Original Article
DNA Sequences Similar to Those of Simian Virus 40 in Ependymomas and Choroid Plexus Tumors of Childhood
N Engl J Med 1992; 326:988-993April 9, 1992
- Abstract
- Abstract
Background.
Ependymomas and papillomas of the choroid plexus occur in early childhood. The ubiquitous human polyomaviruses, BK virus and JC virus, have been associated with the induction of these neoplasms in animal models. A related monkey polyomavirus, simian virus 40 (SV40), is highly tumorigenic in rodents and also induces choroid plexus papillomas.
Methods.
We tested the possibility that polyomaviruses were associated with these tumors in humans. Tumors from 31 children — 20 with choroid plexus neoplasms and 11 with ependymomas — were evaluated for the presence of polyomavirus T-antigen gene sequences by means of amplification with the polymerase chain reaction.
Results.
Ten of the 20 choroid plexus tumors and 10 of the 11 ependymomas contained amplification products that preferentially hybridized to probes specific for SV40 viral DNA rather than BK or JC viral DNA. In two specimens, DNA sequencing demonstrated that the amplified sequence was identical to the sequence of that region of the SV40 gene. In three other specimens, amplification with SV40-specific primers revealed a 574-bp segment of the SV40 viral gene. In 7 of 11 tumors examined by immunohistochemical staining, viral T antigen was expressed in the nuclei of the neoplastic cells.
Conclusions.
Half of the choroid plexus tumors and most of the ependymomas that we studied contained and expressed a segment of T-antigen gene related to SV40. These results suggest that SV40 or a closely related virus may have an etiologic role in the development of these neoplasms during childhood, as in animal models. (N Engl J Med 1992;326:988–93.)
Media in This Article
Figure 1
Schematic Diagram of the Oligonucleotide Primers Used for PCR Amplification.Figure 2
DNA Sequence of the PCR Product from a Choroid Plexus Tumor.Article Activity
- Article
EPIDEMIOLOGIC studies have shown that 70 to 80 percent of adults are seropositive for the human polyomaviruses BK and JC. 1 , 2 BK virus, originally discovered in the urine of a renal-transplant recipient,3 is thought to be a cause of hemorrhagic cystitis and nephritis in immunosuppressed patients. JC virus, which infects oligodendrocytes, has been linked with progressive multifocal leukoencephalopathy.4 Both viruses are presumably acquired as primary infections in childhood, and they persist benignly in the immunocompetent host. The monkey polyomavirus simian virus 40 (SV40), a potent virus that induces tumors in laboratory animals, was found to be a contaminant of polio vaccines administered to adults and children from 1955 to 1963, but it has not been associated with human disease.5 , 6
Both BK virus and JC virus alter the control of normal growth of hamster cells in tissue culture and cause tumors when inoculated into newborn hamsters.7 8 9 Intracerebral injection of BK virus in hamsters results predominantly in ependymomas and choroid plexus papillomas, whereas JC virus induces medulloblastomas, meningiomas, and ependymomas. As with the animal polyomaviruses, the ability of BK and JC viruses to induce tumors appears to be related to the age of the animal at the time of infection and its immune status. Polyomaviruses encode viral T (tumor)-antigen proteins, which are synthesized immediately after infection. These proteins are responsible for the loss of control of cell growth that is induced by the virus both in vitro and in vivo.10 When the T antigens of these viruses are expressed through their natural viral transcriptional signals in transgenic mice, characteristic tumors develop: JC virus induces neuroblastomas,11 BK virus induces renal and hepatic tumors,11 SV40 induces choroid plexus papillomas,12 and the lymphotropic simian polyomavirus, another primate polyomavirus, induces choroid plexus papillomas and lymphoproliferative disorders.13 Although polyomaviruses can cause tumors in animals, studies of their possible role in initiating human tumors have been inconclusive.14 15 16 17 18 19 20 21 22
Ependymomas account for 5 to 10 percent of brain tumors in children, and choroid plexus neoplasms for 3 percent.23 Both types of tumors tend to occur early in life: the median age at which patients present with choroid plexus tumors is 10 months, and the peak incidence of ependymomas is between 1 and 2 years of age. In view of the propensity of polyomaviruses to induce these tumors in animals, we sought to detect viral gene sequences in choroid plexus tumors and ependymomas of childhood.
Methods
Preparation of Tumor Samples
Fresh-frozen tumor tissue (stored at — 70°C) was obtained from the Children's Hospital, Boston, and St. Jude's Children's Research Hospital, Memphis (provided by P. Douglas). Formalin-fixed, paraffin-embedded tissue was obtained from Children's Hospital, Boston, and from Texas Children's Hospital, Houston. Whole blood was obtained from healthy blood donors at Children's Hospital, Boston. DNA from neuroblastomas was provided by Bruce Korf, Children's Hospital, Boston. DNA was isolated from frozen tissue,24 paraffin-embedded tissue,25 and blood26 as previously described.
