Original Article
Prevalence of Hepatitis C Virus RNA in Organ Donors Positive for Hepatitis C Antibody and in the Recipients of Their Organs
N Engl J Med 1992; 327:910-915September 24, 1992
- Abstract
- Abstract
Background.
There is a high prevalence of liver disease among the recipients of organs from donors with antibodies to hepatitis C virus (HCV). We undertook a study to determine the frequency of persistent HCV infection, as indicated by the presence of HCV RNA, among both cadaveric organ donors positive for antibodies to HCV (anti-HCV) and the recipients of organs from these donors.
Methods.
Serum samples from donors and recipients were tested for HCV RNA with the reverse transcriptase polymerase chain reaction, with use of primers from the 5′ untranslated region of the HCV genome, and for anti-HCV with the first-generation enzyme-linked immunosorbent assay (ELISA) and two second-generation tests.
Results.
HCV RNA was detected in 9 of the 11 organ donors (82 percent) with a positive first-generation ELISA for anti-HCV. Among the organ recipients, the prevalence of HCV RNA increased after transplantation: 7 of 26 patients (27 percent) had positive samples before transplantation, as compared with 23 of 24 patients (96 percent) after transplantation (P<0.001). Among 13 recipients who were HCV RNA—negative before receiving organs from the nine HCV RNA—positive donors, HCV infection was detected in all 13 after transplantation, and anti-HCV developed in 8 (62 percent). On the basis of a positive test for HCV RNA, the maximal sensitivity of the three anti-HCV tests was 57 percent (positive in 4 of 7 patients with end-stage organ failure) before transplantation and 70 percent (positive in 16 of 23 patients) after transplantation.
Conclusions.
Nearly all the recipients of organs from anti-HCV—positive donors become infected with HCV. The current tests for anti-HCV antibodies underestimate the incidence of transmission and the prevalence of HCV infection among immunosuppressed organ recipients. (N Engl J Med 1992;327:910–5.)
Article Activity
- Article
VIRUSES are an important cause of liver disease in organ-transplant recipients.1 , 2 The cloning of the genome for hepatitis C virus (HCV), the principal cause of parenterally transmitted non-A, non-B hepatitis, and the development of a test for antibodies to HCV (anti-HCV)3 , 4 made possible study of the role of HCV in liver disease after transplantation. The transmission of the virus by the transfusion of blood products from anti-HCV—positive donors has been demonstrated unequivocally,4 5 6 7 and preliminary data also strongly support sexual, vertical, and intrafamilial transmission.8 9 10 11 After parenteral exposure to HCV, seroconversion usually occurs within three months, but may take as long as one year6 , 7 and may be associated with either clearing or persistence of the virus. Moreover, viremia may persist in some patients without a sustained antibody response.5 Hence, the polymerase chain reaction (PCR) is currently used to detect HCV RNA in the serum and thus the presence of an ongoing HCV infection.5
We have previously demonstrated a high prevalence of liver disease in recipients of organs from anti-HCV—positive cadaveric donors, strongly suggesting the transmission of HCV by organ transplantation.12 The results of that study also raised several questions. First, according to the first-generation enzyme-linked immunosorbent assay (ELISA), anti-HCV was present in only 62 percent of recipients with post-transplantation liver disease. However, patients who had liver disease but were negative for anti-HCV had other markers of HCV infection. This indicates that the first-generation anti-HCV test underestimates the prevalence of HCV infection among recipients of organs from anti-HCV—positive donors. Second, post-transplantation liver disease was detected in the recipients of organs from only 75 percent of the anti-HCV—positive donors, suggesting that in some such donors the condition may not be infectious. Third, among the recipients of organs from donors who had apparently transmitted HCV infection, post-transplantation liver disease developed in only 67 percent, indicating that recipients may not be uniformly susceptible to HCV infection. To clarify these issues we examined serum from anti-HCV—positive cadaveric donors and recipients of organs from these donors before and after transplantation for the presence of HCV RNA. In addition, we compared the ability of the first- and second-generation anti-HCV assays to detect HCV infection in these two groups.
Methods
Patients
The New England Organ Bank is an organ-procurement organization serving 14 transplantation centers in six states. Stored serum samples obtained from 716 cadaveric organ donors from 1986 to 1990 were screened for anti-HCV with a first-generation ELISA (HCV ELISA Test System, Ortho Diagnostic Systems, Raritan, N.J.) at Brigham and Women's Hospital in Boston, and 13 anti-HCV—positive donors were identified. Twenty-nine recipients of organs (kidneys, hearts, or livers) from these donors were identified. The recipients' pretransplantation and post-transplantation records were reviewed by one investigator, with the cooperation of the treating physicians, to determine whether liver disease was present and, if so, its cause and clinical and pathologic features. Liver disease was defined as previously described.12 Pretransplantation serum samples stored at -70°C at the New England Organ Bank or other tissue-typing laboratories were used to test for markers of HCV infection. Post-transplantation tests for HCV infection were performed on serum samples obtained at the most recent follow-up visit. For patients who had died after transplantation, the most recent sample of stored serum, if available, was tested for anti-HCV. The prevalence of post-transplantation liver disease and anti-HCV (with use of the first-generation ELISA) in these recipients has been reported previously.12 Serum samples from 11 of the 13 anti-HCV—positive donors were available for further testing, as were pretransplantation samples from 26 recipients and post-transplantation samples from 24 recipients.
Laboratory Tests
Donor serum samples and samples obtained from recipients before and after transplantation were tested for anti-HCV with a second-generation ELISA (HCV ELISA 2.0 Test System, Ortho) and a second-generation strip immunoblot assay (RIBA HCV Test System, Chiron, Emeryville, Calif.) at the Diagnostics Development Department of Chiron Corporation. Samples were tested for HCV RNA with the reverse transcriptase PCR reaction at the Nucleic Acid Chemistry Department of Chiron Corporation. To prevent bias, the serum samples were coded so that the laboratory personnel could not distinguish the source of the samples, and the personnel at each laboratory were unaware of the results of other assays.
