisms in the Glucokinase Gene in Families with Maturity-Onset Diabetes of the Young.. They include missense mutations that result in the synthesis of a glucokinase molecule with a different amino acid sequence, nonsense mutations that result in the expression of a truncated molecule, and splicing mutations that alter the processing of glucokinase messenger RNA. In addition to these mutations, DNA substitutions that did not cosegregate with NIDDM and that therefore represent polymorphisms or rare variants were also found. The mutations listed in Table 2 were present in all affected members of the family and were not found in any unaffected members or in at least 40 unrelated normal subjects, implying that they were the cause of the diabetes. By contrast, the polymorphisms and variants listed in Table 2 occurred in both affected and unaffected subjects.Mutations in the glucokinase gene were detected in 18 of the 32 families (56 percent) with maturity-onset diabetes of the young. In the 14 families in which we did not find a mutation, the lod scores were negative, suggesting that NIDDM in these families was not due to unidentified mutations in the glucokinase gene. By contrast, studies of the glucokinase gene in the 21 families with late-onset NIDDM showed an abnormality in only 1 (F15). This was a substitution of thymidine for cytosine (C to T) 12 bp upstream from the intron 1c splice acceptor site and was present in only two of the five affected subjects. This nucleotide substitution was also found in 1 of 121 unrelated subjects with late-onset NIDDM, but in none of 55 unrelated normal subjects.
Mutations in Glucokinase Causing Diabetes Mellitus
The presence of mutations in the glucokinase gene in patients with maturity-onset diabetes of the young suggested that the mutations were the direct cause of this disorder. We addressed this issue in Family F51 by testing all available subjects for the presence of the Glu300-to-Gln mutation, using allele-specific amplification18 (Figure 1Figure 1
Allele-Specific Amplification of the Glu-to-Gln Mutation at Codon 300 in 13 Members of the Third Generation of Family F51. and Figure 2Figure 2Cosegregation of the Glu-to-Gln Mutation at Codon 300 in the Glucokinase Gene with the Gene for Maturity-Onset Diabetes of the Young (MODY) in Family F51.). This mutation was present in each of the 41 subjects with hyperglycemia and in none of their normal relatives. The lod score for linkage between the Glu300-to-Gln mutation and NIDDM was 14.1 (i.e., odds in favor of linkage of more than 1014:1) at a recombination fraction of 0.00, indicating that this mutation was the cause of glucose intolerance in this family. We tested 23 members of Family F51 who were younger than 10 years of age, 5 of whom had mild fasting hyperglycemia and the Glu300-to-Gln mutation.Clinical Features of Families with Mutations in Glucokinase
We compared the clinical features of subjects with maturity-onset diabetes of the young due to mutations in glucokinase with those of subjects with maturity-onset diabetes of the young due to other causes (Table 3Table 3
Clinical Characteristics of Patients with Maturity-Onset Diabetes of the Young and Patients with Late-Onset NIDDM.). There were no differences between the two groups in fasting plasma glucose and insulin concentrations. However, the group with glucokinase mutations were younger at the time of diagnosis and had a milder form of diabetes, in that they had a lower frequency of overt NIDDM.With respect to age at the time of the diagnosis of hyperglycemia, we identified at least one affected subject who was 12 years of age or younger in 17 of the 18 families with mutations in the glucokinase gene. Moreover, 11 subjects were given a diagnosis before the age of 6 years, and 1 was given a diagnosis at 16 months. This boy had a fasting plasma glucose concentration of 92 mg per deciliter (5.1 mmol per liter) at 3 months of age and of 120 mg per deciliter (6.7 mmol per liter) at 16 months; the normal values at this age range from 48 to 80 mg per deciliter (2.7 to 4.4 mmol per liter).
Discussion
We identified mutations in the glucokinase gene in 18 of the 32 families with maturity-onset diabetes of the young (56 percent). In contrast, no such mutations were found in 21 families with late-onset NIDDM, implying that mutations in glucokinase are not a major cause of this form of NIDDM. However, we cannot exclude the possibility that glucokinase mutations may contribute to the development of NIDDM in other ethnic or racial groups with late-onset NIDDM. In this regard, associations between specific glucokinase microsatellite alleles and NIDDM have been reported in American blacks22 and Mauritian Creoles23.
The molecular mechanism whereby mutations in glucokinase cause a dominantly inherited form of hyperglycemia is not known. The results suggest that a gene-dosage mechanism may be the most likely cause of the hyperglycemia, since all RNA splicing mutations as well as nonsense and missense mutations were associated with diabetes, and each would be expected to decrease cellular levels of glucokinase. Since the amount of glucokinase in beta cells is believed to determine the threshold for glucose-stimulated insulin secretion, any decrease in the intracellular content or activity of glucokinase would be predicted to increase this threshold. In Families F51, F85, F386, and F423 (Table 2), the plasma glucose concentrations required to cause insulin secretion were increased,24 a finding consistent with this hypothesis. The mutations in glucokinase were also highly penetrant, and all the subjects with glucokinase mutations that we have studied had a metabolic defect, whether mild fasting hyperglycemia, impaired glucose tolerance, or NIDDM.
Sixteen different mutations were identified in 18 families with maturity-onset diabetes of the young. Thus, rather than one or two mutations being responsible for the diabetes in this relatively homogeneous group of white subjects of French ancestry, there are many. A similar spectrum of mutations will probably be found in other ethnic and racial groups, especially since about 50 percent of the mutations shown in Table 2 occur in the context of a cytosine-phosphate-guanosine dinucleotide, which represents a hot spot for mutations25.
Our results indicate that 56 percent of the French families with maturity-onset diabetes of the young carry a mutation in the glucokinase gene. In the remaining 44 percent of the families, linkage analysis with highly polymorphic DNA markers as well as direct screening of the glucokinase gene for mutations suggested that mutations in the glucokinase gene are not the cause of hyperglycemia. Although we could have missed a mutation in the glucokinase gene, we believe it to be unlikely. In fact, 2 of the 14 families in which we were unable to identify a mutation in the glucokinase gene had positive but nonsignificant lod scores for linkage with adenosine deaminase, a marker for a gene for maturity-onset diabetes of the young on chromosome 20, suggesting that the NIDDM in these families was due to mutations in the unidentified diabetes gene on this chromosome. The absence of linkage with the glucokinase or adenosine deaminase gene in the remaining 12 families indicates that there is at least one more gene whose mutation may cause maturity-onset diabetes of the young.
Mutations in glucokinase result in a form of NIDDM that has an early age of onset, often childhood. Although the age at diagnosis may be the most easily recognizable variable that differentiates patients with glucokinase mutations from those who do not have such mutations, it suffers from a lack of discriminating ability because of ascertainment bias. Indeed, screening for diabetes in our families with maturity-onset diabetes of the young led to a decrease in the mean (±SD) age at diagnosis in consecutive generations: from 41 ±15 years in the generation born after 1930 to 22 ±9 years in those born after 1950 and 11 ±5 years in those born after 1970. We measured fasting plasma glucose concentrations in all available subjects over the age of five years (and in several children who were younger). Thus, we believe that the minimal age at diagnosis of hyperglycemia shown in Table 3 is a reflection of the real age at onset and that there is a difference between the subjects with and those without glucokinase mutations.
By contrast, in families with maturity-onset diabetes of the young without glucokinase mutations, the onset of disease occurred after puberty, a period associated with decreased sensitivity to insulin26. However, the disease began in childhood in two affected subjects in families with maturity-onset diabetes of the young without glucokinase mutations. One was from a family in which the diabetes may be due to a mutation in the gene for maturity-onset diabetes of the young on chromosome 20. The second subject had a mother with maturity-onset diabetes of the young and a father with late-onset NIDDM. It has been suggested that abnormalities in glucose metabolism occur at an earlier age in persons with two diabetic parents27.
The NIDDM due to mutations in glucokinase appears to be relatively mild, as indicated by the number of affected subjects who did not have overt diabetes and by the fact that the disease was treated by diet alone in most subjects. Since most were lean, having a normal body weight may be sufficient to maintain fasting plasma glucose concentrations around 125 mg per deciliter (6.9 mmol per liter).
NIDDM is a heterogeneous disorder, and several genetic mechanisms have been implicated in its cause. These include mutations in the insulin28 and insulinreceptor genes,29 the mitochondria,30 and a gene linked to adenosine deaminase on chromosome 20,2 as well as in the glucokinase gene. Although further studies are required to determine their actual prevalence, mutations in the glucokinase gene have been identified in 18 of the 300 diabetes-prone French families (6 percent) for whom we have data. Thus, mutations in this gene are the most common cause of NIDDM identified to date.
Continuing genetic studies of families with maturity-onset diabetes of the young should provide a better understanding of the causes of NIDDM as well as a foundation for addressing the genetic factors that contribute to the more common late-onset forms of this disease.
Supported by the Association Francaise contre les Myopathies through the Genethon program, the Assistance Publique-Hopitaux de Paris, Boehringer-Mannheim, the French Ministry for Research and Technology, the Deutsche Forschungsgemeinschaft, the Howard Hughes Medical Institute, and the National Institutes of Health (grants DK-20595, DK-44840, and DK-16746).
We are indebted to Drs. H. Lestradet and J.J. Robert for referring their patients, to the Caisse Nationale de Prevoyance-Assurances and the Regie Autonome des Transports Parisiens for help in identifying families, and to Ms. F. Lethrosne, Ms. F. Dufour, Ms. C. Roudaut, Ms. M.O. Butel, and Mr. J.M. Sebaoun for their technical assistance.