Preparation of Oligonucleotide Probes and DNA Amplification
The following sequences of oligonucleotides (5' to 3') were used as primers: for the primer PYV.for, TAGGTGCCAACCTATGGAACAGA; for PYV.rev, GGAAAGTCTTTAGGGTCTTCTACC; for BK.probe, GAGAATCTGCTGTTGCTTCTT; for JC.probe, GTTGGGATCCTGTGTTTTCAT; for SV.for2, CTTTGGAGGCTTCTGGGATGCAACT; for SV.for3, TGAGGCTACTGCTGACTCTCAACA; for SV.probe, ATGTTGAGAGTCAGCAGTAGCC; for SV.rev, GCATGACTCAAAAAACTTAGCAATTCTG; for AG1, ACACTCGCTTCTGGAACGTCTGAG; for AG2, AAACGGCTGACAAAAGAAGTCCT; and for AG3, AAACTAGCTAAAGGGAAG.
DNA was amplified by the polymerase chain reaction (PCR) with either Thermus aquaticus (Amplitaq, Perkin-Elmer Cetus) or T. flavus (Replinase, Dupont) polymerase, according to the vendor's suggestions regarding the buffer, with 1.5 mM magnesium chloride and 0.33 to 1.0 μM primer oligonucleotides. Control samples of DNA were derived from pBKpML (provided by M.M. Pater, Memorial University, St. John's, Newfoundland), a single section of brain tissue from a patient with progressive multifocal leukoencephalopathy (provided byJ. Morris, Brigham and Women's Hospital, Boston), and a plasmid containing the SV40 large T-antigen complementary DNA (provided by M. Bradley, Albert Einstein College of Medicine, New York). Thermocycling was performed by denaturation at 94°C for three minutes, followed by cycling 45 to 60 times at 94°C for one minute, at 52°C for one minute, and at 72°C for one minute (except for amplification with the pair of primers SV.for2 and SV.rev, for which cycling was performed at 94°C for one minute, at 57°C for one minute, and at 72°C for one minute).
Southern Blot Analysis and Detection with Oligonucleotide Probes
The PCR products were separated by electrophoresis in a 3 percent NuSieve—1 percent SeaKem agarose gel.27 Gels were transferred to a nylon membrane (Duralon UV, Stratagene) and exposed to 1200 μJ of ultraviolet radiation per square centimeter. The filters were hybridized in 2x SSC (0.3 M sodium chloride and 30 mM sodium citrate, pH 7.0), 1 percent sodium dodecyl sulfate, 20 mM sodium biphosphate, and 500 mg of salmon-sperm DNA per milliliter at 42°C. Probes were prepared by end-labeling the specific oligonucleotide.27
Restriction-Enzyme Digestion and Sequencing of PCR Products
The first PCR product was used in a second reaction with the same oligonucleotide primers for 30 cycles before it was digested with the restriction endonucleases BstXI and FokI (HinGUII). Before dideoxynucleotide sequencing (Sequenase, United States Biochemicals), the PCR product was purified on a Centricon 100 Microconcentrator (Amicon). A single-stranded product was then generated by performing 30 cycles of PCR under standard conditions after reducing the concentration of one primer to 0.01 μM.28
Immunohistochemical Staining
Formalin-fixed, paraffin-embedded samples of tumors obtained at surgery or biopsy were examined according to methods previously described.29 In brief, deparaffinized sections were digested with pepsin. A polyclonal rabbit antibody (prepared as previously described30) to SV40 T antigen purified from infected monkey cells by gel electrophoresis was treated with octanoic (caprylic) acid to obtain the IgG fraction. Biotinylated goat antirabbit IgG was used to localize the primary antibody. The avidin–biotin–peroxidase reaction product was enhanced with nickel chloride.31
Results
DNA was first assessed for PCR analysis by a control reaction designed to amplify γ-globin—gene sequences (the primers AG1 and AG2 and the probe AG3). Only samples in which this segment could be amplified were examined for the presence of polyomavirus sequences. DNA in which γ-globin—gene sequences could be amplified was extracted from paraffin-embedded sections of 17 choroid plexus tumors and 8 ependymomas and from 7 specimens of brain tissue obtained at autopsy of children without neoplasms as controls. In addition, DNA was extracted from six fresh-frozen choroid plexus tumors and four fresh-frozen ependymomas. (Of these 10, 3 choroid plexus tumors and 1 ependymoma were primary tumors from which DNA from paraffin sections was also obtained.) Specimens were analyzed in a blinded fashion with water controls. Repeat biopsy specimens were obtained from three tumors.