Reverse Transcriptase PCR Reaction
RNA was extracted and precipitated from 100 μl of a serum or plasma sample according to the RNazol B method (Cinna/Biotecx Laboratories, Friendswood, Tex.).13 Reverse transcription and PCR were performed according to the methods described in the Gene Amp RNA PCR Kit (Perkin—Elmer Cetus, Emeryville, Calif). The primers were from the 5′ untranslated region of HCV14 (synthesis of complementary DNA [cDNA] and downstream primer, 5′CCCAACACTACTCGGCTAG3′; upstream primer, 5′AACTACTGTCTTCACGCAGAAAGC3′). Recommended procedures for avoiding contamination were followed.15
The amplified PCR product was detected by liquid oligomer hybridization16 of the amplified product with a probe end-labeled with 32P (5′GCCATGGCGTTAGTATGAGTGTC3′) that was located between but did not include the cDNA or PCR primers. Specimens were run in duplicate through the reverse transcription, amplification, and detection steps, and the procedure was repeated if only one of the replicates produced a detectable band of the proper size.
The bands on the autoradiograph were compared with that of the positive control to determine whether they were of the same apparent molecular weight. If bands were detected in the negative-control or water-control lane, the run was repeated. The specimens were run in duplicate. If the replicates matched, the test was not repeated. The results were classified as positive (HCV RNA detected), negative (HCV RNA not detected), or indeterminate. For the purposes of this analysis, only samples in which appropriate bands were detected were considered positive.
Anti-HCV Tests
The first-generation ELISA that we used detects antibody to a recombinant HCV antigen (c100) from the nonstructural region of the HCV genome. The second-generation ELISA that we used detects antibody to recombinant HCV antigens derived from three regions (c100, c200, and c22) from the nonstructural and core regions of the HCV genome. Both assays were performed according to the manufacturer's instructions.
The second-generation recombinant immunoblot assay that we used detects antibody to four recombinant HCV antigens (5–1–1, c100, c33, and c22) from the nonstructural and core regions of the HCV genome. This assay was used to test serum samples judged to be positive on first-generation ELISA as well as those found to be negative. The assays were carried out according to the manufacturer's instructions. In brief, the reactivity of the specimens to each antigen was graded according to a five-point scale, in which a score of 0 represented no reactivity and a score of 4+ the most reactivity, by visually comparing the intensity of the individual antigen band with that of the low-IgG and high-IgG internal-control bands located on each strip. A band with no score of 1+ or higher was classified as nonreactive. A band with a score of 1+ or higher in response to any two antigens was classified as reactive. A band with a score of 1+ or higher in response to only one antigen was classified as indeterminate. The specificity of the second-generation immunoblot assay has been improved by reducing the amount of the c100 antigen in the immunoblot strip.17 Therefore, for the purposes of this analysis, in a high-risk population, both indeterminate and reactive results were considered positive.
Statistical Analysis
Statistical analysis was performed with the Systat software package (Systat, Evanston, Ill.). Results of Fisher's exact test are reported. Differences between groups were considered significant when the two-tailed P value was 0.05 or less.
Results
Prevalence of HCV RNA in Donors and Recipients
HCV RNA was detected in 9 of the 11 donors (82 percent) with positive results on the first-generation ELISA (Table 1Table 1
Recipients of Organs from Donors Positive for Anti-HCV on First-Generation ELISA.*). Among the recipients, the prevalence of HCV RNA increased significantly after transplantation (P<0.001): 7 of 26 pretransplantation samples (27 percent) were positive, as compared with 23 of 24 post-transplantation samples (96 percent). Of the 14 recipients who were negative for HCV RNA before receiving organs from the nine HCV RNA—positive donors, all 13 for whom post-transplantation serum samples were available tested positive for HCV RNA after receiving an organ. This result confirms that HCV can be transmitted by organ transplantation. Of the three HCV RNA—negative recipients who received organs from one of the two HCV RNA—negative donors, none had evidence of liver disease after transplantation, and HCV RNA was absent after transplantation in the only recipient (Patient K13 in Table 1) for whom serum was available. Thus, a small fraction of the donors with positive results on the first-generation ELISA did not harbor the virus and apparently did not transmit HCV infection.In our earlier study12 we used primers from the nonstructural-3 region to detect HCV RNA in serum samples obtained after transplantation from five recipients (Patients K3, K14, K17, H2, and H4) who had liver disease, but who tested negative for anti-HCV on the first-generation ELISA. Three of these recipients (Patients K3, H2, and H4) tested positive. In the current study we used primers from the 5′ region and found that serum samples from all five of these patients tested positive for HCV RNA.
Prevalence of Anti-HCV among Organ Recipients and Its Relation to Post-Transplantation Liver Disease
As previously reported,12 among recipients of organs from donors with positive results on first-generation ELISA, the overall prevalence of a positive result on first-generation ELISA did not increase significantly after transplantation (27 percent before transplantation as compared with 32 percent afterward, P>0.05). In contrast, the prevalence of positive results on both the second-generation ELISA and the second-generation immunoblot assay increased significantly after transplantation (24 percent before and 67 percent after transplantation, P = 0.004, and 19 percent before and 50 percent after transplantation, P = 0.04, respectively) (Table 2Table 2
Results of Tests for HCV in Organ Recipients with and without Liver Disease after Transplantation.). Of the 13 organ recipients who acquired HCV infection after transplantation, 8 (62 percent) were found to have seroconverted on the basis of serologic tests for anti-HCV (data not shown). This finding provides additional evidence that HCV was transmitted by the donors.Interestingly, in this group of organ recipients with a high prevalence of post-transplantation HCV infection, the prevalence of anti-HCV increased significantly after transplantation only in the subgroup in which liver disease developed. This finding suggests that the development of antibody may be related to the pathogenesis of liver disease.
