Original Article
Hodgkin's Disease, Lymphomatoid Papulosis, and Cutaneous T-Cell Lymphoma Derived from a Common T-Cell Clone
N Engl J Med 1992; 326:1115-1122April 23, 1992
- Abstract
- Abstract
Background.
Lymphomatoid papulosis is a benign cutaneous eruption that in 10 to 20 percent of patients is associated with the development of lymphoma. The atypical cells of lymphomatoid papulosis histologically resemble the malignant cells of cutaneous T-cell lymphoma or the Reed-Sternberg cells of Hodgkin's disease. We studied a patient in whom lymphomatoid papulosis developed in 1971, Hodgkin's disease in 1975, and cutaneous T-cell lymphoma in 1985, to determine whether these diseases are clonally related.
Methods.
The T-cell–receptor α-chain gene was cloned and sequenced from a cell line derived from the advanced-stage cutaneous T-cell lymphoma, and the polymerase chain reaction was used to search for this rearrangement of the α-chain gene in tissues obtained earlier that were affected by Hodgkin's disease or lymphomatoid papulosis.
Results.
The tumor-specific rearrangement of the α-chain gene was detected in the patient's earlier tissues affected by lymphomatoid papulosis and Hodgkin's disease, but not in control tissue, including uninvolved tissues from the staging laparotomy for Hodgkin's disease. Cytogenetic studies revealed a translocation, t(8;9)(p22;p24), in cutaneous T-cell lymphoma lines and in a dermatopathic lymph node removed two years before the clinical onset of the cutaneous T-cell lymphoma. Immunohistochemical findings were consistent with an activated T-cell phenotype for the atypical cells of lymphomatoid papulosis, the Reed-Sternberg cells of Hodgkin's disease, and the malignant cells of the T-cell lymphoma.
Conclusions.
Lymphomatoid papulosis, Hodgkin's disease, and cutaneous T-cell lymphoma can be derived from a single T-cell clone. A t(8;9) genetic translocation may be involved in the pathogenesis of lymphomatoid papulosis or its progression to malignant disease. (N Engl J Med 1992;326:1115–22.)
Media in This Article
Figure 1
T-Cell–Receptor α-Chain Complementary DNA Cloned from the Mac-2B Cell Line.Figure 2
Sections of a Skin Lesion Obtained in 1971, When the Patient Had Type A Lymphomatoid Papulosis.Article Activity
- Article
IN some patients Hodgkin's disease or non-Hodgkin's lymphoma is associated with a second lymphoproliferative disease, either benign or malignant. One such benign lymphoproliferative disease is lymphomatoid papulosis, a recurrent, multifocal cutaneous eruption characterized pathologically as an infiltration of large atypical cells surrounded by inflammatory cells.1 The atypical cells resemble the Reed–Sternberg cells of Hodgkin's disease or the Sézary cells of cutaneous T-cell lymphoma2 and have the immunophenotype of activated T cells.3 , 4 Clonal rearrangements of T-cell–receptor genes have been detected in lesions from some patients,5 6 7 with separate lesions showing identical6 , 7 or distinct5 patterns of rearrangement, suggesting that lymphomatoid papulosis may be either a monoclonal or a multiclonal lymphoproliferative disorder. Approximately 10 to 20 percent of the cases of lymphomatoid papulosis precede or follow a malignant lymphoma, usually cutaneous T-cell lymphoma, Hodgkin's disease, or the recently described Ki-1+ (CD30+) anaplastic large-cell lymphoma.8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 This report describes a patient who presented with lymphomatoid papulosis and in whom Hodgkin's disease and a CD30+ cutaneous T-cell lymphoma subsequently developed. We demonstrate here that cells with an identical rearrangement of the T-cell–receptor α-chain gene were present in all three diseases, providing direct evidence that atypical T lymphocytes in lymphomatoid papulosis and malignant cells in Hodgkin's disease and cutaneous T-cell lymphoma can all arise from a common T-cell clone.
Case Report
A 31-year-old white man presented in 1971 with a rash on the right flank, diagnosed by biopsy as mycosis fungoides, for which he received external-beam irradiation. In 1975, bilateral inguinal lymphadenopathy developed. Biopsies revealed Hodgkin's disease of the mixed-cellularity type, determined to be pathological Stage IIA. Irradiation with 4500 cGy to mantle and inverted-Y fields resulted in a complete response. In the ensuing eight years the patient had recurrent skin nodules that regressed spontaneously. In 1983 a biopsy of skin nodules revealed large cells resembling Reed–Sternberg cells, surrounded by inflammatory cells. A diagnosis of lymphomatoid papulosis of histologic type A was made, and the results of the skin biopsies from 1971 were reinterpreted as showing lymphomatoid papulosis. Biopsies of enlarged lymph nodes performed in 1983 showed only dermatopathic lymphadenopathy, but chromosomal analysis of this tissue showed a translocation, t(8;9)(p22;p24), in 20 percent of the cells in metaphase. In 1985 erythroderma with circulating Sézary-like cells developed, and skin nodules continued to appear and regress spontaneously. Biopsies of several skin nodules again showed type A lymphomatoid papulosis, and biopsies of the erythroderma revealed cutaneous T-cell lymphoma. Cytogenetic analysis of the Sézary-like cells showed the t(8;9)(p22;p24) translocation. In 1987 ulcerating skin lesions developed, which contained numerous large cells consistent with progression to a large-cell lymphoma. The patient died from complications of lymphoma in 1988. Autopsy revealed the infiltration of retroperitoneal lymph nodes by a CD30+ anaplastic large-cell lymphoma.
Methods
Biopsy specimens obtained from the skin lesion in 1971, the inguinal lymph node in 1975, and the lymph nodes removed at autopsy in 1988 were fixed in formalin and embedded in paraffin, and immunohistochemical staining was performed with antibodies BerH2 (CD30), Leu-M1 (CD 15), Leu-4 (CD3), βF1 (T-cell–receptor framework antigen), Leu-22 (CD43), OPD-4 (T-cell antigen with no CD assigned), and L26 (CD20). Skin-biopsy specimens obtained in 1983, 1985, and 1987 were fixed in B5 or formalin for histologic examination and in paraformaldehyde—lysine—periodate (PLP) for immunohistochemical analysis25 with antibodies against activation antigens Ki-1 (CD30), Leu-Ml, Tac (CD25), T9 (CD71), and HLA-DR; T-cell antigens Leu-5 (CD2), Leu-4, Leu-3 (CD4), Leu-1 (CD5), Leu-9 (CD7), and Leu-2 (CD8); and B-cell antigens B1 (CD20) and B4 (CD19).