All specimens from which adequate DNA was extracted were initially examined for viral sequences by PCR amplification with the primers PYV.for and PYV.rev (Fig. 1Figure 1
Schematic Diagram of the Oligonucleotide Primers Used for PCR Amplification.). These primers amplify a conserved region of the large T-antigen gene of both the BK and JC viruses. Probes specific for each virus (BK.probe and JC.probe, labeled "probe" in Fig. 1) were used to detect amplified viral sequences. In initial experiments, the viral PCR products were hybridized under low stringency (at 42°C in 2x SSC — i.e., under conditions that may allow some base-pair mismatches) with the BK and JC probes. PCR products of the approximate size expected for the BK virus or JC virus were detected (data not shown). Under these conditions, several samples in addition to the products of control reactions for BK and JC viruses cross-reacted with both probes.To resolve ambiguities regarding the cross-reactivity of specimens with the BK and JC probes, the products of two samples were analyzed by DNA sequencing. The sequence obtained (identical for both samples), shown in Figure 2Figure 2
DNA Sequence of the PCR Product from a Choroid Plexus Tumor., did not correspond to that of BK or JC virus but was identical to the sequence of the corresponding region of SV40. A review of the primers used in the original PCR reaction revealed that PYV.for and PYV.rev were also capable of amplifying the homologous segment of SV40. Selected specimens were subjected to repeat amplification with PYV.for and PYV.rev, but with an SV40-specific probe (SV.probe) to detect the PCR products under higher stringency (at 52°C in 2× SSC). A majority of these specimens were shown to have amplifiable sequences that reacted with the SV40 probe (Fig. 3Figure 3
Hybridization of PCR-Amplified DNA from Choroid Plexus Tumors to a Probe Specific for SV40 T-Antigen Sequences.). Several specimens continued to cross-react with the BK and JC probes under the more stringent conditions. The sequences of two of these specimens (Fig. 3, lanes 10 and 12) subsequently did not amplify with a different pair of oligonucleotide primers (see below) and were not further characterized. The specimens in lanes 3, 4, and 15 were obtained from the same patient on different occasions, and the cross-reactivity in lanes 4 and 15 was attributed to an excess of amplified product. The intensity of hybridization varied among specimens, and only after repeated amplifications with different primers and DNA extractions were specimens defined as positive or negative for viral sequences (e.g., the specimens in lanes 7, 11, and 13 were eventually designated as negative, and those in lanes 5 and 6 as positive). Nonetheless, it was apparent that the majority of the original samples that appeared to be positive for BK and JC sequences instead contained SV40 DNA sequences that were being amplified by the original pair of primers and that were detected by the BK and JC probes at a low stringency of hybridization.To confirm whether SV40-like sequences were present in the tumor specimens and to decrease the likelihood that carryover of PCR products may have confounded the initial amplification reactions, two new primer pairs specific for SV40 were synthesized. First, the primers SV.for2 and SV.rev were used to amplify a 574-bp region of the SV40 large T-antigen gene that includes the single intron (Fig. 1). One fresh-frozen specimen of choroid plexus tumor and two fresh-frozen ependymoma specimens were evaluated by PCR amplification with SV.for2 and SV.rev, yielding products of approximately 574 bp that hybridized to the SV40 probe. The DNA from one specimen was amplified further and subjected to restriction-endonuclease digestion with BstXI or FokI, which confirmed that the digestion pattern was that of SV40. Attempts to amplify the 574-bp segment from paraffin-embedded tissue were unsuccessful.
The primers SV.for3 and SV.rev were used to amplify a 105-bp fragment of SV40 that only partially overlapped the fragment previously amplified with PYV.for and PYV.rev (Fig. 1). The SV.for3—SV.rev pair of primers was used to repeat amplification in all specimens, and the PCR products were detected with the SV40-specific probe under high stringency. The results are summarized in Table 1Table 1
Detection of SV40 by PCR and Immunohistochemical Staining.*. One of seven control specimens (brain tissues) was positive, that from a 28-week-old premature infant. None of 12 neuroblastomas and more than 100 normal blood specimens used as sources of control DNA were positive.Biopsy specimens from 11 patients were evaluated immunohistochemically for the expression of viral sequences, and 5 of these specimens were also analyzed for viral DNA; a polyclonal antiserum against SV40 T antigen was used in these studies. The results are summarized in Table 1, and two examples are shown in Figure 4Figure 4
Histochemical Reactivity of T Antigen in a Choroid Plexus Tumor (Panels A and B) and an Ependymoma (Panels C and D).. Intense deposits were present in a variable fraction (5 to 15 percent) of the nuclei of the tumor cells. The cytoplasm of the tumor cells was negative, as were the nuclei of endothelial and stromal cells and circulating blood cells. Since human polyomavirus T antigens share antigenicity with SV40,32 this assay could not identify the specific virus encoding the detected antigen. The antibody did not stain several human central nervous system tumors (e.g., astrocytomas and primitive neuroectodermal tumors) or normal tissues used as controls. Specimens from two patients were immunoreactive for T antigen, but their viral sequences could not be amplified. The initial tumor specimen from one patient was immunoreactive, whereas a later specimen was not. Variation in T-antigen immunoreactivity with tumor progression has previously been observed in transgenic animals.29 , 33 Discussion
Our initial aim was to use the PCR to detect sequences of BK and JC viral DNA in human choroid plexus tumors and ependymomas, the types of tumors induced in animal models by these polyomaviruses. Oligonucleotide primers were used to amplify a segment of viral DNA, well conserved among polyomaviruses, of the BK and JC viral large T-antigen gene. Two DNA segments initially amplified from tumor specimens were sequenced and found to be identical to segments of the polyomavirus SV40. All specimens were then reevaluated with primers and probes specific for SV40. SV40-like DNA sequences up to 574 bp long were detected in a majority of the specimens of ependymomas and choroid plexus tumors. In addition, expression of T-antigen protein was detected by immunoperoxidase staining in 7 of 11 tumors.