Usefulness of Anti-HCV for the Detection of HCV Infection
Organ Donors
Both the second-generation immunoblot assay and the second-generation ELISA were positive in all nine donors with positive results on the first-generation ELISA (Table 3Table 3
Results of the First-Generation ELISA, Second-Generation ELISA, and Second-Generation Immunoblot Assay in Organ Donors and Recipients, According to the PCR Results.). Therefore, a positive test for anti-HCV in cadaveric organ donors was associated with an 82 percent likelihood of persistent HCV infection.Organ Recipients
HCV RNA was detected by PCR in 7 of the 26 recipients (27 percent) for whom pretransplantation serum samples were available for testing (Table 3). Among these seven, three (43 percent) tested positive for anti-HCV on the first-generation ELISA, four (57 percent) on the second-generation ELISA, and four (57 percent) on the second-generation immunoblot assay (Table 3). Among the 19 patients without HCV RNA, 15 (79 percent) tested negative for anti-HCV on the first-generation ELISA, 16 (89 percent — only 18 of 19 samples were available for analysis) on the second-generation ELISA, and 18 (95 percent) on the second-generation immunoblot assay. Thus, in this small sample of patients with end-stage organ failure, the sensitivity of the first-generation ELISA, second-generation ELISA, and second-generation immunoblot assay was 43, 57, and 57 percent, respectively. The specificity of the three tests was 79, 89, and 95 percent, respectively.
HCV RNA was detected by PCR in 23 of the 24 organ recipients (96 percent) for whom post-transplantation serum samples were available for testing. Among these 23 patients, 8 (35 percent) tested positive for anti-HCV on the first-generation ELISA, 16 (70 percent) on the second-generation ELISA, and 12 (52 percent) on the second-generation immunoblot assay. The sole organ recipient without HCV RNA tested negative on all three assays. Thus, in this small sample of transplant recipients, the sensitivity of the first-generation ELISA, second-generation ELISA, and second-generation immunoblot assay was 35, 70, and 52 percent, respectively. Among the 13 recipients who acquired HCV infection after transplantation, the incidence of seroconversion for anti-HCV was 23, 54, and 46 percent on the first-generation ELISA, second-generation ELISA, and second-generation immunoblot assay, respectively. Since only one recipient tested negative for HCV RNA, the specificity of the anti-HCV tests could not be assessed.
Discussion
We have previously reported a 2 percent prevalence of anti-HCV among cadaveric organ donors at the New England Organ Bank and a 48 percent prevalence of post-transplantation non-A, non-B hepatitis among the recipients of organs from these donors.12 The prevalence of liver disease in that study was 7.4 times greater than the 6 percent prevalence among recipients of organs from untested donors reported by two member institutions of the New England Organ Bank.1 , 18 All but one organ recipient with post-transplantation liver disease had evidence of HCV infection. In the present study, using the reverse transcriptase PCR reaction with primers from the 5′ end of the HCV genome, we found an 82 percent prevalence of HCV RNA among cadaveric organ donors with positive results on the first-generation ELISA. Among the HCV RNA—negative recipients of organs from HCV RNA—positive donors, we found a 100 percent incidence of post-transplantation HCV infection, irrespective of the presence of post-transplantation liver disease (Table 1). Furthermore, none of the HCV RNA—negative recipients of organs from HCV RNA—negative donors had liver disease or HCV RNA after transplantation. These results confirm our previous conclusion that HCV can be transmitted by organ transplantation.
Because of the high prevalence of liver disease among recipients of organs from anti-HCV—positive donors, the New England Organ Bank adopted a policy restricting the use of organs from these donors to life-saving procedures (transplantation of a heart, liver, or lung).12 A similar policy was recommended by the Public Health Service interagency guidelines.19 However, Roth and colleagues have reported a lower prevalence of liver disease,20 and Diethelm et al. have argued against restricting organ donation by persons with a positive first-generation test for anti-HCV until more information is available about the prevalence of HCV RNA among anti-HCV—positive donors and recipients of organs from these donors.21 The results of our study support the current policy of the New England Organ Bank. This policy will be reevaluated in view of the results of an ongoing nationwide study on the clinical characteristics and prevalence of HCV RNA in anti-HCV—positive donors.22
It has recently been suggested that organs from anti-HCV—positive donors might be transplanted safely into anti-HCV—positive recipients.23 However, this approach may not be advisable for several reasons. First, we have previously shown that among recipients of organs from anti-HCV—positive donors, the prevalence of post-transplantation liver disease was the same among those who had anti-HCV before transplantation and those who did not.12 Second, the antibodies detected by the currently available anti-HCV tests are not neutralizing antibodies; thus, they do not confer immunity. Third, the anti-HCV tests that we used do not reliably predict the presence or absence of HCV RNA in serum before transplantation. Indeed, in the small number of patients with end-stage organ failure who were awaiting transplantation whom we tested, the sensitivity and specificity of anti-HCV tests ranged from 43 to 57 percent and from 79 to 95 percent, respectively (Table 3). Fourth, evidence is accumulating that there is more than one strain of HCV5 and that infection with one strain may not necessarily protect against infection with another strain. Therefore, current literature and our own data do not attest to the safety of transplanting organs from anti-HCV—positive donors into anti-HCV—positive recipients. Until such data are available, we do not recommend such procedures.