Source Information
From the Centre d'Etude du Polymorphisme Humain, Paris (P.F., H.Z., G.V., M.V., F.S., S.L., J.S.B., D.C.); Service d'Endocrinologie, Hopital Saint-Louis, Paris (P.F., P.P.); the Metabolism Division, Washington University School of Medicine, St. Louis (M.A.P.); and the Howard Hughes Medical Institute and Departments of Biochemistry and Molecular Biology and Medicine, University of Chicago, Chicago (N.V., M.S., J.T., G.I.B.).
Address reprint requests to Dr. Froguel at the Centre d'Etude du Polymorphisme Humain, 27 rue Juliette Dodu, 75010 Paris, France.
- References
References
1
Rich SS . Mapping genes in diabetes: genetic epidemiological perspective. Diabetes 1990;39:1315-1319
CrossRef | Web of Science | Medline2
Bell GI ,Xiang KS ,Newman MV , et al. Gene for non-insulin-dependent diabetes mellitus (maturity-onset diabetes of the young subtype) is linked to DNA polymorphism on human chromosome 20q. Proc Natl Acad Sci U S A 1991;88:1484-1488
CrossRef | Web of Science | Medline3
Froguel P ,Vaxillaire M ,Sun F , et al. Close linkage of glucokinase locus on chromosome 7p to early-onset non-insulin-dependent diabetes mellitus. Nature 1992;356:162-164
CrossRef | Web of Science | Medline4
Hattersley AT ,Turner RC ,Permutt MA , et al. Linkage of type 2 diabetes to the glucokinase gene. Lancet 1992;339:1307-1310
CrossRef | Web of Science | Medline5
Vionnet N ,Stoffel M ,Takeda J , et al. Nonsense mutation in the glucokinase gene causes early-onset non-insulin-dependent diabetes mellitus. Nature 1992;356:721-722
CrossRef | Web of Science | Medline6
Stoffel M ,Froguel P ,Takeda J , et al. Human glucokinase gene: isolation, characterization, and identification of two missense mutations linked to early-onset non-insulin-dependent (type 2) diabetes mellitus. Proc Natl Acad Sci U S A 1992;89:7698-7702
CrossRef | Web of Science | Medline7
Meglasson MD ,Matschinsky FM . New perspectives on pancreatic islet glucokinase. Am J Physiol 1984;246:E1-E13
Web of Science | Medline8
Matschinsky FM . Glucokinase as glucose sensor and metabolic signal generator in pancreatic beta-cells and hepatocytes. Diabetes 1990;39:647-652
CrossRef | Web of Science | Medline9
Magnuson MA . Glucokinase gene structure: functional implications of molecular genetic studies. Diabetes 1990;39:523-527
CrossRef | Web of Science | Medline10
Froguel P ,Velho G ,Cohen D ,Passa P . Strategies for the collection of sibling-pair data for genetic studies in type 2 (non-insulin-dependent) diabetes mellitus. Diabetologia 1991;34:685-685
CrossRef | Web of Science | Medline11
WHO Expert Committee on Diabetes Mellitus: second report
Medline12
Fajans SS . Scope and heterogeneous nature of MODY. Diabetes Care 1990;13:49-64[Erratum, Diabetes Care 1990;13:910.]
CrossRef | Web of Science | Medline13
Tchobroutsky G . Blood glucose levels in diabetic and non-diabetic subjects. Diabetologia 1991;34:67-73
CrossRef | Web of Science | Medline14
Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Plainview, N.Y.: Cold Spring Harbor Laboratory Press, 1989.
15
Saiki RK ,Gelfand DH ,Stoffel S , et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 1988;239:487-491
CrossRef | Web of Science | Medline16
Orita M ,Suzuki Y ,Sekiya T ,Hayashi K . Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 1989;5:874-879
CrossRef | Web of Science | Medline17
Sanger F ,Coulson AR ,Barrell BG ,Smith AJH ,Roe BA . Cloning in single-stranded bacteriophage as an aid to rapid DNA sequencing. J Mol Biol 1980;143:161-178
CrossRef | Web of Science | Medline18
Newton CR ,Graham A ,Heptinstall LE , et al. Analysis of any point mutation in DNA: the amplification refractory mutation system (ARMS). Nucleic Acids Res 1989;17:2503-2516
CrossRef | Web of Science | Medline19
Lathrop GM ,Lalouel JM . Easy calculations of lod scores and genetic risks on small computers. Am J Hum Genet 1984;36:460-465
Web of Science | Medline20
Kobberling J, Tillil H. Empirical risk figures for first degree relatives of non-insulin dependent diabetics. In: Kobberling J, Tattersall R, eds. The genetics of diabetes mellitus. Vol. 47 of Proceedings of the Serono Symposia. London: Academic Press, 1982:201-9.
21
Ott J. Analysis of human genetic linkage. Rev. ed. Baltimore: Johns Hopkins University Press, 1991.
22
Chiu KC ,Province MA ,Permutt MA . Glucokinase gene is genetic marker for NIDDM in American blacks. Diabetes 1992;41:843-849
CrossRef | Web of Science | Medline23
Chiu KC ,Province MA ,Dowse GK , et al. A genetic marker at the glucokinase gene locus for type 2 (non-insulin-dependent) diabetes mellitus in Mauritian Creoles. Diabetologia 1992;35:632-638
CrossRef | Web of Science | Medline24
Velho G ,Froguel P ,Clement K , et al. Primary pancreatic beta-cell secretory defect caused by mutations in glucokinase gene in kindreds of maturity onset diabetes of the young. Lancet 1992;340:444-448
CrossRef | Web of Science | Medline25
Cooper DN ,Krawczak M . The mutational spectrum of single base-pair substitutions causing human genetic disease: patterns and predictions. Hum Genet 1990;85:55-74
CrossRef | Web of Science | Medline26
Lestradet H ,Deschamps I ,Tichet J ,Lestradet MO . Hyperglycemie chronique non insulinoprive de l'enfant. Arch Fr Pediatr 1989;46:19-23
Medline27
O'Rahilly S ,Wainscoat JS ,Turner RC . Type 2 (non-insulin-dependent) diabetes mellitus: new genetics for old nightmares. Diabetologia 1988;31:407-414
CrossRef | Web of Science | Medline28
Steiner DF ,Tager HS ,Chan SJ ,Nanjo K ,Sanke T ,Rubenstein AH . Lessons learned from molecular biology of insulin-gene mutations. Diabetes Care 1990;13:600-609
CrossRef | Web of Science | Medline29
Taylor SI ,Cama A ,Accili D , et al. Genetic basis of endocrine disease. 1. Molecular genetics of insulin resistant diabetes mellitus. J Clin Endocrinol Metab 1991;73:1158-1163
CrossRef | Web of Science | Medline30
Ballinger SW ,Shoffner JM ,Hedaya EV , et al. Maternally transmitted diabetes and deafness associated with a 10.4 kb mitochondrial DNA deletion. Nat Genet 1992;1:11-15
CrossRef | Web of Science | Medline
- Citing Articles (201)
Citing Articles
1
B. M. Shields, T. J. McDonald, S. Ellard, M. J. Campbell, C. Hyde, A. T. Hattersley. (2012) The development and validation of a clinical prediction model to determine the probability of MODY in patients with young-onset diabetes. Diabetologia
CrossRef2
Rebecca Simmons. 2012. Abnormalities of Fetal Growth. , 51-59.
