Original Article
Primary Human Herpesvirus 6 Infection in Young Children
N Engl J Med 1992; 326:1445-1450May 28, 1992
- Abstract
- Abstract
Background
Human herpesvirus 6 (HHV-6) is a recently discovered virus that, on the basis of serologic evidence, appears to infect most children by the age of three years. However, the clinical manifestations of primary HHV-6 infection have not been well defined.
Methods
We studied consecutive children two years old or younger who presented to an emergency ward with febrile illnesses. Our evaluation included the isolation of HHV-6 from peripheral-blood mononuclear cells, an immunofluorescent-antibody assay, the detection of HHV-6 by the polymerase chain reaction (PCR), and restriction-endonuclease-fragment profiles of HHV-6 isolates.
Results
HHV-6 was isolated from 34 of 243 acutely ill children (14 percent). The children with viremia had irritability, high temperatures (mean, 39.7°C), and inflammation of tympanic membranes (in 21), but few other localizing signs. Two children were hospitalized, but all 34 recovered after an average of four days of fever. The rash characteristic of roseola, which has been associated with HHV-6 infection, was noted in only three children. In 29 children (85 percent), serum samples obtained during convalescence had at least a fourfold increase in IgG antibody titers; 4 infants less than three months old who presumably had maternal antibody did not have this increase. HHV-6 was isolated from blood obtained during convalescence in only one child, but in two thirds of the children the virus could be detected by PCR. The isolates had genomic heterogeneity, indicating the presence of multiple strains.
Conclusions
Primary infection with HHV-6 is a major cause of acute febrile illness in young children. Such infection is associated with varied clinical manifestations, viremia, and the frequent persistence of the viral genome in mononuclear cells. (N Engl J Med 1992;326:1445–50.)
Media in This Article
Figure 1
Specificity of the HHV-6 PCR Assay.Figure 2
BamHI Restriction-Endonuclease—Fragment Profiles of HHV-6 Isolates.Article Activity
- Article
HUMAN herpesvirus 6 (HHV-6) was first isolated from the peripheral-blood mononuclear cells of six adult patients from the United States and Jamaica who had lymphoproliferative diseases.1 Subsequent isolations from patients in a number of additional countries indicated the ubiquitous nature of this new virus and its association with immune disorders in adults.2 3 4 5 Serologic studies demonstrated that HHV-6 infection occurs in most children by the age of three years.6 7 8 9 Whether the frequent acquisition of this infection in the first years of life is accompanied by clinical manifestations was unknown until the appearance of a report by Yamanishi et al.10 that identified HHV-6 as the agent of roseola (exanthem subitum) in four infants. Subsequent reports have confirmed roseola as a manifestation of primary infection.9 , 11 12 13 Except for two cases of roseola reported recently from Washington, D.C.,14 all the reported cases of roseola in which HHV-6 has been isolated have come from Japan. Furthermore, the spectrum of clinical manifestations of primary infection in the first several years of life is unknown, as is the relation between early primary infection and the subsequent detection of HHV-6 in adults. The purpose of this study was to describe the frequency and clinical manifestations of primary infection with HHV-6 in children in the United States, the potential of the virus for latency, and the similarity or heterogeneity of HHV-6 strains causing primary infection.
Methods
Subjects
During the six months from December 1989 through May 1990, all children two years of age or less who were brought to the emergency department of Strong Memorial Hospital (Rochester, N.Y.) with acute febrile illnesses (temperature, ≥38°C) and from whom blood was obtained were enrolled in the study. Children were excluded if insufficient blood could be obtained for complete laboratory studies. The history and clinical findings were recorded on a standard form, as well as the diagnosis made at discharge by the examining physician in the emergency department. Once a child was proved to have HHV-6 viremia by culture of the peripheral-blood mononuclear cells obtained in the emergency department, the child's physician and family were contacted by phone and details of the child's history and permission for a home visit were requested. Information on the presence and duration of the clinical findings since the initial visit in the emergency department was obtained from the physician and the parents and was recorded on a standard form. During the follow-up examination of the child at home, further history and findings were similarly recorded, and blood was obtained for repeat culture, serologic testing, and analysis by the polymerase chain reaction (PCR).
Isolation of HHV-6
Blood samples were collected from the children in anticoagulant tubes containing EDTA and were either processed fresh or stored for less than 72 hours at 4°C. Mononuclear cells were separated by Ficoll–Hypaque density-gradient centrifugation, washed, and divided into two amounts for the detection of HHV-6 by both isolation and PCR. For the PCR, the mononuclear cells (from 5 × 105 to 5 × 106 per milliliter) were pelleted and stored at — 70°C. The rest of the cells (about 106 per milliliter) were cocultivated with fresh human cord-blood mononuclear cells in RPMI-1640 medium containing antibiotics, 10 percent heat-inactivated fetal bovine serum, 5 μg of phytohemagglutinin (Sigma Chemical, St. Louis) per milliliter, 5 percent (32 units per milliliter) human interleukin-2 (Pharmacia Diagnostics, Silver Spring, Md.), and 0.01 mg of hydrocortisone (Sigma Chemical) per milliliter. Fresh medium and uninfected cord-blood mononuclear cells were added once a week. (HHV-6 has not been detected in cord-blood cells by repetitive culture or in cultured mononuclear cells from 20 healthy adults.) Positive cultures were initially identified on the basis of the characteristic cytopathic effect, with subsequent confirmation by indirect immunofluorescent staining with serum from a positive control, which was the serum obtained during convalescence from a child with roseola whose HHV-6 isolate was characterized as described below. The titer of antibody to HHV-6 in this serum was initially assayed by indirect immunofluorescent staining against the child's own isolate and the Z29 strain.15
HHV-6 Serologic Testing
IgG antibody to HHV-6 was determined by the indirect immunofluorescent-antibody assay with slides of HSB-2 cells infected with an isolate of HHV-6 obtained from a child with roseola. This isolate has been characterized as HHV-6 by PCR with two dilferent sets of primers, those described in the following section and those developed by Kondo et al.,16 as well as by a standard anticomplementary immunofluorescent-antibody assay at the Centers for Disease Control and by restriction-endonuclease—fragment profiles, as described below. Twofold dilutions (starting at 1:10) of serum samples in phosphate-buffered saline were added to the slides, incubated at 35°C, and washed. Fluorescein-conjugated goat antihuman IgG (Cappel, West Chester, Pa.) and 0.25 percent Evans blue were added, and the slides were reincubated, washed, mounted, and read. Serum samples obtained during the acute illness and during convalescence were assayed simultaneously, and each assay included infected and uninfected HSB-2 cells as controls, with positive and negative serum samples and with no serum (phosphate-buffered saline).