Previous studies have suggested that polyomavirus DNA, determined to be that of BK, JC, or SV40 by either Southern hybridization or restriction-endonuclease digestion, is present in human brain tumors.5 , 14 15 16 17 18 T-antigen protein has also been detected by immunofluorescent staining in ependymomas, choroid plexus tumors, and meningiomas.34 35 36 37 38 However, a number of other studies have failed to detect either viral DNA sequences or expression of T-antigen protein in many types of tumors.19 20 21 22 In contrast to previous studies, ours was limited to specific types of tumors of children. In addition, our PCR technique was likely to detect any member of a family of polyomaviruses, since the amplified DNA segment was highly conserved among the known viruses. Our data therefore support previous observations that SV40-like DNA sequences are present and expressed in ependymomas and choroid plexus tumors.
Several questions remain about the amplified viral DNA products. First, we have not ascertained whether the viral DNA is present as free DNA or is integrated into cellular DNA, and how much of the viral genome is present. Second, although detection was most specific when a probe for SV40 was used, and the results of sequencing or restriction-endonuclease digestion of DNA from five specimens were consistent with the presence of SV40-like sequences, the other specimens may have contained the sequences of BK or JC virus rather than that of SV40. Third, outside the specific amplified segment, other regions of the viral genome may differ from those of SV40. Such differences could result from genetic recombination between different types of polyomaviruses, producing variant viruses.39 40 41 42 43 44 Because of these uncertainties, it is difficult to establish where these SV40-like DNA sequences may have originated and, specifically, whether they may have been introduced into the population during the period when poliomyelitis vaccines were contaminated with SV40 (1955 through 1963).5 , 6 None of the patients or controls whom we studied were old enough to have been immunized with the contaminated vaccine.
The presence of polyomavirus sequences in choroid plexus tumors and ependymomas does not by itself establish a cause- and-effect relation to the development of the tumor. For instance, up to 80 percent of the population has serologic evidence of infection with either BK or JC virus by 20 years of age,2 and viral DNA sequences could simply be an incidental finding in the brains of persons who were previously infected. However, at least three lines of evidence support a causal relation between the presence of these viral sequences and tumor formation. First, choroid plexus tumors develop in transgenic mice that harbor the SV40 large T-antigen gene.12 Second, ependymomas and choroid plexus tumors can be induced in rodents by inoculating them intracerebrally or intravenously with the BK,9 JC,45 or SV4046 47 48 virus. Third, these tumors are often found in very young infants and are occasionally present at birth.23 The young age of such infants corresponds to that required for tumors to be induced in laboratory animals inoculated with these viruses,49 and it suggests that the infection may occur transplacentally or perinatally.
The probability of acquiring viral sequences through a maternal or perinatal infection is almost certainly extremely low. On the basis of the mouse models, not only must the mother have been previously uninfected, since previous maternal exposure confers immunity on the fetus, but the primary maternal infection must occur during either gestation or the perinatal period.50 In mice, increased fetal wastage is a consequence of maternal infection, an observation that may explain our finding of viral sequences in a 28-week-old premature infant. Infecting newborn mice with polyomavirus by either the intranasal or the intraperitoneal route apparently does not lead to infection of the central nervous system,51 , 52 suggesting that the infection must occur before the development of the blood–brain barrier in utero. Thus, the low probability that a previously seronegative mother will become infected at a specific point in gestation may contribute to the rarity of these tumors.
An alternative to the acquisition of the viral sequences by infection is their presence in the germline DNA. This alternative, also likely to be extremely rare, was possible in two of our patients. One patient was a member of a kindred with the Li—Fraumeni syndrome,53 , 54 and the other had Aicardi's syndrome.55 Recently, members of two kindreds with the Li—Fraumeni syndrome were found to have choroid plexus tumors as a manifestation of the breast cancer—sarcoma phenotype associated with other members.56 Aicardi's syndrome is a rare congenital malformation syndrome of females, consisting of agenesis of the corpus callosum, ocular anomalies, and infantile spasms. Five other children with Aicardi's syndrome have had choroid plexus tumors.57
Ependymomas and choroid plexus tumors may begin as benign hyperplasias — i.e., "papillomas" — of the respective cell types.23 Although these papillomas may not enter an intermediate state of "dysplasia," they may become neoplastic. This sequence of events from hyperplasia to malignant transformation has been reproduced in specific tissues of transgenic animals expressing the SV40 large T antigen under the control of tissue-specific transcriptional promoters.29 , 58 Thus, infection with polyomavirus may induce choroid plexus tumors and ependymomas by initiating hyperplasia that progresses to a more malignant phenotype. This hypothesis is consistent with the current view of how human papillomaviruses contribute to the development of cervical cancer59 and suggests that polyomaviruses, including variants of known viruses, should be evaluated further in humans for a similar role in the initiation of other tumors.