CrossRef3
S Anuradha, V Radha, V Mohan. (2011) Association of novel variants in the hepatocyte nuclear factor 4A gene with maturity onset diabetes of the young and early onset type 2 diabetes. Clinical Genetics 80:6, 541-549
CrossRef4
Tohru Yorifuji, Rika Fujimaru, Yuki Hosokawa, Nobuyoshi Tamagawa, Momoko Shiozaki, Katsuya Aizu, Kazuhiko Jinno, Yoshihiro Maruo, Hironori Nagasaka, Toshihiro Tajima, Koji Kobayashi, Tatsuhiko Urakami. (2011) Comprehensive molecular analysis of Japanese patients with pediatric-onset MODY-type diabetes mellitus. Pediatric Diabetesno-no
CrossRef5
Yael Gozlan, Ariel Tenenbaum, Shlomit Shalitin, Yael Lebenthal, Tal Oron, Ohad Cohen, Moshe Phillip, Galia Gat-Yablonski. (2011) The glucokinase mutation p.T206P is common among MODY patients of Jewish Ashkenazi descent. Pediatric Diabetesno-no
CrossRef6
Maciej Borowiec, Malgorzata Mysliwiec, Wojciech Fendler, Karolina Antosik, Agnieszka Brandt, Maciej Malecki, Wojciech Mlynarski. (2011) Phenotype variability and neonatal diabetes in a large family with heterozygous mutation of the glucokinase gene. Acta Diabetologica 48:3, 203-208
CrossRef7
Viswanathan Mohan. (2011) Type 2 diabetes can also be multigenerational like MODY. International Journal of Diabetes in Developing Countries 31:3, 125-127
CrossRef8
Andrea K. Steck, Wiliam E. Winter. (2011) Review on monogenic diabetes. Current Opinion in Endocrinology, Diabetes and Obesity 18:4, 252-258
CrossRef9
M.P. Kyithar, S. Bacon, K.K. Pannu, S.R. Rizvi, K. Colclough, S. Ellard, M.M. Byrne. (2011) Identification of HNF1A-MODY and HNF4A-MODY in Irish families: Phenotypic characteristics and therapeutic implications. Diabetes & Metabolism
CrossRef10
Kate Bennett, Chela James, Angham Mutair, Hala Al-Shaikh, Aisha Sinani, Khalid Hussain. (2011) Four novel cases of permanent neonatal diabetes mellitus caused by homozygous mutations in the glucokinase gene. Pediatric Diabetes 12:3pt1, 192-196
CrossRef11
Silvia Costantini, Paola Prandini, Massimiliano Corradi, Alessandra Pasquali, Giovanna Contreas, Pier Franco Pignatti, Leonardo Pinelli, Elisabetta Trabetti, Claudio Maffeis. (2011) A novel synonymous substitution in the GCK gene causes aberrant splicing in an Italian patient with GCK-MODY phenotype. Diabetes Research and Clinical Practice 92:1, e23-e26
CrossRef12
Yunfeng Shen, Mengyin Cai, Hua Liang, Hongwei Wang, Jianping Weng. (2011) Insight into the biochemical characteristics of a novel glucokinase gene mutation. Human Genetics 129:3, 231-238
CrossRef13
M Borowiec, K Antosik, W Fendler, G Deja, P Jarosz-Chobot, M Mysliwiec, A Zmyslowska, M Malecki, A Szadkowska, W Mlynarski. (2011) Novel glucokinase mutations in patients with monogenic diabetes - clinical outline of GCK-MD and potential for founder effect in Slavic population. Clinical Geneticsno-no
CrossRef14
Ariel Pablo Lopez, Sabrina Andrea Foscaldi, Maria Silvia Perez, Martín Rodriguez, Mercedes Traversa, Félix Miguel Puchulu, Ignacio Bergada, Gustavo Daniel Frechtel. (2011) HNF1 alpha gene coding regions mutations screening, in a Caucasian population clinically characterized as MODY from Argentina. Diabetes Research and Clinical Practice 91:2, 208-212
CrossRef15
Rebecca Simmons. (2011) Epigenetics and maternal nutrition: nature v. nurture. Proceedings of the Nutrition Society 70:01, 73-81
CrossRef16
Jae-Hyoung Cho, Ji-Won Kim, Jeong-Ah Shin, Juyoung Shin, Kun-Ho Yoon. (2011) β-cell mass in people with type 2 diabetes. Journal of Diabetes Investigation 2:1, 6-17
CrossRef17
Roy Taylor, Gerald I. Shulman. 2011. Regulation of Hepatic Glucose Uptake. .
CrossRef18
Kenneth Cusi, Ralph A. Defronzo. 2011. Pathogenesis of Type 2 Diabetes. .
CrossRef19
Jeffrey B. Halter. 2011. Carbohydrate Metabolism. .
CrossRef20
Christopher B. Newgard, Franz M. Matschinsky. 2011. Substrate Control of Insulin Release. .
CrossRef21
Una Glamočlija, Adlija Jevrić-Čaušević. (2010) Genetic polymorphisms in diabetes: Influence on therapy with oral antidiabetics. Acta Pharmaceutica 60:4, 387-406
CrossRef22
M. T. Malecki. (2010) The search for undiagnosed MODY patients: what is the next step?. Diabetologia 53:12, 2465-2467
CrossRef23
Martine Vaxillaire, Philippe Froguel. 2010. The Genetics of Type 2 Diabetes: From Candidate Gene Biology to Genome-Wide Studies. , 191-214.
CrossRef24
Stefan S. Fajans, Graeme I. Bell, Veronica P. Paz, Jennifer E. Below, Nancy J. Cox, Catherine Martin, Inas H. Thomas, Ming Chen. (2010) Obesity and hyperinsulinemia in a family with pancreatic agenesis and MODY caused by the IPF1 mutation Pro63fsX60. Translational Research 156:1, 7-14
CrossRef25
B. M. Shields, R. M. Freathy, A. T. Hattersley. (2010) Genetic influences on the association between fetal growth and susceptibility to type 2 diabetes. Journal of Developmental Origins of Health and Disease 1:02, 96
CrossRef26
Gyu Yeon Choi. (2010) Fetal origins of adult disease. Korean Journal of Obstetrics and Gynecology 53:6, 475
CrossRef27
Louis H. Philipson, Rinki Murphy, Sian Ellard, Andrew T. Hattersley, Julie Støy, Siri A. Greeley, Graeme I. Bell, Kenneth S. Polonsky. 2010. Genetic Testing in Diabetes MellitusA Clinical Guide to Monogenic Diabetes. , 17-25.
CrossRef28
Jamie Odem, Ethan Munzinger, Sarah Violand, Amie Van Morlan, Danita Rife, Bert Bachrach. (2009) An infant with combination gene mutations for Monogenic Diabetes of Youth (MODY) 2 and 4, presenting with Diabetes Mellitus Requiring Insulin (DMRI) at 8 months of age. Pediatric Diabetes 10:8, 550-553
CrossRef29
Kara K. Osbak, Kevin Colclough, Cecile Saint-Martin, Nicola L. Beer, Christine Bellanné-Chantelot, Sian Ellard, Anna L. Gloyn. (2009) Update on mutations in glucokinase ( GCK ), which cause maturity-onset diabetes of the young, permanent neonatal diabetes, and hyperinsulinemic hypoglycemia. Human Mutation 30:11, 1512-1526
CrossRef30
Fawzu Al-Sheyab, Emran Khamaiseh, Marwan Abu Halaweh, Raida W. Khalil. (2009) Characterization of glucokinase polymorphisms associated with Maturity-Onset Diabetes of the Young (MODY2) in Jordanian population. Cytology and Genetics 43:5, 343-347
CrossRef31
M. Borowiec, C. W. Liew, R. Thompson, W. Boonyasrisawat, J. Hu, W. M. Mlynarski, I. El Khattabi, S.-H. Kim, L. Marselli, S. S. Rich, A. S. Krolewski, S. Bonner-Weir, A. Sharma, M. Sale, J. C. Mychaleckyj, R. N. Kulkarni, A. Doria. (2009) Mutations at the BLK locus linked to maturity onset diabetes of the young and -cell dysfunction. Proceedings of the National Academy of Sciences 106:34, 14460-14465
CrossRef32
Jesús Solera, Pedro Arias, Cintia Amiñoso, Isabel González-Casado, Pilar Garre, Lucrecia Herranz, Africa Villarroel, Marta Cruz, Mercedes Jáñez, Luís Felipe Pallardo, Ricardo Gracia. (2009) Identification of eight new mutations in the GCK gene by DHPLC screening in a Spanish population. Diabetes Research and Clinical Practice 85:1, 20-23
CrossRef33
Nattachet Plengvidhya, Watip Boonyasrisawat, Nalinee Chongjaroen, Prapaporn Jungtrakoon, Sutin Sriussadaporn, Sathit Vannaseang, Napatawn Banchuin, Pa-thai Yenchitsomanus. (2009) Mutations of maturity-onset diabetes of the young (MODY) genes in Thais with early-onset type 2 diabetes mellitus. Clinical Endocrinology 70:6, 847-853
CrossRef34
Rebecca A. Simmons. (2009) Developmental Origins of Adult Disease. Pediatric Clinics of North America 56:3, 449-466
CrossRef35
Q. Qi, Y. Wu, H. Li, R. J. F. Loos, F. B. Hu, L. Sun, L. Lu, A. Pan, C. Liu, H. Wu, L. Chen, Z. Yu, X. Lin. (2009) Association of GCKR rs780094, alone or in combination with GCK rs1799884, with type 2 diabetes and related traits in a Han Chinese population. Diabetologia 52:5, 834-843
CrossRef36
Anke Assmann, Charlotte Hinault, Rohit N Kulkarni. (2009) Growth factor control of pancreatic islet regeneration and function. Pediatric Diabetes 10:1, 14-32
CrossRef37
Maciej T. Malecki, Wojciech Mlynarski, Jan Skupien. (2008) Can geneticists help clinicians to understand and treat non-autoimmune diabetes?. Diabetes Research and Clinical Practice 82, S83-S93