Cell line Mac-1 was started in 1985 from circulating Sézary-like cells in the peripheral blood. Cell lines Mac-2A and Mac-2B were started from separate skin-tumor nodules in 1987. All the cell lines were grown in RPMI-1640 medium with 15 percent fetal-calf serum. The preparation of chromosomes in metaphase from tissues and cell lines was performed according to standard cytogenetic methods.26 27 28 29 Cytospins of cell lines were fixed in acetone and stained with the same antibodies as the PLP-fixed tissues, plus βF1.
The T-cell–receptor α-chain gene was cloned from the Mac-2B cell line by a modification of the single-sided polymerase-chain-reaction (PCR) method of amplification30 and was sequenced. To test for the presence of this rearrangement of the T-cell–receptor α-chain gene in earlier samples of tissue, PCR amplification was performed on DNA extracted from paraffin-embedded tissues,31 with use of primers specific for the Mac-2B T-cell–receptor α-chain variable (V) and joining (J) regions (Fig. 1Figure 1
T-Cell–Receptor α-Chain Complementary DNA Cloned from the Mac-2B Cell Line.). Reactions were carried out in a 50-μl volume with 1.25 units of Taq DNA polymerase (Promega, Madison, Wis.), PCR buffer supplied by the manufacturer, 0.2 mmol of deoxynucleotide triphosphates per liter, and 10 pmol of each primer. Forty cycles of denaturation at 94°C for 60 seconds, annealing at 55°C for 60 seconds, and extension at 72°C for 60 seconds were performed in an automated thermal cycler (Perkin—Elmer Cetus, Norwalk, Conn.). PCR-amplified DNA was electrophoresed in agarose, transferred to nylon membranes (Biotrans, ICN Biomedicals, Costa Mesa, Calif), and hybridized with a probe spanning the N region of Mac-2B (Fig. 1). To verify the presence of amplifiable DNA, amplification was carried out with primers specific for the constant region of the T-cell–receptor β-chain gene32 (GCTGTGTTTGAGCCATCAGAAGCA, sense; and CCTGGTAGCTGGTCTCACCTA, antisense), and Southern blots of the amplified DNA were hybridized with an internal probe (GCCTTTTGGGTGTGGGAGAT, antisense). T-cell–receptor α-chain DNA amplified by PCR was cloned into pBluescript (Stratagene, La Jolla, Calif.) for sequencing.Results
Pathology
The nodular skin lesions from 1971, 1983, and 1985 were consistent with lymphomatoid papulosis, type A, of Willemze et al.2 (Fig. 2AFigure 2
Sections of a Skin Lesion Obtained in 1971, When the Patient Had Type A Lymphomatoid Papulosis.). The lesions contained atypical cells with variable amounts of amphophilic cytoplasm, large vesicular nuclei, and prominent nucleoli; some resembled the Reed–Sternberg cells of Hodgkin's disease (Fig. 2B). The atypical cells in paraffin sections were positive for CD30 (Fig. 2C), and negative for CD43, CD3, and βF1. Frozen sections of the lesion examined by biopsy in 1983 showed staining of the atypical cells for CD30, CD15, CD25, CD71, and HLA-DR. The atypical cells in the 1985 specimen were positive for CD2 as well. This activated T-cell phenotype is characteristic of the large atypical cells in lymphomatoid papulosis.3 The erythrodermic skin obtained in 1985 revealed a subepidermal and focally epidermotropic lymphoid infiltrate containing large cerebriform lymphocytes, immunoblasts, small lymphocytes, eosinophils, and plasma cells. The thickened epidermis contained foci of cerebriform cells characteristic of cutaneous T-cell lymphoma (Fig. 3AFigure 3
Section of a Skin Lesion and Smear of Peripheral Blood, Obtained in 1985, When the Patient Had Cutaneous T-Cell Lymphoma.). Peripheral blood contained lymphocytes with cerebriform nuclei consistent with Sézary cells (Fig. 3B). Skin lesions that underwent biopsy in 1987 showed numerous large immunoblasts, consistent with a large-cell lymphoma (data not shown).Inguinal lymph nodes biopsied in 1975 showed diagnostic Reed–Sternberg cells in a mixed cellular infiltrate, characteristic of mixed-cellularity Hodgkin's disease (Fig. 4AFigure 4
Reed–Sternberg Cells in a Lymph Node Obtained in 1975, When the Patient Had Hodgkin's Disease.). The Reed–Sternberg cells expressed Hodgkin-associated antigens CD30 (Fig. 4B) and CD15 and T-cell antigens CD43 (Fig. 4C) and the OPD-4 epitope, but they were negative for B-cell antigen CD20. There were no lymphocytes with cerebriform nuclei that could be interpreted as cutaneous T-cell lymphoma cells. Enlarged inguinal and axillary lymph nodes removed in 1983 showed only dermatopathic lymphadenopathy. Autopsy in 1988 revealed large retroperitoneal lymph nodes with dense bands of collagen surrounding abnormal lymphoid nodules (Fig. 5AFigure 5
Ki-1+ (CD30+) Anaplastic Large-Cell Lymphoma in a Retroperitoneal Lymph Node Obtained at Autopsy in 1988 (Hematoxylin–Eosin Staining).). These nodules contained Reed–Sternberg cells (Fig. 5B) that were positive for CD30 and CD15. This pattern was consistent with nodular sclerosing Hodgkin's disease except for numerous anaplastic tumor cells filling lymph-node sinuses (Fig. 5C). Because of the latter feature, which is uncharacteristic of Hodgkin's disease, the lymph nodes examined at autopsy were interpreted as indicating a CD30+ anaplastic large-cell lymphoma.17 18 19 20 , 33 Cell Lines and Cytogenetic Analysis
Each cell line contained small lymphocytes and larger cells resembling Reed–Sternberg cells. Lines Mac-2A and Mac-2B, which were derived from the later lymphoma, had a higher percentage of large cells. The cell line derived from circulating Sézary-like cells, Mac-1, had the phenotype of activated helper T cells, expressing CD30, CD2, and CD4. Mac-2A and Mac-2B were also positive for CD30 and additionally positive for CD15, but no longer expressed CD2 and CD4. Chromosomal analysis of all three cell lines revealed a consistent cytogenetically balanced translocation, t(8;9)(p22;p24), identical to the t(8;9) translocation detected in the dermatopathic lymph node from 1983 and in the Sézary-like cells from 1985. Numerous additional chromosomal abnormalities were seen in lines Mac-2A and Mac-2B.