Supported in part by a grant (CA-22555 [to Dr. Butel]) from the National Cancer Institute, by a fellowship (to Dr. Bergsagel) from the Medical Research Council of Canada, and in part by grants from the Anne and Jason Farber Foundation, the Seth H. Feldman Brain Tumor Fund, and Nancy and Richard Simches.
Presented in abstract form (Clin Res 1990;38:466A; and Lab Invest 1991; 64:107A).
Source Information
From the Division of Pediatric Oncology (D.J.B., R.L.G.) and the Department of Pathology (W.J.K.), Dana–Farber Cancer Institute, Children's Hospital, and the Department of Pediatrics, Harvard Medical School, Boston; and the Department of Pathology (M.J.F.) and the Division of Molecular Virology (J.S.B.), Baylor College of Medicine, Houston. Address reprint requests to Dr. Garcea at the Dana–Farber Cancer Institute, D1620, 44 Binney St., Boston, MA 02115.
- References
References
1
Padgett
CrossRef | Web of Science | Medline2
Padgett
Medline3
Gardner
CrossRef | Web of Science | Medline4
Padgett
CrossRef | Web of Science | Medline5
Geissler
Medline6
Shah
Web of Science | Medline7
Walker
CrossRef | Web of Science | Medline8
Uchida
Web of Science | Medline9
Corallini
Web of Science | Medline10
Tooze J, ed. DNA tumor viruses. 2nd ed. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory, 1980.
11
Small
CrossRef | Web of Science | Medline12
Brinster
CrossRef | Web of Science | Medline13
Chen
Web of Science | Medline14
Dorries
CrossRef | Web of Science | Medline15
Krieg
CrossRef | Web of Science | Medline16
Pater MM, Pater A, Flori M, Slota J, di Mayorca G. BK virus DNA sequences in human tumors and normal tissues and cell lines. In: Essex M, Todaro G, zur Hausen H, eds. Viruses in naturally occurring cancers. Vol. 7 of Cold Spring Harbor conferences on cell proliferation. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory, 1980:329–41.
17
Corallini
CrossRef | Web of Science | Medline18
Meinke
Web of Science | Medline19
Wold
CrossRef | Web of Science | Medline20
Greenlee
CrossRef | Web of Science21
Kosaka
CrossRef | Web of Science | Medline22
Israel
CrossRef | Web of Science | Medline23
Heideman RL, Packer RJ, Albright LA, Freeman CR, Rorke LB. Tumors of the central nervous system. In: Pizzo PA, Poplack DG, eds. Principles and practice of pediatric oncology. Philadelphia: J.B. Lippincott, 1989:505–53.
24
Kawasaki ES. Sample preparation from blood, cells, and other fluids. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR protocols: a guide to methods and applications. San Diego, Calif.: Academic Press, 1990:153–8.
25
Impraim
CrossRef | Web of Science | Medline26
Higuchi 27
Maniatis T, Fritsch EF, Sambrook J. Molecular cloning: a laboratory manual. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory, 1982.
28
Gyllensten
CrossRef | Web of Science | Medline29
Sepulveda
Web of Science | Medline30
Lanford
CrossRef | Web of Science | Medline31
Hsu
CrossRef | Web of Science | Medline32
Dougherty 33
Van Dyke 34
Tabuchi
CrossRef | Web of Science | Medline35
Scherneck
Medline36
Weiss
CrossRef | Web of Science | Medline37
Zang
CrossRef | Web of Science | Medline38
Zimmermann
Web of Science | Medline39
Tavis
Web of Science | Medline40
Yogo
Web of Science | Medline41
Kanda
Web of Science | Medline42
Loeber
Web of Science | Medline43
Brade
CrossRef | Web of Science44
Gibson PE, Gardner SD. Strain differences and some serological observations on several isolates of human polyomaviruses. In: Sever JL, Madden D, eds. Polyomaviruses and human neurological disease. Vol. 105 of Progress in clinical and biological research. New York: Alan R. Liss, 1983:119–32.
45
London
CrossRef | Web of Science | Medline46
Kirschstein
CrossRef | Web of Science | Medline47
Eddy
Web of Science | Medline48
Rabson
Web of Science | Medline49
Eddy 50
McCance
Web of Science | Medline51
Dubensky
Web of Science | Medline52
Dubensky
Web of Science | Medline53
Li
Web of Science | Medline54
Li
Web of Science | Medline55
Aicardi
Medline56
Garber
CrossRef | Web of Science | Medline57
Robinow
CrossRef | Web of Science | Medline58
Teitelman
CrossRef | Web of Science | Medline59
zur Hausen
CrossRef | Web of Science | Medline
- Citing Articles (120)
Citing Articles
1
S. Ziadi, H. Boughamoura, M. Ben Maitig, R. Ben Gacem, S. Mestiri, L. Chaabani, M. Trimeche. (2012) Immunodetection of SV40 T/t-antigens in Human Osteosrcoma in a Series of Tunisian Patients. Pathology & Oncology Research
CrossRef2
Richard G. Ellenbogen, R. Michael Scott. 2012. Choroid plexus tumors. , 450-461.