Detection of HHV-6 by PCR
Sequences of primers and probes for the HHV-6 PCR were derived from a DNA sequence (unpublished data) of a segment of the HHV-6 (Z29) genome located near the left terminal repeat.15 The HHV-6 primer sequences were as follows: primer A, 5'GTGATGTACGTGGCCGTCTCCTG; and primer B, 5'GATCCATGGTCGTCTTTCCACG. The amplification of HHV-6 results in a 384-bp product. The peripheral-blood mononuclear cells were digested with proteinase K, and 5 μl of each sample was added to 95 μl of reaction mixture containing Tag polymerase (Promega, Madison, Wis.) and prepared according to the recommendations of the Cetus Corporation. Positive and negative controls, including uninfected cord-blood mononuclear cells and no-template specimens of the reaction mixture, were included with each assay. Beta-globin primers were used as the performance control.17 The thermocycling procedure consisted of denaturation at 94°C for five minutes, 35 cycles of annealing at 55°C for two minutes, extension at 72°C for two minutes, and denaturation at 94°C for two minutes, followed by a final extension at 72°C for seven minutes. After electrophoresis of the amplification reaction in composite gels consisting of 3 percent NuSieve agarose and 1 percent SeaPlaque agarose (FMC BioProducts, Rockland, Me.) and blotting onto nylon membranes (Zeta-Probe, Bio-Rad Laboratories, Richmond, Calif), the amplified fragment was detected by hybridization with an internal-probe sequence (5'CGTCACGTATACCATTCCCAACC) that was labeled at its 5' end with phosphorus-32. The sequences of primers and probes had no substantial similarity to any sequence in Gen-Bank, and they produced no detectable cross-reactive product in reactions containing 105 genomic copies of heterologous human herpesviruses (Fig. 1Figure 1
Specificity of the HHV-6 PCR Assay.).Restriction-Endonuclease—Fragment Profiles
Whole infected-cell DNA was prepared by standard procedures involving digestion with proteinase K, phenol—chloroform extraction, and precipitation with ethanol. After digestion of the DNA with the appropriate restriction endonuclease, the resulting fragments were separated in 0.8 percent agarose gels and then transferred to nitrocellulose membranes (Schleicher and Schuell, Keene, N.H.). HHV-6 DNA was detected by hybridization with Radio-labeled whole viral DNA purified from nucleocapsids, and a fragment containing the terminal-repeat structure (TermL) was obtained by digestion with ClaI.18
Results
Clinical Characteristics of the Patients
Two hundred forty-three children two years of age or younger who had acute febrile illnesses were enrolled in the study. In 34 children (14 percent), HHV-6 was cultured from the peripheral blood obtained at the time of the initial visit. These children were younger than those with negative HHV-6 cultures, but not significantly so (mean ages, 9.5 and 11.2 months, respectively), and 53 percent were boys, as compared with 59 percent of the group with negative cultures. The average duration of symptoms before the visit to the emergency department was similar in the two groups — 2.7 days for the culture-positive children and 2.8 days for those with negative cultures.
The diagnoses of the acute febrile illness in the children at the time of discharge from the emergency department, according to HHV-6 serologic status, are shown in Table 1Table 1
Febrile Illnesses Diagnosed in the Emergency Department in Children, According to HHV-6 Status as Determined on Culture.. Significantly more children with HHV-6 viremia had fever and otitis, whereas the HHV-6—negative group more often had gastroenteritis. The second most frequent diagnosis in the HHV-6—positive children was an undifferentiated febrile illness, which included the diagnosis of viral syndrome and fever of undetermined origin. Together with fever and otitis, this diagnosis accounted for 82 percent of the diagnoses in the children with HHV-6 viremia, as compared with 46 percent of the diagnoses in the HHV-6—negative group. No bacterial illness was diagnosed in the HHV-6—positive children, and none of the blood cultures, which were obtained in 94 percent, were positive.High fever was the most prominent finding in the children with HHV-6 viremia. Their average temperature at the time of the initial visit was 39.7°C (range, 38 to 41.3), which was significantly higher than the mean temperature of 39.1°C (range, 38 to 41) in the children with negative HHV-6 cultures (P = 0.002). Sixty-five percent of the children with HHV-6 viremia had peak fevers over 40°C, as compared with 43 percent of the culture-negative children (P = 0.002) (Table 2Table 2
Signs and Symptoms in the Children Studied, According to HHV-6 Status as Determined on Culture.). Malaise, irritability, and inflamed tympanic membranes were present significantly more often in the children with acute HHV-6 infection, whereas vomiting occurred more frequently in the HHV-6—negative group (Table 2). A rash was noted concurrently with fever at the time of the visit to the emergency department in 6 of the children with HHV-6 viremia (18 percent) and in 12 percent of the HHV-6—negative children. In the children with HHV-6 the rash was macular or maculopapular and most frequently involved the face and trunk. According to the parents, an additional six children had rashes of variable descriptions within a week of the initial visit. Only three of the HHV-6—positive children had a classic roseola-like illness, with a typical rash occurring after the fever subsided.The average white-cell count of the HHV-6—positive children was significantly lower than that of the HHV-6—negative group (8.9 × 109 vs. 13.2 × 109 per liter [8900 vs. 13,200 per cubic millimeter], P<0.001) at the time of the initial visit. The mean proportions of lymphocytes were similar in the groups positive and negative for HHV-6 (39 and 36 percent, respectively), as were the proportions of neutrophils (51 and 52 percent).