Our results also extend our understanding of the relation between HCV and liver disease in patients with end-stage organ failure and in transplant recipients. A large proportion of patients with HCV infection had no evidence of liver disease. Indeed, liver disease was present in only 1 of the 7 HCV RNA—positive patients (14 percent) with end-stage organ failure and in only 12 of the 23 HCV RNA—positive patients (52 percent) after transplantation (Table 1). The apparent absence of liver disease among patients with HCV infection may be due in part to the strict criteria (based on serum alanine aminotransferase levels)12 that we used to define liver disease. Moreover, serum alanine aminotransferase levels tend to be lower than normal in patients with renal failure,24 25 26 and among renal-transplant recipients with hepatitis B, the correlation between serum aminotransferase levels and liver histologic results is poor.27 Indeed, progressive liver disease has even been documented in recipients who did not have elevated serum alanine aminotransferase levels according to the criteria that we used.27 Furthermore, among patients with post-transfusion hepatitis, the correlation between the presence of HCV RNA and serum alanine aminotransferase levels is also poor, suggesting that viral replication can proceed without serious liver injury.5 Possible explanations for this phenomenon include extrahepatic sites of viral replication, a healthy carrier state, and indolent liver disease.5 The long-term implications of an asymptomatic carrier state for HCV RNA are unclear. Liver disease is the cause of death in 8 to 28 percent of transplant recipients surviving beyond the first decade.28 , 29 Liver disease might eventually develop in organ recipients with HCV RNA in serum but normal serum alanine aminotransferase levels in the first few years after transplantation. Serial liver biopsies will be required to settle this issue.
The course of liver disease in transplant recipients appears to differ from that in patients with post-transfusion hepatitis. In approximately 50 percent of patients with post-transfusion non-A, non-B hepatitis, the disease progresses to chronic liver disease.30 31 32 In contrast, in all our patients with post-transplantation liver disease, the disease progressed to chronic hepatitis or subfulminant liver failure, and in no case was the virus cleared from the serum. We speculate that immunosuppressive therapy in transplant recipients may prevent clearing of the virus and recovery from liver disease. Indeed, Farci et al. also found that the failure to clear serum HCV RNA was associated with the development of chronic post-transfusion HCV infection.5
The antibody response to HCV infection in transplant recipients appears to differ from that in patients with post-transfusion HCV infection. Among the recipients of anti-HCV—positive blood products, 88 percent were positive for anti-HCV on first-generation ELISA.7 In our study, seroconversion occurred in only 62 percent of the HCV RNA—negative recipients of organs from donors with HCV infection. This finding suggests that immunosuppression may impair the anti-HCV response in transplant recipients with HCV infection.
Our results enabled us to evaluate the usefulness of the anti-HCV tests available for the diagnosis of HCV infection in transplant recipients. The sensitivity of these anti-HCV tests ranged from 35 to 70 percent, and the second-generation tests were more sensitive than the first-generation test (Table 3). Furthermore, these tests were more sensitive in immunosuppressed patients with post-transplantation liver disease (58 to 83 percent) than in those without such disease (8 to 50 percent). Therefore, currently available tests that detect anti-HCV significantly underestimate the incidence of transmission of HCV and the role of HCV in post-transplantation liver disease. The ability to make an accurate diagnosis awaits the development of more sensitive tests for anti-HCV and methods to detect HCV RNA for large-scale clinical use.
Supported by a fellowship to Dr. Pereira from the International Society of Nephrology, by the New England Organ Bank, and by the Nephrology Clinical Research Fellowship Training Program of New England Medical Center and St. Elizabeth's Hospitals, Boston.
The following transplantation centers are participants in the New England Organ Bank: Yale–New Haven Hospital, New Haven, Conn.; Maine Medical Center, Portland; Beth Israel Hospital, Brigham and Women's Hospital, Children's Hospital, Massachusetts General Hospital, New England Deaconess Hospital, New England Medical Center, Veterans Affairs Medical Center, and University Hospital, Boston; Lahey Clinic Medical Center, Burlington, Mass.; Baystate Medical Center, Springfield, Mass.; University of Massachusetts Medical Center, Worcester; and the Medical Center Hospital of Vermont, Burlington.
Mr. Sayre is a stockholder in Ortho Diagnostic Systems, and Dr. Quan, Dr. Wilber, and Ms. Johnson are stockholders in Chiron Corporation.
We are indebted to the surgeons, physicians, nurses, transplantation coordinators, technicians, and secretaries of member institutions of the New England Organ Bank, the University of Michigan Hospital, Ann Arbor, and Humana Hospital, San Antonio, Texas, for their assistance.
Source Information
From the New England Organ Bank, Newton, Mass. (B.J.G.P., E.L.M., R.L.K., A.S.L.); Ortho Diagnostic Systems, Raritan, N.J. (K.R.S.); and Chiron Corporation, Emeryville, Calif. (S.Q., P.J.J., J.C.W.). Address reprint requests to Dr. Levey at the New England Organ Bank, 1 Gateway Center, Washington St. at Newton Corner, Newton, MA 02158–2803.
- References
References
1
LaQuaglia
CrossRef | Web of Science | Medline2
Ware
Web of Science | Medline3
Choo
CrossRef | Web of Science | Medline4
Kuo
CrossRef | Web of Science | Medline5
Farci
Full Text | Web of Science | Medline6
Alter
Full Text | Web of Science | Medline7
Esteban
Full Text | Web of Science | Medline8
Hess
CrossRef | Web of Science | Medline9
Giovannini
CrossRef | Web of Science | Medline10
Pérez-Romero
Medline11
Riestra
Web of Science | Medline12
Pereira
Full Text | Web of Science | Medline13
Chomczynski
CrossRef | Web of Science | Medline14
Cha
Web of Science | Medline15
Kwok
CrossRef | Web of Science | Medline16
Abbott
CrossRef | Web of Science | Medline17
Evans
CrossRef | Web of Science | Medline18
Weir
CrossRef | Web of Science | Medline19
Public Health Service inter-agency guidelines for screening donors of blood, plasma, organs, tissues, and semen for evidence of hepatitis B and hepatitis C . MMWR Morb Mortal Wkly Rep 1991;40:Suppl RR-4:1–17.
Medline20
Roth 21
Diethelm
Full Text | Web of Science | Medline22
Pereira BJG, Kirkman RL, Bryan CF, et al. National collaborative study of the prevalence of hepatitis C antibody (anti-HCV) in cadaver organ donors. In: Proceedings of the 11th Annual Meeting of the American Society of Transplant Physicians, Chicago, May 26–27, 1992. Chicago: American Society of Transplant Physicians, 1992:322. abstract.