CrossRef3
Fang Qi, Michele Carbone, Haining Yang, Giovanni Gaudino. (2011) Simian virus 40 transformation, malignant mesothelioma and brain tumors. Expert Review of Respiratory Medicine 5:5, 683-697
CrossRef4
Bahman Abedi Kiasari, Pamela J. Vallely, Caroline E. Corless, Alan Curry, Hilary Cotterill, John Murray, Sheila Ramjug, Paul E. Klapper. (2011) Evidence of simian virus 40 infection in multiple organ transplant recipients with renal dysfunction. Scandinavian Journal of Infectious Diseases1-6
CrossRef5
Robert Saddawi-Konefka, John R. Crawford. (2010) Chronic Viral Infection and Primary Central Nervous System Malignancy. Journal of Neuroimmune Pharmacology 5:3, 387-403
CrossRef6
Jessica Otte, Mahmut Safak, Kamel Khalili. 2010. Polyomaviruses. .
CrossRef7
Hua-chuan Zheng, Takafumi Nakamura, Yang Zheng, Yuko Nakanishi, Yoshiaki Tabuchi, Akio Uchiyama, Hiroyuki Takahashi, Yasuo Takano. (2009) SV40 T antigen disrupted the cell metabolism and the balance between proliferation and apoptosis in lens tumors of transgenic mice. Journal of Cancer Research and Clinical Oncology 135:11, 1521-1532
CrossRef8
Niraj C. Patel, Steven J. Halvorson, Vojtech Sroller, Amy S. Arrington, Connie Wong, E. O'Brian Smith, Regis A. Vilchez, Janet S. Butel. (2009) Viral regulatory region effects on vertical transmission of polyomavirus SV40 in hamsters. Virology 386:1, 94-101
CrossRef9
Roland Houben, David Schrama, Jürgen C. Becker. (2009) Molecular pathogenesis of Merkel cell carcinoma. Experimental Dermatology 18:3, 193-198
CrossRef10
Cecilia Pancaldi, Veronica Balatti, Roberto Guaschino, Francesca Vaniglia, Alfredo Corallini, Fernanda Martini, Luciano Mutti, Mauro Tognon. (2009) Simian virus 40 sequences in blood specimens from healthy individuals of Casale Monferrato, an industrial town with a history of asbestos pollution. Journal of Infection 58:1, 53-60
CrossRef11
Niraj C. Patel, Regis A. Vilchez, Deanna E. Killen, Preeti Zanwar, Vojtech Sroller, Karen W. Eldin, Dolores López-Terrada, Janet S. Butel. (2008) Detection of polyomavirus SV40 in tonsils from immunocompetent children. Journal of Clinical Virology 43:1, 66-72
CrossRef12
Landon W. Westfall, Michael H. Shearer, Cynthia A. Jumper, Gary L. White, James F. Papin, Richard Eberle, Janet S. Butel, Robert K. Bright, Ronald C. Kennedy. (2008) Evidence of simian virus 40 exposure in a colony of captive baboons. Virology 377:1, 54-62
CrossRef13
L Barzon, M Trevisan, G Masi, M Pacenti, A Sinigaglia, V Macchi, A Porzionato, R De Caro, G Favia, M Iacobone, G Palù. (2008) Detection of polyomaviruses and herpesviruses in human adrenal tumors. Oncogene 27:6, 857-864
CrossRef14
Keith Peden, Li Sheng, Romelda Omeir, Maureen Yacobucci, Michael Klutch, Majid Laassri, Konstantin Chumakov, Achintya Pal, Haruhiko Murata, Andrew M. Lewis. (2008) Recovery of strains of the polyomavirus SV40 from rhesus monkey kidney cells dating from the 1950s to the early 1960s. Virology 370:1, 63-76
CrossRef15
Kelly M. Fahrbach, Rebecca B. Katzman, Kathleen Rundell. (2008) Role of SV40 ST antigen in the persistent infection of mesothelial cells. Virology 370:2, 255-263
CrossRef16
Khaled Amara, Mounir Trimeche, Sonia Ziadi, Adnene Laatiri, Mohamed Hachana, Badreddine Sriha, Moncef Mokni, Sadok Korbi. (2007) Presence of simian virus 40 DNA sequences in diffuse large B-cell lymphomas in Tunisia correlates with aberrant promoter hypermethylation of multiple tumor suppressor genes. International Journal of Cancer 121:12, 2693-2702
CrossRef17
Sandra Eliasz, Michele Carbone, Maurizio Bocchetta. (2007) Simian virus 40 and cancer. Oncology Reviews 1:3, 131-140
CrossRef18
Annemarie Ziegler, Christian A. Seemayer, Marc Hinterberger, Peter Vogt, Colette Bigosch, Oliver Gautschi, Luigi Tornillo, Daniel C. Betticher, Holger Moch, Rolf A. Stahel. (2007) Low prevalence of SV40 in Swiss mesothelioma patients after elimination of false-positive PCR results. Lung Cancer 57:3, 282-291