Two of the HHV-6-positive children (6 percent) required hospital admission. All the children positive for HHV-6 recovered within 15 days of their visit to the emergency department. The illness lasted an average of 4 days (range, 1 to 15). The fever lasted an average of 4 days (range, 1 to 8).
Serologic Studies
The geometric mean titer of IgG antibody to HHV-6 in the serum samples obtained from the children with HHV-6 viremia at the time of the initial visit was 3.2 log2 (Table 3Table 3
IgG Antibody Titers to HHV-6 in Children Two Years Old or Less Who Were Seen in the Emergency Department for an Acute Febrile Illness.). Eighty-two percent had titers of 3.32 log2 or less. In comparison, the children with febrile illnesses not caused by HHV-6 had significantly higher geometric mean titers, and only 21 percent had titers of 3.32 log2 or less. The average age of these children with low or undetectable HHV-6 titers was 9.3 months, as compared with 11.6 months in those with titers greater than 3.32 log2 (P = 0.06).Serum samples obtained from the HHV-6—positive children during convalescence, three weeks to three months after their acute illness, had significantly increased geometric mean titers, and 85 percent demonstrated an increase of at least four times the initial value (Table 3). With one exception, the four children who did not have a significant increase in titer were three months old or less, and their titers during convalescence were similar to or twice as high as the titers during the acute illness, suggesting that their own production of specific antibody masked the normal decline in maternal antibody. One child had a high titer of 10.3 log2 during the acute illness and a titer of 11.3 log2 three months later during convalescence.
Follow-up serum samples were obtained within three months from 40 of the culture-negative children. Twenty-five of these children were already seropositive for HHV-6 at the time of the initial visit to the emergency department. The geometric mean antibody titers in the serum samples from these seropositive children during the acute illness (7.4 log2) and subsequently (7.6 log2) did not differ significantly. Six of these children had differences of more than 1 log2 between their initial and follow-up titers; four of these were infants under six months of age with declining titers, presumably as a result of the loss of maternally derived antibody. The other two children had high titers in their initial serum samples and at least two-fold increases in the subsequent samples. All 15 children who were negative on culture and seronegative at the time of the initial visit were still seronegative in the subsequent serum samples, except for 1 child who had seroconverted in the intervening three months.
HHV-6 Cultures during Convalescence
At the follow-up visit, peripheral-blood mononuclear cells were obtained from the children who had previously had viremia, and these cells were again cultured with cord-blood cells for the detection of HHV-6. All the cultures were negative for HHV-6 except the culture for one child. A sample of the blood of this five-month-old was obtained during his convalescence, four weeks after an uncomplicated acute illness, and at the time of its drawing he was healthy. HHV-6 was also detected by PCR in samples of blood obtained during the acute illness and during convalescence. The child's IgG antibody titer rose from an undetectable level (<3.3 log2) at the time of the initial visit to 9.3 log2 four weeks later, indicating that the initial illness was a primary infection with HHV-6.
Three of the children who had had viremia were examined during five subsequent febrile illnesses, and blood was again obtained for culture. No recurrences of HHV-6 viremia were detected.
Detection of HHV-6 by PCR
The genome of HHV-6 was detected by PCR in all the samples of peripheral-blood mononuclear cells (without culture) obtained from the children with viremia during the acute illness. However, during convalescence only 68 percent continued to be positive by PCR. In comparison, the samples of peripheral-blood mononuclear cells obtained during the initial visit from the HHV-6—negative children had a lower rate of HHV-6 positivity by PCR (25 percent). To determine the rate of positivity by this method in the peripheral-blood mononuclear cells of children previously infected, the PCR results were analyzed in those who did not have HHV-6 viremia but whose serum samples obtained during the acute illness were antibody-positive and who were four months of age or older (a limit chosen in order to eliminate those with maternally derived HHV-6 antibody). In this group of children presumed to have previous infection, HHV-6 was detected by PCR in the peripheral-blood mononuclear cells of 41 percent. The mononuclear cells of 75 of the children who were negative on culture and antibody testing at the time of the initial visit were also tested by PCR. All were negative except one child evaluated for fever and possible sepsis, who was 21 months of age.
Restriction-Endonuclease—Fragment Profiles
To confirm that the viral isolates obtained from the children were independent isolates and to assess their degree of relatedness, the patterns of migration of fragments generated by the digestion of viral DNA with restriction endonucleases were compared. In digestions with BamHI, for example (Fig. 2Figure 2
BamHI Restriction-Endonuclease—Fragment Profiles of HHV-6 Isolates.), the overall similarity between isolates was readily apparent, the variation being greatest in the terminal fragments, with some variation being evident elsewhere. On the basis of comparisons of the patterns obtained in digestions of 20 isolates with four different enzymes (BamHI, ClaI, HindIII, and KpnI), each isolate had a unique profile. As Pellett et al.18 have described, the variation in the migration of fragments spanning a region of the HHV-6 genome both among strains and within a single strain may lead to incorrect conclusions about strain identity. If those fragments are excluded from the analysis, the 20 isolates segregate into 14 groups, with a maximum of three members in a group.Discussion
This study suggests that HHV-6 is an important cause of acute illness in young children in the United States. Fourteen percent of the children in the first two years of life presenting with febrile illnesses to our emergency department during a six-month period had acute, viremic HHV-6 infection. In contrast to the reports from Japan,9 , 10 , 12 , 19 only a minority had illnesses resembling roseola (exanthem subitum), consisting of several days of fever with no localizing signs, followed by defervescence and a rash. Case reports from Japan have documented that primary HHV-6 infection may occur in infants without rash,20 a condition described clinically in the past as "roseola sine eruptione,"21 and that it has occurred in two children with no documented fever.11
Our selection of febrile infants who presented to the emergency department prevents any assessment of the role of HHV-6 in afebrile infection. In our patients, however, the most striking clinical manifestation was the height of the fever, which was significantly greater than that in children of the same age who had illnesses of other causes. The height of the fever, as well as the spectrum of accompanying clinical signs not usually associated with roseola, such as otitis and diarrhea, resulted in a varied, often time-consuming, and expensive workup in the emergency department.