23
Pirsch
Web of Science | Medline24
Wolf
Web of Science | Medline25
Warnock
Web of Science | Medline26
Cohen
Web of Science | Medline27
Debure
Medline28
Braun
CrossRef | Web of Science | Medline29
Mahony
Web of Science | Medline30
Realdi
CrossRef | Web of Science | Medline31
Rakela
Web of Science | Medline32
Koretz
Web of Science | Medline
- Citing Articles (86)
Citing Articles
1
Hans L. Tillmann. (2012) Acute HCV: Will IL28B Testing Change the Paradigm?. Current Hepatitis Reports
CrossRef2
Hans L. Tillmann, John G. McHutchison. 2012. Hepatitis C. , 564-598.
CrossRef3
Hari S. Conjeevaram, Anna S.F. Lok. 2012. Hepatitis B and C in Non–Liver Transplant Patients. , 700-717.
CrossRef4
Mohammad A. B. Al-Freah, Zeino Zeino, Michael A. Heneghan. (2011) Management of Hepatitis C in Patients with Chronic Kidney Disease. Current Gastroenterology Reports
CrossRef5
Beatriz Domínguez-Gil, Amado Andrés, Jose M. Campistol, Jose M. Morales. (2011) Should we be using kidneys from hepatitis C virus-infected donors?. Current Opinion in Nephrology and Hypertension 20:6, 599-604
CrossRef6
Andrew T. Burr, YouFu Li, Jennifer F. Tseng, Reza F. Saidi, Adel Bozorgzadeh, Shimul A. Shah. (2011) Survival After Liver Transplantation Using Hepatitis C Virus-Positive Donor Allografts: Case-Controlled Analysis of the UNOS Database. World Journal of Surgery 35:7, 1590-1595
CrossRef7
L. M. Kucirka, A. L. Singer, R. L. Ros, R. A. Montgomery, N. N. Dagher, D. L. Segev. (2010) Underutilization of Hepatitis C-Positive Kidneys for Hepatitis C-Positive Recipients. American Journal of Transplantation 10:5, 1238-1246
CrossRef8
Peter Simmonds, David Mutimer. 2010. Hepatitis C Virus. .
CrossRef9
Beatriz Domínguez-Gil, Jose M. Morales. (2009) Transplantation in the patient with hepatitis C. Transplant International 22:12, 1117-1131
CrossRef10
Thorsten Wittwer, Thorsten Wahlers. (2008) Marginal donor grafts in heart transplantation: lessons learned from 25 years of experience. Transplant International 21:2, 113-125
CrossRef11
J Arango, M Arbelaez, J Henao, G Mejia, I Arroyave, J Carvajal, A Garcia, J Gutierrez, A Velásquez, L Garcia, C Aguirre. (2008) Kidney graft survival in patients with hepatitis C: a single center experience. Clinical Transplantation 22:1, 16-19
CrossRef12
Beatriz Domínguez-Gil, Nuria Esforzado, Jose M. Campistol, Amado Andres, Jose M. Morales. (2007) Use of hepatitis C–positive donors for kidney transplantation. Transplantation Reviews 21:4, 195-203
CrossRef13
Luis Sierra Suarez, John C. Richmond. (2007) Overview of Procurement, Processing, and Sterilization of Soft Tissue Allografts for Sports Medicine. Sports Medicine and Arthroscopy Review 15:3, 106-113
CrossRef14
Richard Foster, Michael Zimmerman, James F. Trotter. (2007) Expanding Donor Options: Marginal, Living, and Split Donors. Clinics in Liver Disease 11:2, 417-429
CrossRef15
Santiago Tomé, Julio Pascual, John D. Pirsch, Alexandru Musat, Michael R. Lucey. (2007) Hepatitis C infection in kidney transplantation. Transplantation Reviews 21:2, 86-96
CrossRef16
Juan F. Gallegos-Orozco, Hugo E. Vargas. (2007) Should Antihepatitis B Virus Core Positive or Antihepatitis C Virus Core Positive Subjects Be Accepted as Organ Donors for Liver Transplantation?. Journal of Clinical Gastroenterology 41:1, 66-74
CrossRef17
Steven D. Mawhorter, Robin K. Avery. (2006) Can Donors With Prior Hepatitis Be Safely Used for Heart Transplantation?. The Journal of Heart and Lung Transplantation 25:7, 805-813
CrossRef18
S. Aswad, N. S. Khan, L. Comanor, C. Chinchilla, L. Corado, T. Mone, R. Mendez, R. Mendez. (2005) Role of nucleic acid testing in cadaver organ donor screening: detection of hepatitis C virus RNA in seropositive and seronegative donors. Journal of Viral Hepatitis 12:6, 627-634
CrossRef19
Matthew G. Hartwig, Vijay Patel, Scott M. Palmer, Edward Cantu, James Z. Appel, Robert H. Messier, R Duane Davis. (2005) Hepatitis B Core Antibody Positive Donors as a Safe and Effective Therapeutic Option to Increase Available Organs for Lung Transplantation. Transplantation 80:3, 320-325
CrossRef20
EDWARD GANE. (2004) Renal transplantation in chronic hepatitis C. Journal of Gastroenterology and Hepatology 19:s7, S99-S102
CrossRef21
EHAB W. WAFA, AHMED F. DONIA, BEDEIR ALI-EL-DEIN, AMGAD E. EL AGROUDY, AYMAN RIFAIE, AMANI MOUSTAFA, MOHAMED A. GHONEIM. (2004) EVALUATION AND SELECTION OF POTENTIAL LIVE KIDNEY DONORS. The Journal of Urology 171:4, 1424-1427
CrossRef22
Priya Abraham, George T. John, Sukanya Raghuraman, Sujatha Radhakrishnan, Paulose P. Thomas, Chacko K. Jacob, Gopalan Sridharan. (2003) GB virus C/hepatitis G virus and TT virus infections among high risk renal transplant recipients in India. Journal of Clinical Virology 28:1, 59-69