CrossRef19
Michele Reni, Gemma Gatta, Elena Mazza, Charles Vecht. (2007) Ependymoma. Critical Reviews in Oncology/Hematology 63:1, 81-89
CrossRef20
Kristina Kjærheim, Oluf Dimitri Røe, Tim Waterboer, Peter Sehr, Raeda Rizk, Hong Yan Dai, Helmut Sandeck, Erik Larsson, Aage Andersen, Paolo Boffetta, Michael Pawlita. (2007) Absence of SV40 antibodies or DNA fragments in prediagnostic mesothelioma serum samples. International Journal of Cancer 120:11, 2459-2465
CrossRef21
Keerti V. Shah. (2007) SV40 and human cancer: A review of recent data. International Journal of Cancer 120:2, 215-223
CrossRef22
Joanna Trojanek, Thu Ho, Sidney Croul, Jin Ying Wang, Janaki Chintapalli, Mateusz Koptyra, Antonio Giordano, Kamel Khalili, Krzysztof Reiss. (2006) IRS-1–Rad51 nuclear interaction sensitizes JCV T-antigen positive medulloblastoma cells to genotoxic treatment. International Journal of Cancer 119:3, 539-548
CrossRef23
V Paracchini, A Nanni Costa, S Garte, E Taioli. (2006) Role of simian virus 40 in cancer incidence in solid organ transplant patients. British Journal of Cancer 94:10, 1533-1536
CrossRef24
Gunn-Hege Olsen, Per Arne Andresen, Hilde Tveitan Hilmarsen, Ola Bjørang, Helge Scott, Karsten Midtvedt, Christine H. Rinaldo. (2006) Genetic variability in BK Virus regulatory regions in urine and kidney biopsies from renal-transplant patients. Journal of Medical Virology 78:3, 384-393
CrossRef25
Frank Schüler, Sandra C. Dölken, Carsten Hirt, Marc T. Dölken, Renate Mentel, Lutz G. Gürtler, Gottfried Dölken. (2006) No evidence for simian virus 40 DNA sequences in malignant non-Hodgkin lymphomas. International Journal of Cancer 118:2, 498-504
CrossRef26
Ian D. Kamaly-Asl, Navid Shams, Michael D. Taylor. (2006) Genetics of choroid plexus tumors. Neurosurgical FOCUS 20:1, 1-3
CrossRef27
Martyn K. White, Jennifer Gordon, Krzysztof Reiss, Luis Del Valle, Sidney Croul, Antonio Giordano, Armine Darbinyan, Kamel Khalili. (2005) Human polyomaviruses and brain tumors. Brain Research Reviews 50:1, 69-85
CrossRef28
U.M. Costa, D. Reischak, J. da Silva, A.P. Ravazzolo. (2005) Establishment and partial characterization of an ovine synovial membrane cell line obtained by transformation with Simian Virus 40 T antigen. Journal of Virological Methods 128:1-2, 72-78
CrossRef29
Bruce WS Robinson, Arthur W Musk, Richard A Lake. (2005) Malignant mesothelioma. The Lancet 366:9483, 397-408
CrossRef30
Francisco Vega, Chung-Che Chang, Leonard J Medeiros, Mark M Udden, Jeong Hee Cho-Vega, Ching-Ching Lau, Chris J Finch, Regis A Vilchez, David McGregor, Jeffrey L Jorgensen. (2005) Plasmablastic lymphomas and plasmablastic plasma cell myelomas have nearly identical immunophenotypic profiles. Modern Pathology 18:6, 806-815
CrossRef31
M. Wrensch. (2005) History of Chickenpox and Shingles and Prevalence of Antibodies to Varicella-Zoster Virus and Three Other Herpesviruses among Adults with Glioma and Controls. American Journal of Epidemiology 161:10, 929-938
CrossRef32
Eric A Engels. (2005) Cancer risk associated with receipt of vaccines contaminated with simian virus 40: epidemiologic research. Expert Review of Vaccines 4:2, 197-206
CrossRef33
Lee-Fan Sui, Jan Williamson, Ray M. Lowenthal, Andrew J. C. Parker. (2005) Absence of simian virus 40 (SV40) DNA in lymphoma samples from Tasmania, Australia. Pathology 37:2, 157-159
CrossRef34
John A. Vanchiere, Zoe S. White, Janet S. Butel. (2005) Detection of BK virus and simian virus 40 in the urine of healthy children. Journal of Medical Virology 75:3, 447-454
CrossRef35
L Brouchet, S Valmary, M Dahan, A Didier, F Galateau-Salle, P Brousset, B Degano. (2005) Detection of oncogenic virus genomes and gene products in lung carcinoma. British Journal of Cancer 92:4, 743-746