Currently, isolation of HHV-6 from peripheral-blood mononuclear cells either by techniques of coculturing or by serologic assays is the only method available to identify primary infection. Although HHV-6 has been isolated during reactivations of illness from the blood of adults, usually those with underlying diseases, our findings suggest that this is uncommon in young children. Of the 243 febrile children studied, HHV-6 was isolated from the blood only in children with subsequent serologic documentation of primary infection, with the one exception of an 11-month-old child whose serum samples during the acute illness had a high antibody titer that rose only twofold during convalescence. Whether the initial sample was obtained late enough in this child's course (the third day of illness) and the convalescent serum was obtained late enough to account for the absence of a significant rise is unclear. Asano et al.19 have reported that in 18 percent of children with roseola, antibody is detectable on the third day of illness. Alternatively, this child may have had HHV-6 infection shortly before the current febrile illness, with a reactivation of HHV-6 or with the viremia still present. HHV-6 has been isolated consistently from the peripheral-blood mononuclear cells of infants with roseola during the first three days of fever, with the rate diminishing thereafter to 17 percent on days 5 to 7 of the illness; it was isolated in none of the samples obtained more than eight days after the onset of disease.19 One of the children we studied, although asymptomatic, had viremia four weeks after the initial visit during the acute illness, suggesting that the virus may occasionally persist after a primary infection. The continued detection of HHV-6 in peripheral-blood mononuclear cells by PCR in 68 percent of the serum samples obtained during convalescence one to three months after the acute illness and in 41 percent of the children infected at some time before their visit to the emergency department also suggests the persistence of the viral genome. Whether virus that persists after a primary infection becomes latent and results in the reactivation of illness sometimes observed in adults is unclear.
A growing body of evidence indicates that HHV-6 isolates may be segregated into two groups (A and B) on the basis of restriction-fragment profiles14 , 22 as well as other criteria.23 , 24 Within such groups, however, HHV-6 has less variation in restriction-fragment lengths between strains than do many other herpesviruses.18 The group A isolates, thus far obtained from adults, are characterized by the prototype U-1102 strain.14 For the group B isolates, consisting of Z29-like strains, an association with roseola or childhood disease has been suggested.14 Our results are generally consistent with these observations. The comparisons of the migration of restriction fragments for 20 of our isolates indicate that although most of the isolates could be discriminated from each other, the level of similarity among them was much greater than would have been expected in comparisons of restriction-fragment migration involving herpes simplex virus or cytomegalovirus isolates. Nevertheless, there was a higher degree of heterogeneity among the samples obtained in this study than was apparent in the comparisons of isolates obtained from patients with roseola in Japan.18 Nineteen of the 20 isolates we examined were clearly similar to the group B or Z29-like isolates associated with roseola.14 The proposed segregation of HHV-6 isolates into two groups and their associated clinical and biologic characteristics are important areas for further study.
Although the full spectrum of initial infection with HHV-6 needs further delineation, our findings suggest that this newly discovered virus causes an appreciable proportion of the emergency room visits for children with acute illness in the first two years of life and that the clinical manifestations are varied and often worrisome. This study further emphasizes the need for a means of diagnosis of primary HHV-6 infection that is rapid and feasible in outpatient settings.
Supported in part by an Institutional Award (IN-18–31) from the American Cancer Society.
We are indebted to Karen C. Sanderlin, Elizabeth D. Anton, and Cynthia A. Greenamoyer for their expert technical assistance.
Source Information
From the Department of Pediatrics, University of Rochester School of Medicine, Rochester, NY. (P.P., C.B.H., R.A.I., K.M., C.E.L., K.C.S., P.H.P.); the Division of Viral and Rickettsial Diseases, National Center for Infectious Diseases, Centers for Disease Control, Atlanta (P.E.P., F.R.S., J.A.S.); and DuPont Merck Pharmaceuticals, Wilmington, Del. (T.R.D.). Address reprint requests to Dr. Hall at the University of Rochester School of Medicine, 601 Elmwood Ave., Box 689, Rochester, NY 14642–8689.
- References
References
1
Salahuddin
CrossRef | Web of Science | Medline2
Agut
CrossRef | Web of Science | Medline3
Downing
CrossRef | Web of Science | Medline4
Jarrett
Web of Science | Medline5
Krueger
CrossRef | Web of Science | Medline6
Briggs
CrossRef | Web of Science | Medline7
Brown
CrossRef | Web of Science | Medline8
Knowles
CrossRef | Web of Science | Medline9
Ueda
CrossRef | Web of Science | Medline10
Yamanishi
CrossRef | Web of Science | Medline11
Asano
CrossRef | Web of Science | Medline12
Asano
CrossRef | Web of Science | Medline13
Takahashi
CrossRef | Web of Science | Medline14
Schirmer
CrossRef | Web of Science | Medline15
Lindquester
CrossRef | Web of Science | Medline16
Kondo
Web of Science | Medline17
Saiki
CrossRef | Web of Science | Medline18
Pellett PE, Lindquester GJ, Feorino P, Lopez C. Genomic heterogeneity of human herpesvirus 6 isolates. In: Lopez C, Mori R, Roizman B, Whitley RW, eds. Immunobiology and prophylaxis of human herpesvirus infections. Vol. 278 of Advances in experimental medicine and biology. New York: Plenum Press, 1990:9–18.