CrossRef23
John T. H. T. Yu, George K. K. Lau. (2003) Treatment of hepatitis B and C following nonliver organ transplants. Current Hepatitis Reports 2:2, 82-87
CrossRef24
Tommy Yen, Emmet B. Keeffe, Aijaz Ahmed. (2003) The Epidemiology of Hepatitis C Virus Infection. Journal of Clinical Gastroenterology 36:1, 47-53
CrossRef25
Miriam J. Alter. (2002) Prevention of spread of hepatitis C. Hepatology 36:S1, S93-S98
CrossRef26
S.N. Natov, B.J.G. Pereira. (2002) Transmission of viral hepatitis by kidney transplantation: donor evaluation and transplant policies (Part 1: hepatitis B virus). Transplant Infectious Disease 4:3, 124-131
CrossRef27
Svetlozar N. Natov, Brian J. G. Pereira. (2002) Management of Hepatitis C Infection in Renal Transplant Recipients. American Journal of Transplantation 2:6, 483-490
CrossRef28
Sumathi Sivapalasingam, Sharp F. Malak, John F. Sullivan, Jonathan Lorch, Kent A. Sepkowitz. (2002) High Prevalence of Hepatitis C Infection Among Patients Receiving Hemodialysis at an Urban Dialysis Center • . Infection Control and Hospital Epidemiology 23:6, 319-324
CrossRef29
Steven L. Zacks, Michael W. Fried. (2001) HEPATITIS B AND C AND RENAL FAILURE. Infectious Disease Clinics of North America 15:3, 877-899
CrossRef30
ROBERT W. HALEY, R. PAUL FISCHER. (2001) Commercial Tattooing as a Potentially Important Source of Hepatitis C Infection. Medicine 80:2, 134-151
CrossRef31
G.W. McCaughan, A. Zekry. (2000) Effects of immunosuppression and organ transplantation on the natural history and immunopathogenesis of hepatitis C virus infection. Transplant Infectious Disease 2:4, 166-185
CrossRef32
Françoise Lunel, Jean-François Cadranel, Michel Rosenheim, Richard Dorent, Vincent Di-Martino, Christopher Payan, Catherine Fretz, Jean-Jacques Ghoussoub, Brigitte Bernard, Bruno Dumont, Michèle Perrin, Iranj Gandjbachkh, Jean Marie Ruraux, Lieven Stuyver, Pierre Opolon. (2000) Hepatitis virus infections in heart transplant recipients: Epidemiology, natural history, characteristics, and impact on survival. Gastroenterology 119:4, 1064-1074
CrossRef33
Hugo R. Rosen. (2000) Primer on Hepatitis C for Hospital Epidemiologists • . Infection Control and Hospital Epidemiology 21:3, 229-234
CrossRef34
T. G. Wreghitt. (1999) Blood-borne virus infections in dialysis units—A review. Reviews in Medical Virology 9:2, 101-109
CrossRef35
Miriam J. Alter, Eric E. Mast, Linda A. Moyer, Harold S. Margolis. (1998) HEPATITIS C. Infectious Disease Clinics of North America 12:1, 13-26
CrossRef36
José M. Morales, Josep M. Campistol, Amado Andrés, José L. Rodicio. (1998) Hepatitis C virus and renal transplantation. Current Opinion in Nephrology and Hypertension 7:2, 177-184
CrossRef37
Adrian M Di Bisceglie. (1998) Hepatitis C. The Lancet 351:9099, 351-355
CrossRef38
CHIU-CHING HUANG. (1997) Hepatitis in patients with end-stage renal disease. Journal of Gastroenterology and Hepatology 12:9-10, S236-S241
CrossRef39
Boonyos Raengsakulrach, Leena Ong-aj-yooth, Thanarak Thaiprasert, Sanga Nilwarangkur, Sompong Ong-aj-yooth, Sumitda Narupiti, Vipa Thirawuth, Chonticha Klungthong, Rapin Snitbhan, David W. Vaughn. (1997) High prevalence of hepatitis G viremia among kidney transplant patients in Thailand. Journal of Medical Virology 53:2, 162-166
CrossRef40
ADRIAN B. VAN BAKEL. (1997) The Cardiac Transplant Donor: Identification, Assessment, and Management. The American Journal of the Medical Sciences 314:3, 153-163
CrossRef41
Brian J G Pereira, Andrew S Levey. (1997) Hepatitis C virus infection in dialysis and renal transplantation. Kidney International 51:4, 981-999
CrossRef42
C. Colin, P. Vergnon, A. M. Jullien, S. Excoffier, Y. Matillon, C. Trepo, J. P. Aymard, D. Bastit, M. L. Bidet, R. Breviere, F. Chenais, F. Hau, D. Houssay, A. Mercadier, P. Maisonneuve, M. Lambert, C. Waller, D. Boudart, C. Cotte, M. H. Elghouzzi, C. Janot, M. Daudet, M. Menault, M. Montcharmont, W. Smilovici, C. Fretz, R. Follana, M. Doillon, J. C. Petit, P. Herve, B. Loyer, B. Mattlinger. (1997) Cost-effectiveness of screening blood donors for hepatitis C and non-A, non-B, non-C hepatitis. European Journal of Clinical Microbiology & Infectious Diseases 16:3, 220-227
CrossRef43
Hauptman, Paul J., O'Connor, Kevin J., . (1997) Procurement and Allocation of Solid Organs for Transplantation. New England Journal of Medicine 336:6, 422-431
Full Text44
Dong-Feng Chen, Walter Entires, Volker Kliem, Hans L. Tillmann, Reinhard Brunkhorst, Karl M. Koch, Michael P. Manns, Walter Stangel. (1996) No significant influence of HLA determinants on susceptibility to hepatitis C virus infection in Caucasian patients with end-stage renal disease. Liver 16:6, 384-389
CrossRef45