Rearrangements of the T-Cell–Receptor α-Chain Gene
Molecular cloning of the T-cell–receptor gene from the Mac-2B cell line was used to establish the relation between the patient's cutaneous T-cell lymphoma and the earlier lymphomatoid papulosis and Hodgkin's disease. The complementary DNA encoding the functionally rearranged T-cell–receptor α chain (Fig. 1) and the nonfunctional α chain (data not shown) were isolated. The functional T-cell–receptor α chain used a variable-region gene, not previously described, rearranged to JαL, whereas the nonfunctional gene used Vα8.1.34 Northern blot analysis with a probe specific for the functional Mac-2B T-cell–receptor α-chain variable region showed that this chain was also expressed by the Mac-1 and Mac-2A cell lines (data not shown). These results were consistent with the cytogenetic evidence that all three cell lines were derived from a common T-cell clone.
Conventional Southern blot analysis could not be performed on the earlier tissue specimens because of the extensive fragmentation of DNA extracted from paraffin-embedded tissue and the low frequency of Reed–Sternberg cells in the samples affected by Hodgkin's disease. Therefore, to determine whether the rearrangement of the T-cell–receptor α-chain gene from the cutaneous T-cell lymphoma was present in the earlier lymphomatoid papulosis and Hodgkin's disease, PCR amplification of DNA extracted from these lesions was performed with primers specific for the variable- and joining-region segments of the Mac-2B T-cell–receptor α-chain gene. Southern blotting of the amplified DNA with an internal probe spanning the N region is shown in Figure 6AFigure 6
Southern Blots of PCR Amplification of DNA Extracted from Tissue Samples.. Hybridization was seen with PCR products from two different paraffin blocks of the 1971 lesion due to lymphomatoid papulosis and from the 1975 lymph node affected by Hodgkin's disease, but not from a control sample. Analysis of histologically uninvolved lymph-node, liver, and spleen tissue from the 1975 laparotomy for the staging of Hodgkin's disease was negative (data not shown). The tissue obtained from the dermatopathic lymph node in 1983 was not available for analysis.PCR amplification of a nonrearranged segment of the genome, the constant region of the T-cell–receptor β-chain gene, was used to estimate the relative amount of amplifiable DNA in each sample (Fig. 6B), and densitometry was performed on the Southern blots to determine the approximate ratios of specifically rearranged T-cell–receptor α-chain DNA to total DNA (Fig. 6). These ratios corresponded to the relative frequencies of atypical cells determined by microscopy and immunohistochemical analysis: the second sample affected by lymphomatoid papulosis (Fig. 6, lane B) had the highest percentage of atypical cells and the highest ratio of α-chain DNA to β-chain DNA, whereas the lymph node affected by Hodgkin's disease (Fig. 6, lane C), with its infrequent Reed–Sternberg cells, had the lowest ratio. These data were consistent with the derivation of the amplified T-cell–receptor α-chain product from atypical lymphomatoid papulosis cells and Reed–Sternberg cells.
To verify the identity of the amplified T-cell–receptor α-chain DNA detected by the N-region probe, the PCR products were cloned and sequenced. The sequence of the T-cell–receptor α chain cloned from both the 1971 lymphomatoid papulosis lesion and the 1975 tissue affected by Hodgkin's disease was identical to that of the Mac-2B cell line. This result confirmed that the T-cell clone containing the T-cell–receptor α chain of the cutaneous T-cell lymphoma was present in the earlier lesion due to lymphomatoid papulosis and the lymph node affected by Hodgkin's disease.
Discussion
These findings demonstrate that the T-cell clone that caused this patient's cutaneous T-cell lymphoma was present 14 years earlier in a lymphomatoid papulosis skin lesion and 10 years earlier in a lymph node affected by Hodgkin's disease. Several lines of evidence indicate that this T-cell clone corresponds to the large atypical cells of the lymphomatoid papulosis and to the Reed–Sternberg cells of the Hodgkin's disease. It is unlikely that this T-cell clone represents a second, concurrent lymphoproliferative disease, since such a disorder would have to have been widely disseminated in 1971 and 1975 and yet remained indolent for at least 14 years without systemic treatment. No evidence of a second lymphoproliferative disorder was detected histologically or immunohistochemically in the samples affected by lymphomatoid papulosis or Hodgkin's disease. Cytogenetic analyses performed repeatedly from 1983 through 1988, during which time both the lymphomatoid papulosis and the cutaneous T-cell lymphoma were active, detected only clonal derivatives of cells with the t(8;9) translocation, further indicating that no additional concurrent lymphoproliferative disorder was present. Finally, the amount of specifically rearranged T-cell–receptor α-chain PCR product corresponded to the number of atypical lymphomatoid papulosis and Reed–Sternberg cells, and this T-cell–receptor α-chain gene could not be amplified from tissue from the patient's histologically normal spleen, liver, or lymph nodes from the 1975 staging laparotomy.