CrossRef38
E. González Sarmiento, M.C. Hinojosa Mena-Bernal, L. Inglada Galiana. (2008) Diabetes mellitus tipo 1 y 2: etiopatogenia, formas de comienzo, manifestaciones clínicas, historia natural. Medicine - Programa de Formación Médica Continuada Acreditado 10:17, 1091-1101
CrossRef39
J.-F. Louet, S. B. Smith, J.-F. Gautier, M. Molokhia, M.-L. Virally, J.-P. Kevorkian, P.-J. Guillausseau, P. Vexiau, G. Charpentier, M. S. German, C. Vaisse, M. Urbanek, F. Mauvais-Jarvis. (2008) Gender and neurogenin3 influence the pathogenesis of ketosis-prone diabetes. Diabetes, Obesity and Metabolism 10:10, 912-920
CrossRef40
Jørn V Sagen, Lise Bjørkhaug, Janne Molnes, Helge Raeder, Louise Grevle, Oddmund Søvik, Anders Molven, Pål R Njølstad. (2008) Diagnostic screening of MODY2/ GCK mutations in the Norwegian MODY Registry. Pediatric Diabetes 9:5, 442-449
CrossRef41
Gilberto K. Furuzawa, Fernando M.A. Giuffrida, Carolina S.V. Oliveira, Antonio R. Chacra, Sergio A. Dib, André F. Reis. (2008) Low prevalence of MODY2 and MODY3 mutations in Brazilian individuals with clinical MODY phenotype. Diabetes Research and Clinical Practice 81:3, e12-e14
CrossRef42
Maciej T. Malecki, Wojciech Mlynarski. (2008) Monogenic diabetes: implications for therapy of rare types of disease. Diabetes, Obesity and Metabolism 10:8, 607-616
CrossRef43
S. . Eide, H. Rder, S. Johansson, K. Midthjell, O. Svik, P. R. Njlstad, A. Molven. (2008) Prevalence of HNF1A (MODY3) mutations in a Norwegian population (the HUNT2 Study). Diabetic Medicine 25:7, 775-781
CrossRef44
Sachiko Kitanaka. (2008) Role of HNF-1α and HNF-1β on insulin, IGF-1 and other potential target genes. Expert Review of Endocrinology & Metabolism 3:4, 441-452
CrossRef45
Shoko Sato, Hitoshi Shirakawa, Shuhei Tomita, Yusuke Ohsaki, Keiichi Haketa, Osamu Tooi, Noriaki Santo, Masahiro Tohkin, Yuji Furukawa, Frank J. Gonzalez, Michio Komai. (2008) Low-dose dioxins alter gene expression related to cholesterol biosynthesis, lipogenesis, and glucose metabolism through the aryl hydrocarbon receptor-mediated pathway in mouse liver. Toxicology and Applied Pharmacology 229:1, 10-19
CrossRef46
David B Rhoads, Lynne L Levitsky. (2008) Function of HNF1 in the pathogenesis of diabetes. Expert Review of Endocrinology & Metabolism 3:3, 391-403
CrossRef47
Rinki Murphy, Sian Ellard, Andrew T Hattersley. (2008) Clinical implications of a molecular genetic classification of monogenic β-cell diabetes. Nature Clinical Practice Endocrinology & Metabolism 4:4, 200-213
CrossRef48
(2007) Analysis of the GCK and HNF-1α Gene Polymorphism in Korean Type 2 Diabetic Patients by PCR-DHPLC. Journal of the Korean Chemical Society 51:6, 543-548
CrossRef49
K. Yamagata, T. Nammo, Y. Sato, K. Saisho, H. Shoda, K. Fukui. (2007) The HNF-1?-SNARE connection. Diabetes, Obesity and Metabolism 9:s2, 40-45
CrossRef50
Claudia Gragnoli, Laura Pierpaoli, Nunzia Piumelli, Francesco Chiaramonte. (2007) Linkage studies for T2D in Chop and C/EBPbeta chromosomal regions in Italians. Journal of Cellular Physiology 213:2, 552-555
CrossRef51
Rebecca A. Simmons. (2007) Role of metabolic programming in the pathogenesis of β-cell failure in postnatal life. Reviews in Endocrine and Metabolic Disorders 8:2, 95-104
CrossRef52
Limei Liu, Hiroto Furuta, Asako Minami, Taishan Zheng, Weiping Jia, Kishio Nanjo, Kunsan Xiang. (2007) A novel mutation, Ser159Pro in the NeuroD1/BETA2 gene contributes to the development of diabetes in a Chinese potential MODY family. Molecular and Cellular Biochemistry 303:1-2, 115-120
CrossRef53
Martijn van de Bunt, Anna L Gloyn. (2007) Monogenic disorders of the pancreatic β-cell: personalizing treatment for rare forms of diabetes and hypoglycemia. Personalized Medicine 4:3, 247-259
CrossRef54
Latisha Love-Gregory, M Alan Permutt. (2007) HNF4A genetic variants: role in diabetes. Current Opinion in Clinical Nutrition and Metabolic Care 10:4, 397-402
CrossRef55
Struan FA Grant, Hakon Hakonarson. (2007) Recent development in pharmacogenomics: from candidate genes to genome-wide association studies. Expert Review of Molecular Diagnostics 7:4, 371-393
CrossRef56
Itziar Estalella, Itxaso Rica, Guiomar Perez de Nanclares, Jose Ramon Bilbao, Jose Antonio Vazquez, Jose Ignacio San Pedro, Maria Angeles Busturia, Luis Castaño, . (2007) Mutations in GCK and HNF-1? explain the majority of cases with clinical diagnosis of MODY in Spain. Clinical Endocrinology 0:0, 070615230707001-???
CrossRef57
S. Cauchi, M. Vaxillaire, H. Choquet, E. Durand, A. Duval, M. Polak, P. Froguel. (2006) No major contribution of TCF7L2 sequence variants to maturity onset of diabetes of the young (MODY) or neonatal diabetes mellitus in French white subjects. Diabetologia 50:1, 214-216
CrossRef58
Jin Soon Hwang, Choong Ho Shin, Sei Won Yang, Sung young Jung, Nam Huh. (2006) Genetic and clinical characteristics of Korean maturity-onset diabetes of the young (MODY) patients. Diabetes Research and Clinical Practice 74:1, 75-81
CrossRef59
L Vits, D Beckers, M Craen, C De Beaufort, E Vanfleteren, K Dahan, A Nollet, G Vanhaverbeke, SV Imschoot, J-P Bourguignon, V Beauloye, K Storm, G Massa, M Giri, F Nobels, J De Schepper, R Rooman, A Van den Bruel, C Mathieu, W Wuyts. (2006) Identification of novel and recurrent glucokinase mutations in Belgian and Luxembourg maturity onset diabetes of the young patients. Clinical Genetics 70:4, 355-359
CrossRef60
LIMING WANG, WENSHUI XIA. (2006) ISOLATION AND ANALYSIS OF A NOVEL ACIDIC POLYSACCHARIDE WITH GLUCOKINASE-STIMULATING ACTIVITY FROM COARSE GREEN TEA. Journal of Food Biochemistry 30:2, 187-202
CrossRef61
Andrew T Hattersley. (2006) Beyond the beta cell in diabetes. Nature Genetics 38:1, 12-13
CrossRef62
Kenji Fukui, Qin Yang, Yang Cao, Noriko Takahashi, Hiroyasu Hatakeyama, Haiyan Wang, Jun Wada, Yanling Zhang, Lorella Marselli, Takao Nammo, Kazue Yoneda, Mineki Onishi, Shigeki Higashiyama, Yuji Matsuzawa, Frank J. Gonzalez, Gordon C. Weir, Haruo Kasai, Iichiro Shimomura, Jun-ichiro Miyagawa, Claes B. Wollheim, Kazuya Yamagata. (2005) The HNF-1 target Collectrin controls insulin exocytosis by SNARE complex formation. Cell Metabolism 2:6, 373-384
CrossRef63
Rebecca Simmons. (2005) Developmental origins of adult metabolic disease: concepts and controversies. Trends in Endocrinology & Metabolism 16:8, 390-394
CrossRef64
Laura Forsyth, Robert Hume, Allan Howatson, Anthony Busuttil, Ann Burchell. (2005) Identification of novel polymorphisms in the glucokinase and glucose-6-phosphatase genes in infants who died suddenly and unexpectedly. Journal of Molecular Medicine 83:8, 610-618
CrossRef65
N. Shehadeh, D. Bakri, P. R. Njolstad, R. Gershoni-Baruch. (2005) Clinical characteristics of mutation carriers in a large family with glucokinase diabetes (MODY2). Diabetic Medicine 22:8, 994-998
CrossRef66
Fernando M. A. Giuffrida, Andre F. Reis. (2005) Genetic and clinical characteristics of maturity-onset diabetes of the young. Diabetes, Obesity and Metabolism 7:4, 318-326
CrossRef67
Khalid Hussain, Karen E Cosgrove. (2005) From congenital hyperinsulinism to diabetes mellitus: the role of pancreatic beta-cell KATP channels. Pediatric Diabetes 6:2, 103-113
CrossRef68
M TUSIELUNA. (2005) Genes and Type 2 Diabetes Mellitus. Archives of Medical Research 36:3, 210-222
CrossRef69
Cullen M. Taniguchi, Kohjiro Ueki, C. Ronald Kahn. (2005) Complementary roles of IRS-1 and IRS-2 in the hepatic regulation of metabolism. Journal of Clinical Investigation 115:3, 718-727
CrossRef70
Lars Hansen, Oluf Pedersen. (2005) Genetics of type 2 diabetes mellitus: status and perspectives. Diabetes, Obesity and Metabolism 7:2, 122-135
CrossRef71
Jos?? Timsit, Christine Bellann??-Chantelot, Dani??le Dubois-Laforgue, Gilberto Velho. (2005) Diagnosis and Management of Maturity-Onset Diabetes of the Young. Treatments in Endocrinology 4:1, 9-18
CrossRef72
Alma Martinez, Rebecca Simmons. 2005. Abnormalities of Fetal Growth. , 32-45.