19
Asano
CrossRef | Web of Science | Medline20
Suga
Web of Science | Medline21
Breese 22
Kikuta
CrossRef | Web of Science | Medline23
Aubin
Web of Science | Medline24
Ablashi
CrossRef | Web of Science | Medline
- Citing Articles (86)
Citing Articles
1
Yvonne A. Maldonado. 2011. Less Common Viral Infections. , 905-916.
CrossRef2
Carolus Schenke, Miguel A Alejandre-Alcázar, Wolfgang Holter, Klaus Korn, Thomas Papadopoulos, Henrik Köhler. (2010) Aplastic Anemia Following Hepatitis Associated With Human Herpesvirus 6. Journal of Pediatric Gastroenterology and Nutrition 51:4, 527-529
CrossRef3
William J. Britt. 2010. Betaherpesviruses: Cytomegalovirus, Human Herpesviruses 6 and 7. .
CrossRef4
Parisa Ravanfar, Natalia Mendoza, Anita Satyaprakash, Rosella Creed, Stephen Tyring. 2010. Infections of the Skin and Mucosa. , 285-300.
CrossRef5
R. R. Razonable, D. M. Zerr, . (2009) HHV-6, HHV-7 and HHV-8 in Solid Organ Transplant Recipients. American Journal of Transplantation 9, S97-S100
CrossRef6
Francesco Drago, Francesco Broccolo, Alfredo Rebora. (2009) Pityriasis rosea: An update with a critical appraisal of its possible herpesviral etiology. Journal of the American Academy of Dermatology 61:2, 303-318
CrossRef7
Katherine N Ward. (2009) Unique route for human herpesvirus transmission: HHV-6 and chromosomal integration. Future Virology 4:3, 221-224
CrossRef8
Mark R. Schleiss. (2009) Persistent and Recurring Viral Infections: The Human Herpesviruses. Current Problems in Pediatric and Adolescent Health Care 39:1, 7-23
CrossRef9
Sandrine Kagialis-Girard, Brigitte Durand, Valérie Mialou, Marie-Pierre Pagès, Claire Galambrun, Yves Bertrand, Claude Negrier. (2006) Human herpesvirus 6 infection and transient acquired myelodysplasia in children. Pediatric Blood & Cancer 47:5, 543-548
CrossRef10
A. Fernández-Rodríguez, S. Ballesteros, F. de Ory, J.E. Echevarría, R. Álvarez-Lafuente, G. Vallejo, J. Gómez. (2006) Virological analysis in the diagnosis of sudden children death: A medico-legal approach. Forensic Science International 161:1, 8-14
CrossRef11
Yvonne A. Maldonado. 2006. Less Common Viral Infections. , 933-944.
CrossRef12
John F. Toney. (2005) Skin manifestations of herpesvirus infections. Current Infectious Disease Reports 7:5, 359-364
CrossRef13
Katherine N. Ward, Anton D. Thiruchelvam, Xosé Couto-Parada. (2005) Unexpected occasional persistence of high levels of HHV-6 DNA in sera: Detection of variants A and B. Journal of Medical Virology 76:4, 563-570
CrossRef14
K.N. Ward. (2005) The natural history and laboratory diagnosis of human herpesviruses-6 and -7 infections in the immunocompetent. Journal of Clinical Virology 32:3, 183-193
CrossRef15
Zerr, Danielle M., Meier, Amalia S., Selke, Stacy S., Frenkel, Lisa M., Huang, Meei-Li, Wald, Anna, Rhoads, Margaret P., Nguy, Long, Bornemann, Rena, Morrow, Rhoda Ashley, Corey, Lawrence, . (2005) A Population-Based Study of Primary Human Herpesvirus 6 Infection. New England Journal of Medicine 352:8, 768-776
Full Text16
Tetsushi Yoshikawa. (2004) Human herpesvirus 6 infection in hematopoietic stem cell transplant patients. British Journal of Haematology 124:4, 421-432
CrossRef17
Nahed M. Abdel-Haq, Basim I. Asmar. (2004) Human herpesvirus 6 (HHV6) infection. The Indian Journal of Pediatrics 71:1, 89-96
CrossRef18
W Chu. (2003) Imaging Findings of Paediatric Oncology Patients Presenting with Acute Neurological Symptoms. Clinical Radiology 58:8, 589-603
CrossRef19
Ariel E. Feldstein, Raymund R. Razonable, Thomas G. Boyce, Deborah K. Freese, Mounif El-Youssef, Jean Perrault, Carlos V. Paya, Michael B. Ishitani. (2003) Prevalence and clinical significance of human herpesviruses 6 and 7 active infection in pediatric liver transplant patients. Pediatric Transplantation 7:2, 125-129
CrossRef20
CARRIE L. BYINGTON, DANIELLE M. ZERR, E. WILLIAM TAGGART, LONG NGUY, DAVID R. HILLYARD, KAREN C. CARROLL, LAWRENCE COREY. (2002) Human herpesvirus 6 infection in febrile infants ninety days of age and younger. The Pediatric Infectious Disease Journal 21:11, 996-999
CrossRef21
Mary Anne Jackson, John F. Sommerauer. (2002) Human herpesviruses 6 and 7. The Pediatric Infectious Disease Journal 21:6, 565-566
CrossRef22
Gunnar Skeppner, Anders Kreuger, Göran Elinder. (2002) Transient Erythroblastopenia of Childhood: Prospective Study of 10 Patients With Special Reference to Viral Infections. Journal of Pediatric Hematology/Oncology 24:4, 294-298
CrossRef23
Kiyoshi Aita, Yi Jin, Hiroshi Irie, Ichiro Takahashi, Katsumi Kobori, Yutaka Nakasato, Hiroko Kodama, Yukishige Yanagawa, Tetsushi Yoshikawa, Junji Shiga. (2001) Are there histopathologic characteristics particular to fulminant hepatic failure caused by human herpesvirus-6 infection? A case report and discussion. Human Pathology 32:8, 887-889