Detection of a persistent T-cell clone in this patient's earliest known lesion due to lymphomatoid papulosis supports a monoclonal T-cell origin for this disease. Previous studies of rearrangements of the T-cell–receptor gene have suggested, however, that it may begin as a monoclonal6 , 7 or oligoclonal5 proliferation of atypical T lymphocytes, and one study failed to find any rearrangements in type A lymphomatoid papulosis.7 These data are not inconsistent with a monoclonal T-cell—lineage origin for lymphomatoid papulosis if one hypothesizes that an initiating genetic event may occur at a variable point in T-cell development, either before gene rearrangement, resulting in oligoclonal, polyclonal, or unrearranged T-cell–receptor genes, or after rearrangement, resulting in a monoclonal T-cell–receptor gene (Fig. 7Figure 7
Models of the Development of Lymphomatoid Papulosis and Associated Malignant Lymphomas.).The precise relation between lymphomatoid papulosis and the subsequent lymphomas in our patient is not clear. A direct linear progression (Fig. 7) seems unlikely. It is possible that the lymphomatoid papulosis produced two subclones that evolved independently into Hodgkin's disease and cutaneous T-cell lymphoma (Fig. 7), as previously hypothesized.24 We suggest a third, more general model, which posits the existence of an occult, abnormal T-cell clone, subclones of which acquired independent genetic abnormalities to produce lymphomatoid papulosis, Hodgkin's disease, and cutaneous T-cell lymphoma (Fig. 7). This model is consistent with the observation that lymphomatoid papulosis can precede, coexist with, or follow a malignant lymphoma, and that Hodgkin's disease has also been associated with non-Hodgkin's lymphomas in the absence of lymphomatoid papulosis or other premalignant conditions.8 9 10 11 12 13 14 15 16 Such an occult precursor clone may have been detected in the dermatopathic lymph node obtained in 1983, which contained cells with the t(8;9) translocation but no recognizable lymphoproliferative disease; these cells may have been too rare to be detected in normal tissues obtained in 1975.
The t(8;9) translocation was probably involved in the initiation or early progression of this patient's lymphoproliferative disease. A similar-appearing rearrangement of chromosome 9 at p22–23 was described in the only other T-cell lymphoma associated with lymphomatoid papulosis that has been karyotyped.15 Breakpoints in this region of chromosome 9 have been detected infrequently in non-Hodgkin's lymphomas of T-cell or null-cell phenotype35 36 37 and in Hodgkin's disease.38 A breakpoint on chromosome 8 at band p22–23 has been noted in five cases of large-cell lymphoma, two of which involved translocations to the short arm of chromosome 9,35 , 37 and in several cases of Hodgkin's disease.38
This study demonstrates a T-cell origin for this patient's Hodgkin's disease, on the basis of the detection of a clonal rearrangement of the T-cell–receptor α-chain gene, the expression of T-cell—lineage antigens, and the absence of B-cell—lineage antigens. This confirms and extends previous observations indicating that some forms of Hodgkin's disease have a T-cell origin. Rearrangements of T-cell–receptor β- and γ-chain genes and chromosomal abnormalities associated with loci of the T-cell–receptor gene have been demonstrated in Hodgkin's disease cell lines and tissues from patients with the disease.39 40 41 42 Previous studies have also demonstrated the expression of T-cell antigens (CD2, CD4, CD3, and βF1) in a subgroup of patients with Hodgkin's disease.43 44 45 46 In other patients, a B-cell origin seems more likely, as suggested by the expression of B-cell antigens47 and by rearrangements of immunoglobulin48 , 49 and bcl-2 genes.50 The Hodgkin's disease phenotype may thus represent a common pathway for the malignant transformation of several different cell types. Further studies of Hodgkin's disease and non-Hodgkin's lymphomas associated with lymphomatoid papulosis and other lymphoproliferative diseases are needed to determine whether these cancers are distinct in pathogenesis and clinical behavior from lymphomas that arise independently.
Supported by grants to Dr. Kadin from the American Cancer Society (CD 485) and the Council for Tobacco Research, U.S.A.. (2630R2), and by a grant (HL 07516) to Dr. Davis from the Hematology Career Training Program of the National Institutes of Health.
We are indebted to Drs. Suzanne Ulbricht and Steven Come of Beth Israel Hospital, Boston, for clinical care of this patient, and to Dr. Carl Kjeldsberg, Department of Pathology, University of Utah, for providing autopsy tissues.
Source Information
From the Division of Hematology—Oncology, Department of Medicine (T.H.D., S.P.B.), and the Department of Pathology (R.M.-C, M.E.K.), Beth Israel Hospital; the Department of Pathology, Brigham and Women's Hospital (C.C.M.); and Harvard Medical School (T.H.D., C.C.M., R.M.-C, S.P.B., M.E.K.); all in Boston. Address reprint requests to Dr. Kadin at the Department of Pathology, Beth Israel Hospital, 330 Brookline Ave., Boston MA 02215.
- References
References
1
Macaulay
CrossRef | Web of Science | Medline2
Willemze
CrossRef | Web of Science | Medline3
Kadin
Web of Science | Medline4
Ralfkiaer
Web of Science | Medline5
Weiss
Full Text | Web of Science | Medline6
Kadin
Web of Science | Medline7
Whittaker
CrossRef | Web of Science | Medline8
Weinman
CrossRef | Web of Science | Medline9
Sanchez
CrossRef | Web of Science | Medline10
Madison
CrossRef | Web of Science | Medline11
Chen
CrossRef | Web of Science | Medline12
Wantzin
CrossRef | Web of Science | Medline13
Lederman
CrossRef | Web of Science | Medline14
Tucker
CrossRef | Web of Science | Medline15
Harrington
CrossRef | Web of Science | Medline16
Kaudewitz
CrossRef | Web of Science | Medline17
Stein
Web of Science | Medline18
Kadin
Web of Science | Medline19
Chott
CrossRef | Web of Science | Medline20
Greer
Web of Science | Medline21
Chan
CrossRef | Web of Science | Medline22
Hawkins
CrossRef | Web of Science | Medline23
Kadin ME. The spectrum of Ki-l+ cutaneous lymphomas. In: vanVloten WA, Willemze R, Lange Vejlsgaard G, Thomsen K, eds. Cutaneous lymphoma. Vol. 19 of Current problems in detmatology. Basel, Switzerland: Karger, 1990:132–43.
24
Idem. Common activated helper-T cell-origin for lymphomatoid papulosis, mycosis fungoides, and some types of Hodgkin's disease . Lancet 1985;2: 864–5.
Web of Science | Medline25
Muramoto
Web of Science | Medline26
Moorhead
CrossRef | Web of Science | Medline27
Sehested
CrossRef | Medline28
Caspersson
CrossRef | Web of Science29
Seabright
CrossRef | Web of Science | Medline30
Balk
CrossRef | Web of Science | Medline31
Wright DK, Manos MM. Sample preparation from paraffin-embedded tissues. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR protocols: a guide to methods and applications. San Diego, Calif.: Academic Press, 1990:153–8.