CrossRef73
, FINN EDLER EYBEN, JENS PETER KROUSTRUP, JENS FROMHOLT LARSEN, JULIO CELIS. (2004) Comparison of Gene Expression in Intra-Abdominal and Subcutaneous Fat: A Study of Men with Morbid Obesity and Nonobese Men Using Microarray and Proteomics. Annals of the New York Academy of Sciences 1030:1, 508-536
CrossRef74
A. Corbatón Anchuelo, R. Cuervo Pinto, M. Serrano Ríos. (2004) Diabetes mellitus. Concepto, clasificación y mecanismos etiopatogénicos. Medicine - Programa de Formación Médica Continuada Acreditado 9:16, 963-970
CrossRef75
Claudia Gragnoli, Guido Menzinger Von Preussenthal, Joel F Habener. (2004) Triple genetic variation in the HNF-4α gene is associated with early-onset type 2 diabetes mellitus in a philippino family. Metabolism 53:8, 959-963
CrossRef76
Ralph A DeFronzo. (2004) Pathogenesis of type 2 diabetes mellitus. Medical Clinics of North America 88:4, 787-835
CrossRef77
Joseph Avella, Charles V. Wetli, James C. Wilson, Michael Katz, Timothy Hahn. (2004) Fatal Olanzapine-Induced Hyperglycemic Ketoacidosis. The American Journal of Forensic Medicine and Pathology 25:2, 172-175
CrossRef78
Christopher B. Newgard. 2004. Regulation of Glucose Metabolism in the Liver. .
CrossRef79
C. W. Ahn, Y. D. Song, J. H. Nam, D. M. Kim, S. O. Woo, S. W. Park, B. S. Cha, S. K. Lim, K. R. Kim, J. H. Lee, H. C. Lee, K. B. Huh. (2004) Insulin sensitivity in physically fit and unfit children of parents with Type 2 diabetes. Diabetic Medicine 21:1, 59-63
CrossRef80
Johanna K Wolford, Barbora Vozarova de Courten. (2004) Genetic Basis of Type 2 Diabetes Mellitus. Treatments in Endocrinology 3:4, 257-267
CrossRef81
Heiner Fangerau, Stephanie Ohlraun, Ralf O. Granath, Markus M. Nöthen, Marcella Rietschel, Thomas G. Schulze. (2004) Computer-Assisted Phenotype Characterization for Genetic Research in Psychiatry. Human Heredity 58:3-4, 122-130
CrossRef82
Ewan R. Pearson, Andrew T. Hattersley. 2003. Monogenic Disorders of the ��-Cell. .
CrossRef83
Thomas G. Schulze, Francis J. McMahon. (2003) Genetic linkage and association studies in bipolar affective disorder: A time for optimism. American Journal of Medical Genetics 123C:1, 36-47
CrossRef84
Anna L. Gloyn. (2003) Glucokinase ( GCK ) mutations in hyper- and hypoglycemia: Maturity-onset diabetes of the young, permanent neonatal diabetes, and hyperinsulinemia of infancy. Human Mutation 22:5, 353-362
CrossRef85
Ralph A. DeFronzo, Lawrence Mandarino, Eleuterio Ferrannini. 2003. Metabolic and Molecular Pathogenesis of Type 2 Diabetes Mellitus. .
CrossRef86
Jose C. Florez, Joel Hirschhorn, David Altshuler. (2003) T
HE INHERITED BASIS OF DIABETES MELLITUS : Implications for the Genetic Analysis of Complex Traits. Annual Review of Genomics and Human Genetics 4:1, 257-291
CrossRef87
Claes B. Wollheim, Pierre Maechler. 2003. ��-Cell Biology of Insulin Secretion. .
CrossRef88
Taro E. Akiyama, Frank J. Gonzalez. (2003) Regulation of P450 genes by liver-enriched transcription factors and nuclear receptors. Biochimica et Biophysica Acta (BBA) - General Subjects 1619:3, 223-234
CrossRef89
Sara K. Hansen, Marcelina Párrizas, Maria L. Jensen, Stepanka Pruhova, Jakob Ek, Sylvia F. Boj, Anders Johansen, Miguel A. Maestro, Francisca Rivera, Hans Eiberg, Michal Andel, Jan Lebl, Oluf Pedersen, Jorge Ferrer, Torben Hansen. (2002) Genetic evidence that HNF-1α–dependent transcriptional control of HNF-4α is essential for human pancreatic β cell function. Journal of Clinical Investigation 110:6, 827-833
CrossRef90
Núria Morral, Robert McEvoy, Hengjiang Dong, Marcia Meseck, Jennifer Altomonte, Swan Thung, Savio L.C. Woo. (2002) Adenovirus-Mediated Expression of Glucokinase in the Liver as an Adjuvant Treatment for Type 1 Diabetes. Human Gene Therapy 13:13, 1561-1570
CrossRef91
Jan WA Smit, Michaela Diamant. (2002) Genetically defined pancreatic beta cell failure. Pharmacogenomics 3:5, 669-678
CrossRef92
André R. Miserez, Patrick Y. Muller, Violeta Spaniol. (2002) Indinavir inhibits sterol-regulatory element-binding protein-1c-dependent lipoprotein lipase and fatty acid synthase gene activations. AIDS 16:12, 1587-1594
CrossRef93
Richard E. Pratley, Christian Weyer. (2002) Progression from IGT to type 2 diabetes mellitus: The central role of impaired early insulin secretion. Current Diabetes Reports 2:3, 242-248
CrossRef94
David Q. Shih, Markus Stoffel. (2002) Molecular etiologies of mody and other early-onset forms of diabetes. Current Diabetes Reports 2:2, 125-134
CrossRef95
C.M. Lindgren, M.M. Mahtani, E. Widén, M.I. McCarthy, M.J. Daly, A. Kirby, M.P. Reeve, L. Kruglyak, A. Parker, J. Meyer, P. Almgren, M. Lehto, T. Kanninen, T. Tuomi, L.C. Groop, E.S. Lander. (2002) Genomewide Search for Type 2 Diabetes Mellitus Susceptibility Loci in Finnish Families: The Botnia Study. The American Journal of Human Genetics 70:2, 509-516
CrossRef96
J. Bentzen, P. Poulsen, A. Vaag, H. Beck-Nielsen, M. Fenger. (2002) The influence of the polymorphism in apolipoprotein B codon 2488 on insulin and lipid levels in a Danish twin population. Diabetic Medicine 19:1, 12-18
CrossRef97
Rie Sano, Takashi Miki, Yoshifumi Suzuki, Fumio Shimada, Masato Taira, Azuma Kanatsuka, Hideichi Makino, Naotake Hashimoto, Yasushi Saito. (2001) Analysis of the insulin-sensitive phosphodiesterase 3B gene in type 2 diabetes. Diabetes Research and Clinical Practice 54:2, 79-88
CrossRef98
Mark I McCarthy, Andrew T Hattersley. (2001) Molecular diagnostics in monogenic and multifactorial forms of Type 2 diabetes. Expert Review of Molecular Diagnostics 1:4, 403-412
CrossRef99
Fajans, Stefan S., Bell, Graeme I., Polonsky, Kenneth S., . (2001) Molecular Mechanisms and Clinical Pathophysiology of Maturity-Onset Diabetes of the Young. New England Journal of Medicine 345:13, 971-980
Full Text100
E. Kousta, S. Ellard, L. I. S. Allen, P. J. Saker, S. J. Huxtable, A. T. Hattersley, M. I. McCarthy. (2001) Glucokinase mutations in a phenotypically selected multiethnic group of women with a history of gestational diabetes. Diabetic Medicine 18:8, 683-684
CrossRef101
Njølstad, Pål R., Søvik, Oddmund, Cuesta-Muñoz, Antonio, Bjørkhaug, Lise, Massa, Ornella, Barbetti, Fabrizio, Undlien, Dag E., Shiota, Chiyo, Magnuson, Mark A., Molven, Anders, Matschinsky, Franz M., Bell, Graeme I., . (2001) Neonatal Diabetes Mellitus Due to Complete Glucokinase Deficiency. New England Journal of Medicine 344:21, 1588-1592
Full Text102
Valerie Lehnert, James Holzwarth, Michael Ott, Annick Thompson, Sabine Demmak, Dorothee Foernzler. (2001) A semi-automated system for analysis and storage of SNPs. Human Mutation 17:4, 243-254
CrossRef103
Andrea Kelly, Craig Alter, Paul Thornton. (2001) Insights into Neonatal Hyperinsulinism. The Endocrinologist 11:1, 26-34
CrossRef104
Takahisa YAMADA, Takeshi MIYAKE, Kenkichi SUGIURA, Akira NARITA, Kaichun WEI, Suwen WEI, Daniel H. MORALEJO, Tomoe OGINO, Claude GAILLARD, Yoshiyuki SASAKI, Kozo MATSUMOTO. (2001) Identification of Epistatic Interactions Involved in Non-Insulin-Dependent Diabetes Mellitus in the Otsuka Long-Evans Tokushima Fatty Rat.. Experimental Animals 50:2, 115-123
CrossRef105
E. H. R. van Essen, B. O. Roep, L. M. 't Hart, J. J. Jansen, J. M. W. Van den Ouweland, H. H. P. J. Lemkes, J. A. Maassen. (2000) HLA-DQ polymorphism and degree of heteroplasmy of the A3243G mitochondrial DNA mutation in maternally inherited diabetes and deafness. Diabetic Medicine 17:12, 841-847
CrossRef106