CrossRef24
A. Desachy, S. Ranger-Rogez, B. Francois, C. Venot, I. Traccard, H. Gastinne, F. Denis, P. Vignon. (2001) Reactivation of Human Herpesvirus Type 6 in Multiple Organ Failure Syndrome. Clinical Infectious Diseases 32:2, 197-203
CrossRef25
Pablo Alberto Romagnoli, Silvia Viviana Nates, Jorge Victorio Pavan, Horacio Marcelo Serra. (2000) Seroprevalence of human herpesvirus 6 in Andino Puneños (Argentina). Transactions of the Royal Society of Tropical Medicine and Hygiene 94:6, 669-672
CrossRef26
Hideji Uesugi, Hiroyuki Shimizu, Taketoshi Maehara, Nobutaka Arai, Hiroshi Nakayama. (2000) Presence of human herpesvirus 6 and herpes simplex virus detected by polymerase chain reaction in surgical tissue from temporal lobe epileptic patients. Psychiatry and Clinical Neurosciences 54:5, 589-593
CrossRef27
Tetsushi Yoshikawa, Yoshizo Asano. (2000) Central nervous system complications in human herpesvirus-6 infection. Brain and Development 22:5, 307-314
CrossRef28
W. C. Reeves, F. R. Stamey, J. B. Black, A. C. Mawle, J. A. Stewart, P. E. Pellett. (2000) Human Herpesviruses 6 and 7 in Chronic Fatigue Syndrome: A Case-Control Study. Clinical Infectious Diseases 31:1, 48-52
CrossRef29
Charles T. Leach. (2000) Human herpesvirus-6 and -7 infections in children: agents of roseola and other syndromes. Current Opinion in Pediatrics 12:3, 269-274
CrossRef30
Benjamin M Blumberg, David J Mock, James M Powers, Masumi Ito, Jose G Assouline, Jeffrey V Baker, Bojun Chen, Andrew D Goodman. (2000) The HHV6 paradox: ubiquitous commensal or insidious pathogen? A two-step in situ PCR approach. Journal of Clinical Virology 16:3, 159-178
CrossRef31
Haruhiko Kosuge. (2000) HHV-6, 7 and their related diseases. Journal of Dermatological Science 22:3, 205-212
CrossRef32
Keiko Tanaka-Taya, Toshio Kondo, Naoko Nakagawa, Reiko Inagi, Hiroko Miyoshi, Tomimasa Sunagawa, Shintaro Okada, Koichi Yamanishi. (2000) Reactivation of human herpesvirus 6 by infection of human herpesvirus 7. Journal of Medical Virology 60:3, 284-289
CrossRef33
Mark Young Stoeckle. (2000) The Spectrum of Human Herpesvirus 6 Infection: From Roseola Infantum to Adult Disease. Annual Review of Medicine 51:1, 423-430
CrossRef34
Paul K.S. Chan, Ho-Keung Ng, Mamie Hui, Margaret Ip, Jo L.K. Cheung, Augustine F. Cheng. (1999) Presence of human herpesviruses 6, 7, and 8 DNA sequences in normal brain tissue. Journal of Medical Virology 59:4, 491-495
CrossRef35
Stephen J Teach, Howard L Wallace, Mary Jo Evans, Patricia K Duffner, John Hay, Howard S Faden. (1999) Human herpesviruses types 6 and 7 and febrile seizures. Pediatric Neurology 21:4, 699-703
CrossRef36
Jodi B. Black, Philip E. Pellett. (1999) Human herpesvirus 7. Reviews in Medical Virology 9:4, 245-262
CrossRef37
Donald R. Carrigan, Konstance K. Knox. (1999) Pathogenic role of human herpesvirus 6 in transplantation. Current Opinion in Organ Transplantation 4:3, 285-291
CrossRef38
Christine Morris, Mario Luppi, Margaret McDonald, Patrizia Barozzi, Giuseppe Torelli. (1999) Fine mapping of an apparently targeted latent human herpesvirus type 6 integration site in chromosome band 17p13.3. Journal of Medical Virology 58:1, 69-75
CrossRef39
Gregory R. Lockhart, Yen Loo Longobardi, Michael Ehrlich. (1999) Transient Synovitis: Lack of Serologic Evidence for Acute Parvovirus B-19 or Human Herpesvirus-6 Infection. Journal of Pediatric Orthopaedics 19:2, 185-187
CrossRef40
D H Dockrell, T F Smith, C V Paya. (1999) Human herpesvirus 6.. Mayo Clinic Proceedings 74:2, 163-170
CrossRef41
D. Torre, F. Speranza, R. Martegani, P. Ferrante, E. Omodeo-Zorini, R. Mancuso, G. P. Fiori. (1998) Meningoencephalitis caused by human herpesvirus-6 in an immunocompetent adult patient: Case report and review of the literature. Infection 26:6, 402-404
CrossRef42
MARY T. CASERTA, CAROLINE BREESE HALL. (1998) A Practitioner's Guide to Human Herpesvirus-6 (HHV-6) and Human Herpesvirus-7 (HHV-7). AIDS Patient Care and STDs 12:11, 833-842
CrossRef43
BRUCE P. LANPHEAR, CAROLINE B. HALL, JODI BLACK, PEGGY AUINGER. (1998) Risk factors for the early acquisition of human herpesvirus 6 and human herpesvirus 7 infections in children. The Pediatric Infectious Disease Journal 17:9, 792-795
CrossRef44
Mario Luppi, Patrizia Barozzi, Richard Garber, Antonio Maiorana, Goretta Bonacorsi, Tullio Artusi, Raffaella Trovato, Roberto Marasca, Giuseppe Torelli. (1998) Expression of Human Herpesvirus-6 Antigens in Benign and Malignant Lymphoproliferative Diseases. The American Journal of Pathology 153:3, 815-823