Brian J. G. Pereira, Teresa L Wright. (1996) HBV and HCV Genome in Peripheral Blood Mononuclear Cells in Patients Undergoing Chronic Hemodialysis, by C Oesterreicher, J Hammer, U Koch, F Pfeffel, G Sunder-Plassman, D Petermann, C Muller. Kidney Int 48:1967-1971, 1995. Seminars in Dialysis 9:5, 432-433
CrossRef46
TM CHAN. (1996) Hepatitis C virus infection in patients on renal replacement therapy. Nephrology 2:s1, s85-s87
CrossRef47
Christian Jorgensen, Marie-Christine Legouffe, Pascal Perney, Joliette Coste, Barbara Tissot, Christiane Segarra, Christophe Bologna, Laurent Bourrat, Bernard Combe, François Blanc, Jacques Sany. (1996) Sicca syndrome associated with hepatitis C virus infection. Arthritis & Rheumatism 39:7, 1166-1171
CrossRef48
Luca S. Belli, Enrico Silini, Alberto Alberti, Giorgio Bellati, Claudio Vai, Ernesto Minola, Gianfranco Rondinara, Luciano De Carlis, Margherita Asti, Domenico Forti, Gaetano Ideo. (1996) Hepatitis C virus genotypes, hepatitis, and hepatitis C virus recurrence after liver transplantation. Liver Transplantation and Surgery 2:3, 200-205
CrossRef49
Keith Zucker, David Roth, Robert Cirocco, James Mathew, Manuel Carreno, Laphalle Fuller, Theodore Karatzas, Yide Jin, George Burke, Jose Nery, Marc Webb, Andreas Tzakis, Violet Esquenazi, Joshua Miller. (1996) Transplant-associated autoimmune mechanisms in human hepatitis C virus infection. Journal of Clinical Immunology 16:1, 60-70
CrossRef50
Daniel Glicklich, Toros Kapoian. (1996) Should the Hepatitis C Positive End Stage Renal Disease Patient Be Transplanted?. Seminars in Dialysis 9:1, 5-8
CrossRef51
Hugo R. Rosen, Lawrence S. Friedman, Paul Martin. (1996) Hepatitis C and the Renal Transplant Patient. Seminars in Dialysis 9:1, 39-46
CrossRef52
Stephen D. Ryder, John Koskinas, Paolo M. Rizzi, Ian G. McFarlane, Bernard C. Portmann, Nikolai V. Naoumov, Roger Williams. (1995) Hepatocellular carcinoma complicating autoimmune hepatitis: Role of hepatitis C virus. Hepatology 22:3, 718-722
CrossRef53
OLIVER CHAZOUILLERES, TERESA L WRIGHT. (1995) Hepatitis C and liver transplantation. Journal of Gastroenterology and Hepatology 10:4, 471-480
CrossRef54
T Kudo, T Morishima, M Shibata, H Miwata, M Matsushima, K Tsuzuki. (1995) Low humoral responses to hepatitis C virus among pediatric renal transplant recipients. Acta Paediatrica 84:6, 677-682
CrossRef55
C. J. Tibbs. (1995) Methods of transmission of hepatitis C. Journal of Viral Hepatitis 2:3, 113-119
CrossRef56
Paul Martin, Lawrence S Friedman. (1995) Chronic viral hepatitis and the management of chronic renal failure. Kidney International 47:5, 1231-1241
CrossRef57
K. Al Meshari, M. Al Ahdal, O. Alfurayh, A. Ali, E. De Vol, G. Kessie. (1995) New insights into hepatitis C virus infection of hemodialysis patients: the implications. American Journal of Kidney Diseases 25:4, 572-578
CrossRef58
Etienne Marc Sokal. (1995) Quality of life after orthotopic liver transplantation in children. An overview of physical, psychological and social outcome. European Journal of Pediatrics 154:3, 171-175
CrossRef59
JoséM. Sánchez-Tapias, Joan Rodés. (1995) Dilemmas of organ transplantation from anti-HCV-positive donors. The Lancet 345:8948, 469-470
CrossRef60
Mel Krajden, Fouad Bishai, Corinna Quan, Jim Mahony, James Brunton, David Rootman, Jiu Zhao, Wendy Lau, Gregory Snell, Janet Maurer, Steve Kesten, David Colby. (1995) Multi-organ donor transmission of hepatitis C virus to five solid organ transplant recipients and lack of transmission to corneal transplant recipients. Clinical and Diagnostic Virology 3:2, 113-121
CrossRef61
David Roth. (1995) Hepatitis C virus: The nephrologist's view. American Journal of Kidney Diseases 25:1, 3-16
CrossRef62
F Lunel, C Robert, P Munier, JF Cadranel, C Fretz, M Perrin, L Frangeul, P Grippon, B Bernard, P Opolon, JM Huraux, M Rosenheim, H Agut. (1995) Hepatitis virus infections in heart transplant recipients. Biomedicine & Pharmacotherapy 49:3, 125-129
CrossRef63
Michel Jadoul. (1995) Should Hemodialysis Patients with Hepatitis C Virus Antibodies Be Isolated?. Seminars in Dialysis 8:1, 1-3
CrossRef64
Brian J. G. Pereira, Andrew S. Levey. (1995) Hepatitis C infection in cadaver organ donors: strategies to reduce transmission of infection and prevent organ waste. Pediatric Nephrology 9:S1, S23-S28
CrossRef65
David Roth, Keith Zucker, Robert Cirocco, George Burke, Les Olson, Violet Esquenazi, Joshua Miller. (1995) Transmission of hepatitis C virus by kidney transplantation: impact of perfusion techniques and course of viremia post transplant. Pediatric Nephrology 9:S1, S29-S34
CrossRef66