Setsuya Sakagashira, Henry J. Hiddinga, Kayoko Tateishi, Tokio Sanke, Tadashi Hanabusa, Kishio Nanjo, Norman L. Eberhardt. (2000) S20G Mutant Amylin Exhibits Increased in Vitro Amyloidogenicity and Increased Intracellular Cytotoxicity Compared to Wild-Type Amylin. The American Journal of Pathology 157:6, 2101-2109
CrossRef107
Jae-Hyun Nam, Hyun-Chul Lee, Youn-Hee Kim, Bong-Su Cha, Young-Duk Song, Sung-Kil Lim, Kyung-Rae Kim, Kap-Bum Huh. (2000) Identification of glucokinase mutation in subjects with post-renal transplantation diabetes mellitus. Diabetes Research and Clinical Practice 50:3, 169-176
CrossRef108
Steven C. Elbein. (2000) Genetics of Type 2 Diabetes: An Overview for the Millennium. Diabetes Technology & Therapeutics 2:3, 391-400
CrossRef109
Francesco S. Celi, Carlo Negri, Keith Tanner, Nina Raben, Flora De Pablo, Adela Rovira, Luis F. Pallardo, Pilar Martin-Vaquero, Michael P. Stern, Braxton D. Mitchell, Alan R. Shuldiner. (2000) Molecular scanning for mutations in the insulin receptor substrate-1 (IRS-1) gene in Mexican Americans with Type 2 diabetes mellitus. Diabetes/Metabolism Research and Reviews 16:5, 370-377
CrossRef110
William E. Winter, Janet H. Silverstein. (2000) Molecular and genetic bases for maturity onset diabetes of youth. Current Opinion in Pediatrics 12:4, 388-393
CrossRef111
Alessandro Doria, Nattachet Plengvidhya. (2000) Recent advances in the genetics of maturity-onset diabetes of the young and other forms of autosomal dominant diabetes. Current Opinion in Endocrinology & Diabetes 7:4, 203-210
CrossRef112
Margaret Gelder Ehm, Maha C. Karnoub, Hakan Sakul, Kirby Gottschalk, Donald C. Holt, James L. Weber, David Vaske, David Briley, Linda Briley, Jan Kopf, Patrick McMillen, Quan Nguyen, Melanie Reisman, Eric H. Lai, Geoff Joslyn, Nancy S. Shepherd, Callum Bell, Michael J. Wagner, Daniel K. Burns. (2000) Genomewide Search for Type 2 Diabetes Susceptibility Genes in Four American Populations. The American Journal of Human Genetics 66:6, 1871-1881
CrossRef113
T. -S. Jap, Y. -C. Wu, J. Y. Chiou, C. -F. Kwok. (2000) A novel mutation in the hepatocyte nuclear factor-1alpha/MODY3 gene in Chinese subjects with early-onset Type 2 diabetes mellitus in Taiwan. Diabetic Medicine 17:5, 390-393
CrossRef114
Steven M. Willi, Leonard E. Egede. (2000) Type 2 diabetes mellitus in adolescents. Current Opinion in Endocrinology & Diabetes 7:2, 71-76
CrossRef115
Fran
ois Godart, Christine Bellann
CrossRef116
Thorsten Klemm, Ralf Paschke. (2000) Mögliche genetische Ursachen für Spätkomplikationen des Diabetes mellitus. Medizinische Klinik 95:1, 31-39
CrossRef117
William E. Winter, Masamichi Nakamura, Dorlinda V. House. (1999) MONOGENIC DIABETES MELLITUS IN YOUTH. Endocrinology & Metabolism Clinics of North America 28:4, 765-785
CrossRef118
Olle Melander, Ingrid Mattiasson, Karel Maršál, Leif Groop, U Lennart Hulthén. (1999) Heredity for hypertension influences intra-uterine growth and the relation between fetal growth and adult blood pressure. Journal of Hypertension 17:11, 1557-1561
CrossRef119
El Habib Hani, Doris A. Stoffers, Jean-Claude Chèvre, Emmanuelle Durand, Violeta Stanojevic, Christian Dina, Joel F. Habener, Philippe Froguel. (1999) Defective mutations in the insulin promoter factor-1 (IPF-1) gene in late-onset type 2 diabetes mellitus. Journal of Clinical Investigation 104:9, R41-R48
CrossRef120
M. C. Y. Ng, B. N. Cockburn, T. H. Lindner, V. T. F. Yeung, C. -C. Chow, W. -Y. So, J. K. Y. Li, Y. M. D. Lo, Z. S. K. Lee, C. S. Cockram, J. A. J. H. Critchley, G. I. Bell, J. C. N. Chan. (1999) Molecular genetics of diabetes mellitus in Chinese subjects: identification of mutations in glucokinase and hepatocyte nuclear factor-1alpha genes in patients with early-onset Type 2 diabetes mellitus/MODY. Diabetic Medicine 16:11, 956-963
CrossRef121
(1999) Original Articles: 6. Diabetic Medicine 16:9, 779-792
CrossRef122
Pamela M. Thomas. (1999) GENETIC MUTATIONS AS A CAUSE OF HYPERINSULINEMIC HYPOGLYCEMIA IN CHILDREN. Endocrinology & Metabolism Clinics of North America 28:3, 647-656
CrossRef123
Collins, Francis S., . (1999) Medical and Societal Consequences of the Human Genome Project. New England Journal of Medicine 341:1, 28-37
Full Text124
Peter A. Antinozzi, Hal K. Berman, Robert M. O'Doherty, Christopher B. Newgard. (1999) METABOLIC ENGINEERING WITH RECOMBINANT ADENOVIRUSES. Annual Review of Nutrition 19:1, 511-544
CrossRef125
J. N. Livingston. (1999) Genetically engineered mice in drug development. Journal of Internal Medicine 245:6, 627-635
CrossRef126
David A. Bender. (1999) Optimum nutrition: thiamin, biotin and pantothenate. Proceedings of the Nutrition Society 58:02, 427-433
CrossRef127
Andrew T Hattersley, John E Tooke. (1999) The fetal insulin hypothesis: an alternative explanation of the association of low bir thweight with diabetes and vascular disease. The Lancet 353:9166, 1789-1792
CrossRef128
Philippe Froguel, Gilberto Velho. (1999) Molecular Genetics of Maturity-onset Diabetes of the Young. Trends in Endocrinology & Metabolism 10:4, 142-146
CrossRef129
M. T. Malecki, Y. Yang, A. Antonellis, S. Curtis, J. H. Warram, A. S. Krolewski. (1999) Identification of new mutations in the hepatocyte nuclear factor 4a gene among families with early onset Type 2 diabetes mellitus. Diabetic Medicine 16:3, 193-200
CrossRef130
Hee-Sook Jun, Hak Yeon Bae, Byoung Rai Lee, Kwang Sam Koh, Young Soo Kim, Kwan Woo Lee, Hyun-man Kim, Ji-Won Yoon. (1999) Pathogenesis of non-insulin-dependent (type II) diabetes mellitus (NIDDM) – genetic predisposition and metabolic abnormalities. Advanced Drug Delivery Reviews 35:2-3, 157-177
CrossRef131
K Sankaranarayanan, R Chakraborty, E.A Boerwinkle. (1999) Ionizing radiation and genetic risks. Mutation Research/Reviews in Mutation Research 436:1, 21-57
CrossRef132
Christen M. Anderson. (1999) Mitochondrial dysfunction in diabetes mellitus. Drug Development Research 46:1, 67-79
CrossRef133
Gérard Emilien, Jean-Marie Maloteaux, Michel Ponchon. (1999) Pharmacological Management of Diabetes. Pharmacology & Therapeutics 81:1, 37-51
CrossRef134
PR Njølstad, BN Cockburn, GI Bell, O Søvik. (1998) A missense mutation, Val62Ala, in the glucokinase gene in a Norwegian family with maturity-onset diabetes of the young. Acta Paediatrica 87:8, 853-856
CrossRef135
Fatima Bosch, Anna Pujol, Alfons Valera. (1998) TRANSGENIC MICE IN THE ANALYSIS OF METABOLIC REGULATION. Annual Review of Nutrition 18:1, 207-232
CrossRef136
L Agius. (1998) The physiological role of glucokinase binding and translocation in hepatocytes. Advances in Enzyme Regulation 38:1, 303-331
CrossRef137
Richard E. Pratley. (1998) Gene–environment interactions in the pathogenesis of type 2 diabetes mellitus: lessons learned from the Pima Indians. Proceedings of the Nutrition Society 57:02, 175-181
CrossRef138
B.E. Hayward, N. Dunlop, S. Intody, J.P. Leek, A.F. Markham, J.P. Warner, D.T. Bonthron. (1998) Organization of the Human Glucokinase Regulator GeneGCKR. Genomics 49:1, 137-142
CrossRef139
C. Vanhoutte, W.J. Malaisse. (1998) Energy-Dependent Intracellular Translocation of Glucokinase in Rat Pancreatic Islets. Molecular Genetics and Metabolism 63:3, 176-182
CrossRef140
Tamio Ohno, Futoshi Yoshida, Yasuaki Ichikawa, Seiichi Matsuo, Nigishi Hotta, Mamoru Terada, Shin Tanaka, Kazuo Yamashita, Takao Namikawa, Junzoh Kitoh. (1998) A new spontaneous animal model of NIDDM without obesity in the musk shrew. Life Sciences 62:11, 995-1006