CrossRef45
Freimut Wilborna, Thomas Bindera, Frank Neipel, Rainer Blasczyk, Wolfgang Siegert. (1998) Human herpesvirus type 6 variants identified by single-strand conformation polymorphism analysis. Journal of Virological Methods 73:1, 21-29
CrossRef46
R.M. Bland, P.L.K. Mackie, T. Shorts, S. Pate, J.Y. Paton. (1998) The rapid diagnosis and clinical features of human herpesvirus 6. Journal of Infection 36:2, 161-165
CrossRef47
SANDRA H. JEE, CHRISTINE E. LONG, KENNETH C. SCHNABEL, NEERU SEHGAL, LEON G. EPSTEIN, CAROLINE BREESE HALL. (1998) Risk of recurrent seizures after a primary human herpesvirus 6-induced febrile seizure. The Pediatric Infectious Disease Journal 17:1, 43-48
CrossRef48
DAVID W. KIMBERLIN. (1998) Human herpesviruses 6 and 7. The Pediatric Infectious Disease Journal 17:1, 59-68
CrossRef49
Katalin I. Koranyi, Jennifer Chapman, Daniel Scherzer. (1997) IRRITABILITY AND VOMITING IN A FIVE-MONTH-OLD. The Pediatric Infectious Disease Journal 16:12, 1186
CrossRef50
P. K. S. Chan, J. S. M. Peiris, K. Y. Yuen, R. H. S. Liang, Y. L. Lau, F. E. Chen, S. K. F. Lo, C. Y. Cheung, T. K. Chan, M. H. Ng. (1997) Human herpesvirus-6 and human herpesvirus-7 infections in bone marrow transplant recipients. Journal of Medical Virology 53:3, 295-305
CrossRef51
Manmohan Yadav, Meena Arivananthan, Anil Chandrashekran, Bee Siew Tan, Bin Yaacob Hashim. (1997) Human herpesvirus-6 (HHV-6) DNA and virus-encoded antigen in oral lesions. Journal of Oral Pathology and Medicine 26:9, 393-401
CrossRef52
Parmjeet S. Randhawa, Frank J. Jenkins, Michael A. Nalesnik, Jeffrey Martens, Penny A. Williams, Ardith Ries, Si Pham, Anthony J. Demetris. (1997) Herpesvirus 6 Variant A Infection After Heart Transplantation with Giant Cell Transformation in Bile Ductular and Gastroduodenal Epithelium. The American Journal of Surgical Pathology 21:7, 847-853
CrossRef53
M. Arivananthan, M. Yadav, S. Kumar. (1997) Detection of HHV-6 genotypes by in situ hybridization with variant-specific oligonucleotide probes. Journal of Virological Methods 66:1, 5-14
CrossRef54
Jay A Levy. (1997) Three new human herpesviruses (HHV6, 7, and 8). The Lancet 349:9051, 558-563
CrossRef55
G. Dominguez, J. B. Black, F. R. Stamey, N. Inoue, P. E. Pellett. (1996) Physical and genetic maps of the human herpesvirus 7 strain SB genome. Archives of Virology 141:12, 2387-2408
CrossRef56
M. Yadav, M. Arivananthan, S. Kumar. (1996) HHV-6 antigen and viral DNA detected in cervical cells from archived tissue using histochemical staining and hybridization. Clinical and Diagnostic Virology 7:1, 23-33
CrossRef57
S. Marsh, M. Kaplan, Y. Asano, D. Hoekzema, A.L. Komaroff, J.E. Whitman, D.V. Ablashi. (1996) Development and application of HHV-6 antigen capture assay for the detection of HHV-6 infections. Journal of Virological Methods 61:1-2, 103-112
CrossRef58
Anne-Marie Fillet, Isabelle Reux, Cathy Joberty, Jean-Guy Fournier, Jean-Jacques Hauw, Phuc Le Hoang, François Bricaire, Jean-Marie Huraux, Henri Agut. (1996) Detection of human herpes virus 6 in AIDS-associated retinitis by means of in situ hybridization, polymerase chain reaction and immunohistochemistry. Journal of Medical Virology 49:4, 289-295
CrossRef59
E. G. HERMIONE LYALL. (1996) Human herpesvirus 6: primary infection and the central nervous system. The Pediatric Infectious Disease Journal 15:8, 693-696
CrossRef60
Paolo Lusso. (1996) Human herpesvirus 6 (HHV-6). Antiviral Research 31:1-2, 1-21
CrossRef61
Lene Nielsen, Bent Faber Vestergaard. (1996) Competitive ELISA for detection of HHV-6 antibody: seroprevalence in a Danish population. Journal of Virological Methods 56:2, 221-230
CrossRef62
G. J. Lindquester, N. Inoue, R. D. Allen, J. W. Castelli, F. R. Stamey, T. R. Dambaugh, J. J. O'Brian, R. M. Danovich, N. Frenkel, P. E. Pellett. (1996) Restriction endonuclease mapping and molecular cloning of the human herpesvirus 6 variant B strain Z29 genome. Archives of Virology 141:2, 367-379
CrossRef63
EGLAL SHALABY-RANA, DENA SELBY, PERCY IVY, TED SCHUTZBANK, MARIA CHAN, ROMA CHANDRA, MASSOUD MAJD. (1996) Multilocular thymic cyst in a child with acquired immunodeficiency syndrome. The Pediatric Infectious Disease Journal 15:1, 83-86
CrossRef64
Dharam V. Ablashi, John Bernbaum, Joseph A. DiPaolo. (1995) Human herpesvirus 6 as a potential copathogen. Trends in Microbiology 3:8, 324-327
CrossRef65
Giuseppe Torelli, Patrizia Barozzi, Roberto Marasca, Paola Cocconcelli, Elisa Merelli, Luca Ceccherini-Nelli, Sergio Ferrari, Mario Luppi. (1995) Targeted integration of human herpesvirus 6 in the p arm of chromosome 17 of human peripheral blood mononuclear cells in vivo. Journal of Medical Virology 46:3, 178-188