Jose M Morales, Jose M Campistol, Gregorio Castellano, Amado Andres, Francisco Colina, Antonio Fuertes, Guadlupe Ercilla, Miguel Bruguera, Jordi Andreu, Pablo Carretero, Jose L Rodicio, Andrew S Levey, Brian JG Pereira. (1995) Transplantation of kidneys from donors with hepatitis C antibody into recipients with pre-transplantation anti-HCV. Kidney International 47:1, 236-240
CrossRef67
Richard J Johnson, Richard Willson, Hideaki Yamabe, William Couser, Charles E Alpers, Mark H Wener, Connie Davis, David R Gretch. (1994) Renal manifestations of hepatitis C virus infection. Kidney International 46:5, 1255-1263
CrossRef68
Michael J. Nowicki, Nafees Ahmad, James E. Heubi, I. Kenneth Kuramoto, Bahige M. Baroudy, William F. Balistreri. (1994) The prevalence of hepatitis C virus (HCV) in infants and children after liver transplantation. Digestive Diseases and Sciences 39:10, 2250-2254
CrossRef69
Germana V. Gregorio, Alex P. Mowat. (1994) Viral hepatitis in children with renal disease. Pediatric Nephrology 8:5, 610-619
CrossRef70
P. A. C. Maple, T. McKee, U. Desselberger, T. G. Wreghitt. (1994) Hepatitis C virus infections in transplant patients: Serological and virological investigations. Journal of Medical Virology 44:1, 43-48
CrossRef71
Svetlozar N. Natov, Brian J. G. Pereira. (1994) A Dialysis Case Presentation and Discussion. Seminars in Dialysis 7:5, 360-368
CrossRef72
Brian J G Pereira, Teresa L Wright, Christopher H Schmid, Christopher F Bryan, Ramsey C Cheung, E Shannon Cooper, Henry Hsu, Randall Heyn-Lamb, Jimmy A Light, Douglas J Norman, David H Van Thiel, Barbara G Werner, Charles E Wright, Andrew S Levey. (1994) Screening and confirmatory testing of cadaver organ donors for hepatitis C virus infection: A U.S. National Collaborative Study. Kidney International 46:3, 886-892
CrossRef73
Suthanthiran, ManikkamStrom, Terry B.. (1994) Renal Transplantation. New England Journal of Medicine 331:6, 365-376
Full Text74
Nicole Simon, Anne-Marie Couroucé, Nadine Lemarrec, Christian Trépo, Stéphane Ducamp. (1994) A twelve year natural history of hepatitis C virus infection in hemodialyzed patients. Kidney International 46:2, 504-511
CrossRef75
Ola Weiland. (1994) Interferon therapy in chronic hepatitis C virus infection. FEMS Microbiology Reviews 14:3, 279-288
CrossRef76
S. Kazi, S. Prasad, R. Pollak, T. Holzer, C. Heynen, A. J. Fabrega, D. Pitrak, T. J. Layden. (1994) Hepatitis C infection in potential recipients with normal liver biochemistry does not preclude renal transplantation. Digestive Diseases and Sciences 39:5, 961-964
CrossRef77
C. Lumbreras, R. Delgado, A. Fuertes, C. Loinaz, J. Iglesias, F. Colina, J. M. Aguado, C. Gimeno, I. Garcia, M. Lizasoain, E. Moreno, A. R. Noriega. (1994) Clinical significance of hepatitis C virus (HCV) infection in liver transplant recipients. Digestive Diseases and Sciences 39:5, 965-969
CrossRef78
S. P. Dibenedetto, R. Ragusa, A. Sciacca, A. Cataldo, V. Miraglia, S. D'Amico, L. Nigro, A. M. Ippolito. (1994) Incidence and morbidity of infection by hepatitis C virus in children with acute lymphoblastic leukaemia. European Journal of Pediatrics 153:4, 271-275
CrossRef79
E. A. B. McCruden, S. Welch, B. Batchelor, M. C. Allison, B. Dow, E. A. C. Follett, P. R. Mills, J. D. Briggs. (1994) Hepatitis C virus infection detected by antibody tests and the polymerase chain reaction as a cause of liver dysfunction in renal transplant recipients. Journal of Medical Virology 42:2, 158-163
CrossRef80
Richard A. McPherson. (1994) Laboratory diagnosis of human hepatitis viruses. Journal of Clinical Laboratory Analysis 8:6, 369-377
CrossRef81
David Roth, Keith Zucker, Robert Cirocco, Angelo DeMattos, George W Burke, Jose Nery, Violet Esquenazi, Sharon Babischkin, Joshua Miller. (1994) The impact of hepatitis C virus infection on renal allograft recipients. Kidney International 45:1, 238-244
CrossRef82
T. Jake Liang, Lennox J. Jeffers, K. Rajender Reddy, Maria De Medina, I. Talley Parker, Hugo Cheinquer, Victor Idrovo, Alfredo Rabassa, Eugene R. Schiff. (1993) Viral pathogenesis of hepatocellular carcinoma in the United States. Hepatology 18:6, 1326-1333
CrossRef83
Michel Jadoul, Chantal Cornu, Charles van Ypersele de Strihou. (1993) Incidence and risk factors for hepatitis C seroconversion in hemodialysis: A prospective study. Kidney International 44:6, 1322-1326
CrossRef84
Robert H Rubin. (1993) Infectious disease complications of renal transplantation. Kidney International 44:1, 221-236
CrossRef85
BrianJ.G. Pereira, EdgarL. Milford, RobertL. Kirkman, AndrewS. Levey, WilliamW. Tomford, Howard Leibowitz, Meriwether Rhodes, Stella Quan, JudithC. Wilber. (1993) Low risk of liver disease after tissue transplantation from donors with HCV. The Lancet 341:8849, 903-904
CrossRef86
(1993) Hepatitis C Virus and Organ Transplantation. New England Journal of Medicine 328:7, 511-513
Full Text