32
Toyonaga
CrossRef | Web of Science | Medline33
Agnarsson
CrossRef | Web of Science | Medline34
Toyonaga
CrossRef | Web of Science | Medline35
Cabanillas
Web of Science | Medline36
Fujita
CrossRef | Web of Science | Medline37
Levine
Web of Science | Medline38
Tilly
Web of Science | Medline39
Drexler
CrossRef | Web of Science | Medline40
Fonatsch C, Gradl G, Rademacher JL. Genetics of Hodgkin's lymphoma. In: Diehl V, Pfreundschuh M, Loeffler M, eds. New aspects in the diagnosis and treatment of Hodgkin's disease. Vol. 117 of Recent results in cancer research. Berlin, Germany: Springer-Verlag, 1989:35–49.
41
Griesser
CrossRef | Web of Science | Medline42
Herbst
CrossRef | Web of Science | Medline43
Falini
CrossRef | Web of Science | Medline44
Kadin
Web of Science | Medline45
Casey
Web of Science | Medline46
Dallenbach
CrossRef | Web of Science | Medline47
Pinkus
Web of Science | Medline48
Weiss
CrossRef | Web of Science | MedlineErratum, Hum Pathol 1986;17:1106
CrossRef | Web of Science49
Brinker
Web of Science | Medline50
Stetler-Stevenson
CrossRef | Web of Science | Medline
- Citing Articles (77)
Citing Articles
1
Raymond J. Cho, Timothy H. McCalmont, Weiyun Z. Ai, Lindy P. Fox, Patrick Treseler, Laura B. Pincus. (2012) CASE REPORT DEMONSTRATING USE OF AN EXPANDED IMMUNOHISTOCHEMICAL PANEL TO DISTINGUISH CUTANEOUS HODGKIN LYMPHOMA FROM HISTOPATHOLOGIC IMITATORS. Journal of Cutaneous Pathologyno-no
CrossRef2
Aieska de Souza, Rokea A. el-Azhary, Michael J. Camilleri, David A. Wada, David L. Appert, Lawrence E. Gibson. (2011) In search of prognostic indicators for lymphomatoid papulosis: A retrospective study of 123 patients. Journal of the American Academy of Dermatology
CrossRef3
K. Van Roosbroeck, L. Cox, T. Tousseyn, I. Lahortiga, O. Gielen, B. Cauwelier, P. De Paepe, G. Verhoef, P. Marynen, P. Vandenberghe, C. De Wolf-Peeters, J. Cools, I. Wlodarska. (2011) JAK2 rearrangements, including the novel SEC31A-JAK2 fusion, are recurrent in classical Hodgkin lymphoma. Blood 117:15, 4056-4064
CrossRef4
Lyn M. Duncan, Johanna L. Baran, Judith A. Ferry. 2011. Cutaneous Lymphomas. , 281-326.
CrossRef5
Parul Bhargava, Marshall E. Kadin. 2011. Immunohistology of Hodgkin Lymphoma. , 137-155.
CrossRef6
M.R. Kamstrup, E. Biskup, R. Gniadecki. (2010) Notch signalling in primary cutaneous CD30+ lymphoproliferative disorders: a new therapeutic approach?. British Journal of Dermatology 163:4, 781-788
CrossRef7
Tudung T. Nguyen, Roger A. Warnke, Katie Seo, Saul A. Rosenberg, Daniel A. Arber. (2010) Rare presentation of classical Hodgkin lymphoma with a clonal T-cell receptor gene rearrangement in the tissue. Leukemia & Lymphoma 51:7, 1356-1359
CrossRef8
L. Calzado-Villarreal, I. Polo-Rodríguez, P.L. Ortiz-Romero. (2010) Síndrome linfoproliferativo CD30+ cutáneo primario. Actas Dermo-Sifiliográficas 101:2, 119-128
CrossRef9
Geoffrey Strutton. 2010. Cutaneous infiltrates – lymphomatous and leukemic. , 971-1005.
CrossRef10
2010. 41 Cutaneous infiltrates – lymphomatous and leukemic. , 851-881.
CrossRef11
Haresh Mani, Elaine S. Jaffe. (2009) Hodgkin Lymphoma: An Update on Its Biology With New Insights Into Classification. Clinical Cancer Reviews 3:1, 54-64
CrossRef12
Franziska C. Eberle, Haresh Mani, Elaine S. Jaffe. (2009) Histopathology of Hodgkin’s Lymphoma. The Cancer Journal 15:2, 129-137
CrossRef13
Pierre Ronco, Hanna Debiec. (2009) Pathophysiological lessons from rare associations of immunological disorders. Pediatric Nephrology 24:1, 3-8
CrossRef14
Daniel Humme, Ansgar Lukowsky, Matthias Steinhoff, Marc Beyer, Peter Walden, Wolfram Sterry, Chalid Assaf. (2009) Dominance of Nonmalignant T-Cell Clones and Distortion of the TCR Repertoire in the Peripheral Blood of Patients with Cutaneous CD30+ Lymphoproliferative Disorders. Journal of Investigative Dermatology 129:1, 89-98
CrossRef15
Gian Marco Ghiggeri, Dario Bleid, Alberto Garaventa, Cristina Coccia, Claudio Gambini, Gianluca Caridi, Francesco Perfumo. (2009) Recurrent lymphomatoid papulosis associated with nephrotic syndrome. An occurrence of uncertain origin. Pediatric Nephrology 24:1, 189-192
CrossRef16
Claudiu V. Cotta, Eric D. Hsi. (2008) Pathobiology of Mature T-Cell Lymphomas. Clinical Lymphoma, Myeloma & Leukemia 8:0, S168-S179
CrossRef17
D. Korpusik, T. Ruzicka. (2007) Klinische Verlaufsformen und Therapie der lymphomatoiden Papulose. Der Hautarzt 58:10, 870-881
CrossRef18
J. Campos Franco, R. López Rodríguez, J. García González, I. Abdulkader Nallib, M.R. Alende Sixto, A. González Quintela. (2006) Masa pélvica en un paciente con antecedente de micosis fungoide. Revista Clínica Española 206:11, 595-596
CrossRef19