CrossRef141
Glaser, Benjamin, Kesavan, Prebakaran, Heyman, MozhganDavis, Elizabeth, Cuesta, Antonio, Buchs, Andreas, Stanley, Charles A., Thornton, Paul S., Permutt, M. Alan, Matschinsky, Franz M., Herold, Kevan C., . (1998) Familial Hyperinsulinism Caused by an Activating Glucokinase Mutation. New England Journal of Medicine 338:4, 226-230
Full Text142
Yasuo Nara, Ming Gao, Kazumi Ikeda, Toshiaki Sato, Makoto Sawamura, Kazuya Kawano, Yukio Yamori. (1997) Genetic Analysis of Non-insulin-Dependent Diabetes Mellitus in the Otsuka Long–Evans Tokushima Fatty Rat. Biochemical and Biophysical Research Communications 241:1, 200-204
CrossRef143
Laura del Bosque-Plata, Eduardo García-García, Salvador Ramírez-Jiménez, Javier Cabello-Villegas, Laura Riba, Amir Gómez-León, Gerardo Vega-Hernández, Nelly Altamirano-Bustamante, Raul Calzada-León, Carlos Robles-Valdés, Fernando Mendoza-Morfín, Oliva Curiel-Pérez, M. Teresa Tusié-Luna. (1997) Analysis of the glucokinase gene in Mexican families displaying early-onset non-insulin-dependent diabetes mellitus including MODY families. American Journal of Medical Genetics 72:4, 387-393
CrossRef144
A. T. Hattersley, P. M. Clark, R. Page, J. C. Levy, L. Cox, C. N. Hales, R. C. Turner. (1997) Glucokinase deficiency results in a beta-cell disorder characterised by normal fasting plasma proinsulin concentrations. Diabetologia 40:11, 1367-1368
CrossRef145
J.Michael Moates, Catherine Postic, Jean-Francois Decaux, Jean Girard, Mark A. Magnuson. (1997) Variable Expression of Hepatic Glucokinase in Mice Is Due to a Regulational Locus That Cosegregates with the Glucokinase Gene. Genomics 45:1, 185-193
CrossRef146
Matthew C. Riddle. (1997) TACTICS FOR TYPE II DIABETES. Endocrinology & Metabolism Clinics of North America 26:3, 659-677
CrossRef147
F.M. Matschinsky, H.W. Collins. (1997) Essential biochemical design features of the fuel-sensing system in pancreatic β-cells. Chemistry & Biology 4:4, 249-257
CrossRef148
Hannele Yki-Järvinen. (1997) MODY genes and mutations in hepatocyte nuclear factors. The Lancet 349:9051, 516-517
CrossRef149
Leif C. Groop, Tiinamaija Tuomi. (1997) Non-insulin-dependent Diabetes Mellitus - A Collision between Thrifty Genes and an Affluent Society. Annals of Medicine 29:1, 37-53
CrossRef150
Mary-Elizabeth Patti, C.Ronald Kahn. (1996) Lessons from transgenic and knockout animals about noninsulin-dependent diabetes mellitus. Trends in Endocrinology & Metabolism 7:9, 311-319
CrossRef151
Makiko Ogata, Naoko Iwasaki, Hisako Ohgawara, Sachiyo Karibe, Yasue Omori. (1996) Absence of the Gly40-Ser mutation in the glucagon receptor gene in Japanese subjects with NIDDM. Diabetes Research and Clinical Practice 33:2, 71-74
CrossRef152
F. Shimada, H. Makino, N. Hashimoto, H. Iwaoka, M. Taira, O. Nozaki, A. Kanatsuka, C. Holm, D. Langin, Y. Saito. (1996) Detection of an amino acid polymorphism in hormone-sensitive lipase in Japanese subjects. Metabolism 45:7, 862-864
CrossRef153
C.L. Hanis, E. Boerwinkle, R. Chakraborty, D.L. Ellsworth, P. Concannon, B. Stirling, V.A. Morrison, B. Wapelhorst, R.S. Spielman, K.J. Gogolin-Ewens, J.M. Shephard, S.R. Williams, N. Risch, D. Hinds, N. Iwasaki, M. Ogata, Y. Omori, C. Petzold, H. Rietzsch, H.-E. Schröder, J. Schulze, N.J. Cox, S. Menzel, V.V. Boriraj, X. Chen, L.R. Lim, T. Lindner, L.E. Mereu, Y.-Q. Wang, K. Xiang, K. Yamagata, Y. Yang, G.I. Bell. (1996) A genome–wide search for human non–insulin–dependent (type 2) diabetes genes reveals a major susceptibility locus on chromosome 2. Nature Genetics 13:2, 161-166
CrossRef154
Flier, Jeffrey S., Underhill, Lisa H., Polonsky, Kenneth S., Sturis, Jeppe, Bell, Graeme I., . (1996) Non-Insulin-Dependent Diabetes Mellitus — A Genetically Programmed Failure of the Beta Cell to Compensate for Insulin Resistance. New England Journal of Medicine 334:12, 777-783
Full Text155
Vincent Poitout, D, R. Paul Robertson, M.D. (1996) AN INTEGRATED VIEW OF β-CELL DYSFUNCTION IN TYPE-II DIABETES. Annual Review of Medicine 47:1, 69-83
CrossRef156
Eberhard Ritz, Adam Stefanski. (1996) Diabetic nephropathy in type II diabetes. American Journal of Kidney Diseases 27:2, 167-194
CrossRef157
C. Ronald Kahn, M.D, David Vicent, M.D, Alessandro Doria, M.D., Ph.D. (1996) GENETICS OF NON-INSULIN-DEPENDENT (TYPE-II) DIABETES MELLITUS. Annual Review of Medicine 47:1, 509-531
CrossRef158
W. J. Schnedl, H. E. Hohmeier, C. B. Newgard. (1996) Insulinsezernierende Zellen zur Therapie des Diabetes mellitus. Naturwissenschaften 83:1, 1-5
CrossRef159
Kim M. Summers. (1996) Relationship between genotype and phenotype in monogenic diseases: Relevance to polygenic diseases. Human Mutation 7:4, 283-293
CrossRef160
Lee-Ming Chuang, Huey-Peir Wu, Ken C. Chiu, Chuen-Shiang Lai, Tong-Yuan Tai, Boniface J. Lin. (1995) Mitochondrial gene mutations in familial non-insulin-dependent diabetes mellitus in Taiwan. Clinical Genetics 48:5, 251-254
CrossRef161
Andrew Grupe, Bruce Hultgren, Anne Ryan, Yan Hui Ma, Michele Bauer, Timothy A. Stewart. (1995) Transgenic knockouts reveal a critical requirement for pancreatic β cell glucokinase in maintaining glucose homeostasis. Cell 83:1, 69-78
CrossRef162
Huey-Peir Wu, Tong-Yuan Tai, Lee-Ming Chuang, Ken C. Chiu, Boniface J. Lin. (1995) CA-repeated microsatellite polymorphism of the glucokinase gene and its association with non-insulin-dependent diabetes mellitus in Taiwanese. Diabetes Research and Clinical Practice 30:1, 21-26
CrossRef163
Joni H. Hansson, Carol Nelson-Williams, Hiroshi Suzuki, Laurent Schild, Richard Shimkets, Yin Lu, Cecilia Canessa, Tadaaki Iwasaki, Bernard Rossier, Richard P. Lifton. (1995) Hypertension caused by a truncated epithelial sodium channel γ subunit: genetic heterogeneity of Liddle syndrome. Nature Genetics 11:1, 76-82
CrossRef164
Y. Zhang, M. Warren-Perry, P. J. Saker, A. T. Hattersley, A. D. R. Mackie, J. D. Baird, R. H. Greenwood, M. Stoffel, G. I. Bell, R. C. Turner. (1995) Candidate gene studies in pedigrees with maturity-onset diabetes of the young not linked with glucokinase. Diabetologia 38:9, 1055-1060
CrossRef165
J. P. Warner, J. P. Leek, S. Intody, A. F. Markham, D. T. Bonthron. (1995) Human glucokinase regulatory protein (GCKR): cDNA and genomic cloning, complete primary structure, and chromosomal localization. Mammalian Genome 6:8, 532-536
CrossRef166
T. Tao, Y. Tanizawa, A. Matsutani, A. Matsubara, T. Kaneko, K. Kaku. (1995) HepG2/erythrocyte glucose transporter (GLUT1) gene in NIDDM: a population association study and molecular scanning in Japanese subjects. Diabetologia 38:8, 942-947
CrossRef167
Timothy J. Aitman, John A. Todd. (1995) Molecular genetics of diabetes mellitus. Baillière's Clinical Endocrinology and Metabolism 9:3, 631-656
CrossRef168
M. Laakso, M. Malkki, P. Kek
CrossRef169
Anne Thorburn, Anne Litchfield, Suzanne Fabris, Joseph Proietto. (1995) Abnormal transient rise in hepatic glucose production after oral glucose in non-insulin-dependent diabetic subjects. Diabetes Research and Clinical Practice 28:2, 127-135
CrossRef170
C. B. Chan, R. M. MacPhail, M. T. Kibenge, J. C. Russell. (1995) Increased glucose phosphorylating activity correlates with insulin secretory capacity of male JCR:LA-corpulent rat islets. Canadian Journal of Physiology and Pharmacology 73:4, 501-508
CrossRef171