CrossRef66
Anne-Marie Fillet, Martine Raphael, Bertrand Visse, Josée Audouin, Laurent Poirel, Henri Agut. (1995) Controlled study of human herpesvirus 6 detection in acquired immunodeficiency syndrome-associated non-Hodgkin's lymphoma. Journal of Medical Virology 45:1, 106-112
CrossRef67
Freimut Wilborn, Christian Andreas Schmidt, Robert Zimmermann, Volker Brinkmann, Frank Neipel, Wolfgang Siegert. (1994) Detection of herpesvirus type 6 by polymerase chain reaction in blood donors: random tests and prospective longitudinal studies. British Journal of Haematology 88:1, 187-192
CrossRef68
J. Rajčáni, R. Yanagihara, M. S. Godec, J. W. Nagle, M. Kudelova, D. M. Asher. (1994) Low-incidence latent infection with variant B or roseola type human herpesvirus 6 in leukocytes of healthy adults. Archives of Virology 134:3-4, 357-368
CrossRef69
Hall, Caroline BreeseLong, Christine E.Schnabel, Kenneth C.Caserta, Mary T.McIntyre, Kim M.Costanzo, Maria A.Knott, AnneDewhurst, StephenInsel, Richard A.Epstein, Leon G.. (1994) Human Herpesvirus-6 Infection in Children -- A Prospective Study of Complications and Reactivation. New England Journal of Medicine 331:7, 432-438
Full Text70
Keiko Tanaka, Toshio Kondo, Sadayoshi Torigoe, Shintaro Okada, Tetsu Mukai, Koichi Yamanishi. (1994) Human herpesvirus 7: Another causal agent for roseola (exanthem subitum). The Journal of Pediatrics 125:1, 1-5
CrossRef71
Drobyski, William R.Knox, Konstance K.Majewski, DavidCarrigan, Donald R.. (1994) Fatal Encephalitis Due to Variant B Human Herpesvirus-6 Infection in a Bone Marrow-Transplant Recipient. New England Journal of Medicine 330:19, 1356-1360
Full Text72
K. N. Ward, J. J. Gray. (1994) Primary human herpesvirus-6 infection is frequently overlooked as a cause of febrile fits in young children. Journal of Medical Virology 42:2, 119-123
CrossRef73
J. B. Black, P. E. Pellett. (1993) Human herpesvirus 7. Reviews in Medical Virology 3:4, 217-223
CrossRef74
Maureen A. Leahy, Sonja M. Krejci, Marti Friednash, Stephen S. Stockert, Harry Wilson, J. Clark Huff, William L. Weston, Sylvia L. Brice. (1993) Human Herpesvirus 6 Is Present in Lesions of Langerhans Cell Histiocytosis.. Journal of Investigative Dermatology 101:5, 642-645
CrossRef75
Mario Luppi, Roberto Marasca, Patrizia Barozzi, Tullio Artusi, Giuseppe Torelli. (1993) Frequent detection of human herpesvirus-6 sequences by polymerase chain reaction in paraffin-embedded lymph nodes from patients with angioimmunoblastic lymphadenopathy and angioimmunoblastic lymphadenopathy-like lymphoma. Leukemia Research 17:11, 1003-1011
CrossRef76
Harry V. Vinters, Rebecca Wang, Clayton A. Wiley. (1993) Herpesviruses in chronic encephalitis associated with intractable childhood epilepsy. Human Pathology 24:8, 871-879
CrossRef77
Cone, Richard W.Hackman, Robert C.Huang, Meei-Li W.Bowden, Raleigh A.Meyers, Joel D.Metcalf, MarkZeh, JudithAshley, RhodaCorey, Lawrence. (1993) Human Herpesvirus 6 in Lung Tissue from Patients with Pneumonitis after Bone Marrow Transplantation. New England Journal of Medicine 329:3, 156-161
Full Text78
Akashi, KoichiEizuru, YoshitoSumiyoshi, YoshiakiMinematsu, ToshioHara, SachikoHarada, MineKikuchi, MasahiroNiho, YoshiyukiMinamishima, Yoichi. (1993) Severe Infectious Mononucleosis-like Syndrome and Primary Human Herpesvirus 6 Infection in an Adult. New England Journal of Medicine 329:3, 168-171
Full Text79
Agut, Henri, . (1993) Puzzles Concerning the Pathogenicity of Human Herpesvirus 6. New England Journal of Medicine 329:3, 203-204
Full Text80
Jodi B. Black, Naoki Inoue, Kathleen Kite-Powell, Sherif Zaki, Philip E. Pellett. (1993) Frequent isolation of human herpesvirus 7 from saliva. Virus Research 29:1, 91-98
CrossRef81
Eileen M. Burd, Donald R. Carrigan. (1993) Human herpesvirus 6 (HHV-6)-associated dysfunction of blood monocytes. Virus Research 29:1, 79-90
CrossRef82
Pasqualina Bovenzi, Prisco Mirandola, Paola Secchiero, Renata Strumia, Enzo Cassai, Dario Di Luca. (1993) Human herpesvirus 6 (variant A) in Kaposi's sarcoma. The Lancet 341:8855, 1288-1289
CrossRef83
(1993) News for the practitioner. European Journal of Pediatrics 152:1, 78-79
CrossRef84
M. J. Levin. (1993) Impact of herpesvirus infections in the future. Journal of Medical Virology 41:S1, 158-164
CrossRef85
H. Agut, A.M. Fillet. (1992) Les nouveaux herpesvirus. La Revue de Médecine Interne 13:7, S298-S300
CrossRef86
(1992) Herpesvirus 6 Infection in Young Children. New England Journal of Medicine 327:15, 1099-1100
Full Text
- Letters