T Krejsgaard, C S Vetter-Kauczok, A Woetmann, P Lovato, T Labuda, K W Eriksen, Q Zhang, J C Becker, N Ødum. (2006) Jak3- and JNK-dependent vascular endothelial growth factor expression in cutaneous T-cell lymphoma. Leukemia 20:10, 1759-1766
CrossRef20
A. Barzilai, H. Trau, M. David, M. Feinmesser, R. Bergman, D. Shpiro, G. Schiby, K. Rosenblatt, R. Or, E. Hodak. (2006) Mycosis fungoides associated with B-cell malignancies. British Journal of Dermatology 155:2, 379-386
CrossRef21
Andreas Bräuninger, Roland Schmitz, Dörte Bechtel, Christoph Renné, Martin-Leo Hansmann, Ralf Küppers. (2006) Molecular biology of Hodgkin's and Reed/Sternberg cells in Hodgkin's lymphoma. International Journal of Cancer 118:8, 1853-1861
CrossRef22
Ashraf A. Abou-Elella, Thomas P. Nifong. (2006) Composite EBV negative peripheral T-cell lymphoma and diffuse large B-cell lymphoma involving the ileum: A case report and a systematic review of the literature. Leukemia & Lymphoma 47:10, 2208-2217
CrossRef23
F. Grange. (2005) Pronostic des lymphomes T cutanés primitifs. Annales de Dermatologie et de Vénéréologie 132, 13-20
CrossRef24
Alexandar Tzankov, Caroline Bourgau, Alexandra Kaiser, Annette Zimpfer, Robert Maurer, Stefano A Pileri, Philip Went, Stephan Dirnhofer. (2005) Rare expression of T-cell markers in classical Hodgkin's lymphoma. Modern Pathology
CrossRef25
Mike Notohamiprodjo, Stephan Segerer, Ralf Huss, Bernhard Hildebrandt, Dulce Soler, Roghieh Djafarzadeh, Wiebke Buck, Peter J. Nelson, Irene von Luettichau. (2005) CCR10 is expressed in cutaneous T-cell lymphoma. International Journal of Cancer 115:4, 641-647
CrossRef26
R Dukic, A Derragui, S Geiss, J.-M Wilhelm, P Thannberger, A Colson, P Kieffer. (2004) Papulose lymphomatoïde atypique à grandes cellules supposée déclenchée par la minocycline. La Revue de Médecine Interne 25:5, 401-404
CrossRef27
Sylke Gellrich, Martin Wernicke, Anke Wilks, Ansgar Lukowsky, J. Marcus Muche, Kim Christian Jasch, Heike Audring, David Mason, Wolfram Sterry. (2004) The Cell Infiltrate in Lymphomatoid Papulosis Comprises a Mixture of Polyclonal Large Atypical Cells (CD30-Positive) and Smaller Monoclonal T cells (CD30-Negative). Journal of Investigative Dermatology 122:3, 859-861
CrossRef28
Rein Willemze, Chris J.L.M Meijer. (2003) Primary cutaneous CD30-positive lymphoproliferative disorders. Hematology/Oncology Clinics of North America 17:6, 1319-1332
CrossRef29
Marshall E Kadin, Christopher Carpenter. (2003) Systemic and primary cutaneous anaplastic large cell lymphomas. Seminars in Hematology 40:3, 244-256
CrossRef30
A. Neil Crowson, MD, Dmitry Y. Baschinsky, MD, Al Kovatich, MSc, Cynthia Magro, MD. (2003) Granulomatous Eccrinotropic Lymphomatoid Papulosis. American Journal of Clinical Pathology 119:5, 731-739
CrossRef31
R.U. Sidwell, J.E. McLaughlin, A. Jones, S.J. Whittaker. (2003) Hodgkin Lymphoma in a patient with mycosis fungoides: molecular evidence for separate cellular origins. British Journal of Dermatology 148:4, 810-812
CrossRef32
Werner Kempf, Edi Levi, Jivko Kamarashev, Heinz Kutzner, Walther Pfeifer, Tina Petrogiannis-Haliotis, Gunter Burg, Marshall E. Kadin. (2002) Fascin expression in CD30-positive cutaneous lymphoproliferative disorders. Journal of Cutaneous Pathology 29:5, 295-300
CrossRef33
Katarzyna Dadej, Louis Gaboury, Louis Lamarre, Caroline Pétorin, Chantal Séguin, Marcel Cadotte, Isabelle Gòrska–Flipot. (2001) The Value of Clonality in the Diagnosis and Follow-up of Patients With Cutaneous T-cell Infiltrates. Diagnostic Molecular Pathology 10:2, 78-88
CrossRef34
Stephan W. Morris, Liquan Xue, Zhigui Ma, Marsha C. Kinney. (2001) Alk+ CD30+ lymphomas: a distinct molecular genetic subtype of non-hodgkin's lymphoma. British Journal of Haematology 113:2, 275-295
CrossRef35
Shiyong Li, Douglas T. Ross, Marshall E. Kadin, Patrick O. Brown, Mariusz A. Wasik. (2001) Comparative Genome-Scale Analysis of Gene Expression Profiles in T Cell Lymphoma Cells during Malignant Progression Using a Complementary DNA Microarray. The American Journal of Pathology 158:4, 1231-1237
CrossRef36
Akira Miyata, Kensuke Kojima, Tadashi Yoshino, Soichirou Fujii, Katsuji Shinagawa, Koichi Ichimura. (2001) Concurrent Hodgkin’s Disease (Mixed Cellularity Type) and T-Cell Chronic Lymphocytic Leukemia/Prolymphocytic Leukemia. International Journal of Hematology 73:2, 230-235
CrossRef37
Werner Kempf, Marshall E. Kadin, Heinz Kutzner, Carol L. Lord, Guenter Burg, Norman L. Letvin, Igor J. Koralnik. (2001) Lymphomatoid papulosis and human herpesviruses - A PCR-based evaluation for the presence of human herpesvirus 6, 7 and 8 and related herpesviruses. Journal of Cutaneous Pathology 28:1, 29-33
CrossRef38