Martine Vaxillaire, Valérie Boccio, Anne Philippi, Corinne Vigouroux, Joe Terwilliger, Philippe Passa, Jacques S. Beckmann, Gilberto Velho, G. Mark Lathrop, Philippe Froguel. (1995) A gene for maturity onset diabetes of the young (MODY) maps to chromosome 12q. Nature Genetics 9:4, 418-423
CrossRef172
J. Hager, L. Hansen, C. Vaisse, N. Vionnet, A. Philippi, W. Poller, G. Velho, C. Carcassi, L. Contu, C. Julier, F. Cambien, P. Passa, M. Lathrop, W. Kindsvogel, F. Demenais, E. Nishimura, P. Froguel. (1995) A missense mutation in the glucagon receptor gene is associated with non–insulin–dependent diabetes mellitus. Nature Genetics 9:3, 299-304
CrossRef173
R.C.L. Page, J.C. Levy, B. Barrow, R.C. Turner, P. Patel, A.T. Hattersley, D. Lo, J.S. Wainscoat, M.A. Permutt, G.I. Bell. (1995) Clinical Characteristics of Subjects with a Missense Mutation in Glucokinase. Diabetic Medicine 12:3, 209-217
CrossRef174
T. Hirashima, K. Kawano, S. Mori, K. Matsumoto, T. Natori. (1995) A diabetogenic gene (ODB-1) assigned to the X-chromosome in OLETF rats. Diabetes Research and Clinical Practice 27:2, 91-96
CrossRef175
Philippe Froguel, Jörg Hager. (1995) Human diabetes and obesity: tracking down the genes. Trends in Biotechnology 13:2, 52-55
CrossRef176
F. Shimada, H. Makino, H. Iwaoka, S. Miyamoto, N. Hashimoto, A. Kanatsuka, G. I. Bell, S. Yoshida. (1995) Identification of two novel amino acid polymorphisms in beta-cell/liver (GLUT2) glucose transporter in Japanese subjects. Diabetologia 38:2, 211-215
CrossRef177
N. Iwasaki, H. Ohgawara, H. Nagahara, M. Kawamura, G. I. Bell, Y. Omori. (1995) Characterization of Japanese families with early-onset type 2 (non-insulin dependent) diabetes mellitus and screening for mutations in the glucokinase and mitochondrial tRNALeu(UUR) genes. Acta Diabetologica 32:1, 17-22
CrossRef178
JF Blicklé, I Robillart, JM Brogard. (1995) Etiopathogénie du diabète non insulinodépendant. La Revue de Médecine Interne 16:1, 20-30
CrossRef179
E. Dow, S.V. Gelding, E. Skinner, J.E. Hewitt, I.P. Gray, H. Mather, R. Williamson, D.G. Johnston. (1994) Genetic Analysis of Glucokinase and the Chromosome 20 Diabetes Susceptibility Locus in Families with Type 2 Diabetes. Diabetic Medicine 11:9, 856-861
CrossRef180
C. Laurino, S. Bertolinib, R. Cordera. (1994) Linkage analysis does not support a role for glucokinase gene in the aetiology of type 2 diabetes mellitus among North Western Italians. Molecular and Cellular Endocrinology 104:2, 147-151
CrossRef181
B. Glaser, K.C. Chiu, R. Anker, A. Nestorowicz, H. Landau, H. Ben-Bassat, Z. Shlomai, N. Kaiser, P.S. Thornton, C.A. Stanley, R.S. Spielman, K. Gogolin-Ewens, E. Cerasi, L. Baker, J. Rice, H. Donis-Keller, M.A. Permutt. (1994) Familial hyperinsulinism maps to chromosome 11p14–15.1, 30 cM centromeric to the insulin gene. Nature Genetics 7:2, 185-188
CrossRef182
Edward R. B. McCabe. (1994) Microcompartmentation of energy metabolism at the outer mitochondrial membrane: Role in diabetes mellitus and other diseases. Journal of Bioenergetics and Biomembranes 26:3, 317-325
CrossRef183
H. Katagiri, I. Asano, H. Ishihara, K. Inukai, M. Anai, Y. Yazaki, Y. Oka, T. Yamanouchi, K. Isukuda, M. Kikuchi, H. itaoka, N. Ohsawa. (1994) Mitochondrial diabetes mellitus: Prevalence and clinical characterization of diabetes due to mitochondrial tRNALeU(UUR) gene mutation in Japanese patients. Diabetologia 37:5, 504-510
CrossRef184
Kadowaki, TakashiKadowaki, HirokoMori, YasumichiTobe, KazuyukiSakuta, RyoichiSuzuki, YoshihikoTanabe, YuzoSakura, HiroshiAwata, TakuyaGoto, Yu-ichiHayakawa, TakakiMatsuoka, KenpeiKawamori, RyuzoKamada, TakenobuHorai, SatoshiNonaka, IkuyaHagura, RyokoAkanuma, YasuoYazaki, Yoshio. (1994) A Subtype of Diabetes Mellitus Associated with a Mutation of Mitochondrial DNA. New England Journal of Medicine 330:14, 962-968
Full Text185
Kiyoshi Takekawa, Hiroshi Ikegami, Masahiro Fukuda, Hironori Ueda, Yoshihiko Kawaguchi, Yoshihiko Fujioka, Tomomi Fujisawa, Toshio Ogihara. (1994) Early-onset type 2 (non-insulin-dependent) diabetes mellitus is associated with glucokinase locus, but not with adenosine deaminase locus, in the Japanese population. Diabetes Research and Clinical Practice 23:3, 141-146
CrossRef186
Y. Tanizawa, A. C. Riggs, K. C. Chiu, R. C. Janssen, D. S. H. Bell, R. P. C. Go, J. M. Roseman, R. T. Acton, M. A. Permutt. (1994) Variability of the pancreatic islet beta cell/liver (GLUT 2) glucose transporter gene in NIDDM patients. Diabetologia 37:4, 420-427
CrossRef187
S. Nishi, S. Hinata, T. Matsukage, J. Takeda, A. Ichiyama, G.I. Bell, T. Yoshimi. (1994) Mutations in the Glucokinase Gene are not a Major Cause of Late-onset Type 2 (Non-insulin-dependent) Diabetes Mellitus in Japanese subjects. Diabetic Medicine 11:2, 193-197
CrossRef188
M.I. McCarthy, G.A. Hitman, M. Hitchins, A. Riikonen, J. Stengård, A. Nissinen, E. Tuomilehto-Wolf, J. Tuomilehto. (1994) Glucokinase Gene Polymorphisms: a Genetic Marker for Glucose Intolerance in a Cohort of Elderly Finnish Men. Diabetic Medicine 11:2, 198-204
CrossRef189
Mike MUECKLER. (1994) Facilitative glucose transporters. European Journal of Biochemistry 219:3, 713-725
CrossRef190
S. C. Elbein, M. Hoffman, H. Qin, K. Chiu, Y. Tanizawa, M. A. Permutt. (1994) Molecular screening of the glucokinase gene in familial Type 2 (non-insulin-dependent) diabetes mellitus. Diabetologia 37:2, 182-187
CrossRef191
K. C. Chiu, R. C. P. Go, M. Aoki, A. C. Riggs, Y. Tanizawa, R. T. Acton, D. S. H. Bell, R. L. Goldenberg, J. M. Roseman, M. A. Permutt. (1994) Glucokinase gene in gestational diabetes mellitus: population association study and molecular scanning. Diabetologia 37:1, 104-110
CrossRef192
JoukeT. Tamsma, GerardP. Pasma, FokkoJ. van der Woude, HeinG Gooszen, HermanH.P.J. Lemkes. (1994) Transfer of non-insulin-dependent diabetes to a pancreas transplant recipient. The Lancet 343:8889, 111-112
CrossRef193
Stefan S. Fajans, Graeme I. Bell, Donald W. Bowden, Jeffrey B. Halter, Kenneth S. Polonsky. (1994) Maturity-onset diabetes of the young. Life Sciences 55:6, 413-422
CrossRef194
G Mark Lathrop. (1993) Genetic approaches to common diseases. Current Opinion in Biotechnology 4:6, 678-683
CrossRef195
Nathalie Vionnet, Philippe Passa, Philippe Froguel. (1993) Prevalence of mitochondrial gene mutations in families with diabetes mellitus. The Lancet 342:8884, 1429-1430
CrossRef196
M. Lehto, K. Xiang, M. Stoffel, R. Espinosa, L. C. Groop, M. M. Beau, G. I. Bell. (1993) Human hexokinase II: localization of the polymorphic gene to chromosome 2. Diabetologia 36:12, 1299-1302
CrossRef197
F. M. Matschinsky, P. J. Randle. (1993) Evolution of the glucokinase glucose sensor paradigm for pancreatic beta cells. Diabetologia 36:11, 1215-1217
CrossRef198
Stephen O'Rahilly. (1993) Glucokinase and non-insulin-dependent diabetes. Clinical Endocrinology 39:1, 17-19
CrossRef199
H. Sakura, R. Kawamori, M. Kubota, T. Morishima, T. Kamada, Y. Akanuma, Y. Yazaki, T. Kadowaki. (1993) Glucokinase gene mutation and impaired glucose uptake by liver. The Lancet 341:8859, 1532-1533
CrossRef200
Graeme I. Bell, Philippe Froguel, Shigeo Nishi, Simon J. Pilkis, Markus Stoffel, Jun Takeda, Nathalie Vionnet, Kazuki Yasuda. (1993) Mutations of the human glucokinase gene and diabetes mellitus. Trends in Endocrinology & Metabolism 4:3, 86-90
CrossRef201
Weir, Gordon C., . (1993) A Defective Beta-Cell Glucose Sensor as a Cause of Diabetes. New England Journal of Medicine 328:10, 729-731
Full Text