Christopher S. Bee, Yolande P. Blaise, Cherie H. Dunphy. (2001) Composite Lymphoma of Hodgkin Lymphoma and Mycosis Fungoides: Previously Undescribed in the Same Extracutaneous Site. Leukemia & Lymphoma 42:3, 543-549
CrossRef39
Edi Levi, Zhenxi Wang, Tina Petrogiannis-Haliotis, Walther M. Pfeifer, Werner Kempf, Reed Drews, Marshall E. Kadin. (2000) Distinct Effects of CD30 and Fas Signaling in Cutaneous Anaplastic Lymphomas: A Possible Mechanism for Disease Progression. Journal of Investigative Dermatology 115:6, 1034-1040
CrossRef40
Brigitte Granel, Jacques Serratrice, Laure Swiader, Nicole Horshowski, Didier Blaise, Norbert Vey, Dominique Metras, Gilbert Habib, Patrick Disdier, Pierre-Jean Weiller. (2000) Lymphomatoid papulosis associated with both severe hypereosinophilic syndrome and CD30 positive large T-cell lymphoma. Cancer 89:10, 2138-2143
CrossRef41
Matthias Schmuth, Gerda Topar, Brigitte Illersperger, Elisabeth Kowald, Peter O. Fritsch, Norbert T. Sepp. (2000) Therapeutic use of interferon-? for lymphomatoid papulosis. Cancer 89:7, 1603-1610
CrossRef42
James Sciubba, Nasser Said-al-Naief, John Fantasia. (2000) Critical review of lymphomatoid papulosis of the oral cavity with case report. Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology, and Endodontology 90:2, 195-204
CrossRef43
R DUMMER, J WILLERS, J KAMARASHEV, M UROSEVIC, U DOBBELING, G BURG. (2000) Pathogenesis of cutaneous lymphomas. Seminars in Cutaneous Medicine and Surgery 19:2, 78-86
CrossRef44
R DREWS, A SAMEL, M KADIN. (2000) Lymphomatoid papulosis and anaplastic large cell lymphomas of the skin. Seminars in Cutaneous Medicine and Surgery 19:2, 109-117
CrossRef45
A Tavani, C La Vecchia, S Franceschi, D Serraino, A Carbone. (2000) Medical history and risk of Hodgkinʼs and non-Hodgkinʼs lymphomas. European Journal of Cancer Prevention 9:1, 59-64
CrossRef46
M. Muschen, K. Rajewsky, A. Brauninger, A. S. Baur, J. J. Oudejans, A. Roers, M.-L. Hansmann, R. Kuppers. (2000) Rare Occurrence of Classical Hodgkin's Disease as a T Cell Lymphoma. Journal of Experimental Medicine 191:2, 387-394
CrossRef47
Epstein, Franklin H., , Küppers, Ralf, Klein, Ulf, Hansmann, Martin-Leo, Rajewsky, Klaus, . (1999) Cellular Origin of Human B-Cell Lymphomas. New England Journal of Medicine 341:20, 1520-1529
Full Text48
Leticia Quintanilla-Martinez, Falko Fend, Leticia Rodriguez Moguel, Lori Spilove, Michael W. Beaty, Douglas W. Kingma, Mark Raffeld, Elaine S. Jaffe. (1999) Peripheral T-Cell Lymphoma With Reed-Sternberg-like Cells of B-Cell Phenotype and Genotype Associated With Epstein-Barr Virus Infection. The American Journal of Surgical Pathology 23:10, 1233
CrossRef49
L. Geldenhuys, J. Radhi, P. R. Hull. (1999) Mycosis fungoides and cutaneous Hodgkin's disease in the same patient: a case report. Journal of Cutaneous Pathology 26:6, 311-314
CrossRef50
Márcia M. Silva, José Carlos Morais, Nelson Spector, Juan Maceira, Maria Auxiliadora J. Sousa, Absalom L. Filgueira. (1998) Lymphomatoid papulosis followed by Hodgkin's disease. International Journal of Dermatology 37:7, 541-543
CrossRef51
Joan Guitart, David Fretzin. (1998) Skin as the Primary Site of Hodgkin's Disease:. The American Journal of Dermatopathology 20:2, 218-222
CrossRef52
Rachael D. Liebmann, Brian Anderson, Keith P. McCarthy, Jade W. M. Chow. (1997) The polymerase chain reaction in the diagnosis of early mycosis fungoides. The Journal of Pathology 182:3, 282-287
CrossRef53
Michele Bernier, Marline Bagot, Murielle Broyer, Jean-Pierre Farcet, Philippe Gaulard, Janine Wechsler. (1997) Distinctive clinicopathologic features associated with regressive primary CD30 positive cutaneous lymphomas: analysis of 6 cases. Journal of Cutaneous Pathology 24:3, 157-163
CrossRef54
Hiroaki Yagi, Yoshiki Tokura, Fukumi Furukawa, Masahiro Takigawa. (1996) Th2 Cytokine mRNA Expression in Primary Cutaneous CD30-Positive Lymphoproliferative Disorders: Successful Treatment With Recombinant Interferon-gamma.. Journal of Investigative Dermatology 107:6, 827-832
CrossRef55
SYLVIE LOUVET, ANNE DOMPMARTIN, XAVIER TROUSSARD, FRANÇOISE GALATEAU, ANNE MOREAU, OUMEDALLI REMAN, MICHEL LEPORRIER, DOMINIQUE LEROY. (1996) SPECTRUM OF CD30 LYMPHOPROLIFERATIVE DISEASES FROM LYMPHOMATOID PAPULOSIS TO ANAPLASTIC LARGE CELL LYMPHOMA. International Journal of Dermatology 35:12, 842-848
CrossRef56
Shimareet Kumar, Douglas W. Kingma, William B. Weiss, Mark Raffeld, Elaine S. Jaffe. (1996) Primary Cutaneous Hodgkin's Disease with Evolution to Systemic Disease. The American Journal of Surgical Pathology 20:6, 754-759
CrossRef57
Laurian Balus, Liborio Manente, Daniele Remotti, Paola Grammatico, Marinella Bellocci. (1996) Granulomatous Slack Skin. The American Journal of Dermatopathology 18:2, 199-206
CrossRef58
Andreas Chott, Eric C. Vonderheid, Suzanne Olbricht, Ning-Ning Miao, Steven P. Balk, Marshall E. Kadin. (1996) The Same Dominant T Cell Clone Is Present in Multiple Regressing Skin Lesions and Associated T Cell Lymphomas of Patients with Lymphomatoid Papulosis.. Journal of Investigative Dermatology 106:4, 696-700
CrossRef59
Gary S. Wood, Carol F. Crooks, Ahmet Z. Uluer. (1995) Lymphomatoid Papulosis and Associated Cutaneous Lymphoproliferative Disorders Exhibit a Common Clonal Origin.. Journal of Investigative Dermatology 105:1, 51-55
CrossRef60
Gary S. Wood. (1995) Lymphocyte Activation in Cutaneous T-Cell Lymphoma.. Journal of Investigative Dermatology 105:s1, 105S-109S
CrossRef61
K Peters. (1995) Cytogenetic findings in regressing skin lesions of lymphomatoid papulosis. Cancer Genetics and Cytogenetics 80:1, 13-16
CrossRef62
R. STEVEN PADILLA, RANDALL L. SNOOK. (1995) Stump the Experts. Dermatologic Surgery 21:3, 263-264
CrossRef63
Matthew J. McCarty, Svetislava J. Vukelja, Edward A. Sausville, James J. Perry, William D. James, Elaine S. Jaffe, Raymond B. Weiss. (1994) Lymphomatoid papulosis associated with Ki-1-positive anaplastic large cell lymphoma. A report of two cases and a review of the literature. Cancer 74:11, 3051-3058
CrossRef64
Gary S. Wood, Rosnn M. Tung, Andreas C. Heaffner, Carol F. Crooks, Shaoyi Liao, Rachaci Orozco, Hendrik Veelken, Marshall E. Kadin, Howard Koh, Peter Heald, Raymond L. Barnhill, Jeffrey Sklar. (1994) Detection of Clonal T-Cell Receptor gamma Gene Rearrangements in Early Mycosis Fungoides/Sezary Syndrome by Polymerase Chain Reaction and Denaturing Gradient Gel Electrophoresis (PCR/DGGE).. Journal of Investigative Dermatology 103:1, 34-41
CrossRef65
Mitsuru Matsumoto, Kiyonori Takada, Takaaki Hato, Takahiko Horiuchi, Masaki Yasukawa, Shinichi Murao, Shigeru Fujita. (1994) Monoclonal proliferation of double-negative (CD4−CD8−) T-cells bearing T-Cell receptor-αβ followed by subsequent development of Hodgkin's disease. Cancer 73:11, 2818-2823
CrossRef66
R. WILLEMZE, R.C. BELJAARDS, C.J.L.M. MEIJER. (1994) Classification of primary cutaneous T-cell lymphomas. Histopathology 24:5, 405-415
CrossRef67
Matthias Volkenandt, Joseph R. Bertino, B.Vittal Shenoy, Olaf M. Koch, Marshall E. Kadin. (1993) Molecular evidence for a clonal relationship between lymphomatoid papulosis and Ki-1 positive large cell anaplastic lymphoma. Journal of Dermatological Science 6:2, 121-126
CrossRef68
Matthias Volkenandt, Raif Wienecke, Olaf M. Koch, Jan Buer, Michael Probst, Jens Atzpodien, Tetsuro Horikoshi, sKathleen Danenberg, sPeter Danenberg, sJoseph R. Bertino. (1993) Conformational Polymorphism of cRNA of T-Cell-Receptor Genes as a Clone-Specific Molecular Marker for Cutaneous Lymphoma.. Journal of Investigative Dermatology 101:4, 514-516
CrossRef69
Gary S. Wood, David W. Bahler, Richard T. Hoppe, Roger A. Warnke, Jeffrey L. Sklar, Ronald Levy. (1993) Transformation of Mycosis Fungoides: T-Cell Receptor beta Gene Analysis Demonstrates a Common Clonal Origin for Plaque-Type Mycosis Fungoides and CD30+ Large-Cell Lymphoma.. Journal of Investigative Dermatology 101:3, 296-300
CrossRef70
Yanming Zhang, Brigitte Schlegelberger, Hansjörg Plendl, Ruth Sonnen, Rolf Kuse, Alfred C. Feller, Werner Grote. (1993) Clonal t(8;14)(p11;q31) in a case of reactive lymphoproliferation. Genes, Chromosomes and Cancer 7:3, 165-168
CrossRef71
Iwona Wlodarska, Jan Delabie, Chris De Wolf-peeters, Cristina Mecucci, Michel Stul, Gregor Verhoef, Jean-Jacques Cassiman, Herman Van Den Berghe. (1993) T-cell lymphoma developing in Hodgkin's disease: Evidence for two clones. The Journal of Pathology 170:3, 239-248
CrossRef72
Angel Pizarro, Javier Pinilla. (1993) THE RHYTHMIC PARADOXICAL ERUPTION SPECTRUM IN THE AIDS ERA. British Journal of Haematology 84:3, 558-558
CrossRef73
Marshall E. Kadin, Eric C. Vonderheid, Lawrence M. Weiss. (1993) Absence of Epstein—Barr viral RNA in lymphomatoid papulosis. The Journal of Pathology 170:2, 145-148
CrossRef74
Stuart R. Lessin, Alain H. Rook. (1993) T-cell receptor gene rearrangement studies as a diagnostic tool in lymphoproliferative skin diseases. Experimental Dermatology 2:2, 53-62
CrossRef75
Cabot, Richard C.Scully, Robert E., Mark, Eugene J., McNeely, William F., McNeely, Betty U., Jacobson, J.O.Harris, N.L.. (1992) Case 50-1992. New England Journal of Medicine 327:25, 1801-1809
Full Text76
Helen H. Wang, Lori Lach, Marshall E. Kadin. (1992) Epidemiology of lymphomatoid papulosis. Cancer 70:12, 2951-2957
CrossRef77
D.N. SLATER. (1992) Diagnostic difficulties in 'non-mycotic' cutaneous lymphoproliferative diseases. Histopathology 21:3, 203-213
CrossRef