CrossRef36
J Sabatier, E Uro-Coste, I Pommepuy, F Labrousse, S Allart, M Trémoulet, M B Delisle, P Brousset. (2005) Detection of human cytomegalovirus genome and gene products in central nervous system tumours. British Journal of Cancer 92:4, 747-750
CrossRef37
Dana E.M. Rollison, Utaiwan Utaipat, Caroline Ryschkewitsch, Jean Hou, Patricia Goldthwaite, Richard Daniel, Kathy J. Helzlsouer, Peter C. Burger, Keerti V. Shah, Eugene O. Major. (2005) Investigation of human brain tumors for the presence of polyomavirus genome sequences by two independent laboratories. International Journal of Cancer 113:5, 769-774
CrossRef38
Zhannat Z. Nurgalieva, Connie Wong, Abai K. Zhangabylov, Zhazira E. Omarbekova, David Y. Graham, Regis A. Vilchez, Janet S. Butel. (2005) Polyomavirus SV40 infections in Kazakhstan. Journal of Infection 50:2, 142-148
CrossRef39
Norman M. Kaplan, Biff F. Palmer, Randall S. Hughes. (2005) Malignant Pleural Mesothelioma. The American Journal of the Medical Sciences 329:1, 29-44
CrossRef40
Mulan Jin, Hirofumi Sawa, Tadaki Suzuki, Kazuko Shimizu, Yoshinori Makino, Shinya Tanaka, Takayuki Nojima, Yasunori Fujioka, Makoto Asamoto, Noriaki Suko, Miri Fujita, Kazuo Nagashima. (2004) Investigation of simian virus 40 large T antigen in 18 autopsied malignant mesothelioma patients in Japan. Journal of Medical Virology 74:4, 668-676
CrossRef41
Torsten Pietsch, Michael D. Taylor, James T. Rutka. (2004) Molecular pathogenesis of childhood brain tumors. Journal of Neuro-Oncology 70:2, 203-215
CrossRef42
Fernando López-Ríos, Peter B Illei, Valerie Rusch, Marc Ladanyi. (2004) Evidence against a role for SV40 infection in human mesotheliomas and high risk of false-positive PCR results owing to presence of SV40 sequences in common laboratory plasmids. The Lancet 364:9440, 1157-1166
CrossRef43
Abhishek Agarwal, Sandeep Chopra, A. D. Sehgal. (2004) Choroid plexus papilloma associated with developmental delay. The Indian Journal of Pediatrics 71:8, 763-766
CrossRef44
A Ozdarendeli, C Camci, E Aygen, C Kirkil, Z.A Toroman, O Dogru, M.Z Doymaz. (2004) SV40 in human thyroid nodules. Journal of Clinical Virology 30:4, 337-340
CrossRef45
Aaron Milstone, Regis A. Vilchez, Xochi Geiger, Agnes B. Fogo, Janet S. Butel, Stephen Dummer. (2004) POLYOMAVIRUS SIMIAN VIRUS 40 INFECTION ASSOCIATED WITH NEPHROPATHY IN A LUNG-TRANSPLANT RECIPIENT. Transplantation 77:7, 1019-1024
CrossRef46
Janet S Butel, Regis A Vilchez, Jeffrey L Jorgensen, Claudia A Kozinetz. (2003) Association Between SV40 and Non-Hodgkin's Lymphoma. Leukemia & Lymphoma 44:S3, S33-S39
CrossRef47
J. J. Carter. (2003) Lack of Serologic Evidence for Prevalent Simian Virus 40 Infection in Humans. CancerSpectrum Knowledge Environment 95:20, 1522-1530
CrossRef48
Regis A. Vilchez, Janet S. Butel. (2003) Simian virus 40 and its association with human lymphomas. Current Oncology Reports 5:5, 372-379
CrossRef49
N GUPTA. (2003) Choroid plexus tumors in children. Neurosurgery Clinics of North America 14:4, 621-631
CrossRef50
Sidney Croul, Kamel Khalili, Darryl L’Heureux. 2003. Polyomaviruses and Brain Tumors. .
CrossRef51
Eric A. Engels, Leonard H. Rodman, Morten Frisch, James J. Goedert, Robert J. Biggar. (2003) Childhood exposure to simian virus 40-contaminated poliovirus vaccine and risk of AIDS-associated non-Hodgkin's lymphoma. International Journal of Cancer 106:2, 283-287
CrossRef52
Christine Hanssen Rinaldo, Marit Renée Myhre, Hilde Alstad, Øivind Nilssen, Terje Traavik. (2003) Human polyomavirus BK (BKV) transiently transforms and persistently infects cultured osteosarcoma cells. Virus Research 93:2, 181-187
CrossRef53
E. A. Engels, H. A. Katki, N. M. Nielsen, J. F. Winther, H. Hjalgrim, F. Gjerris, P. S. Rosenberg, M. Frisch. (2003) Cancer Incidence in Denmark Following Exposure to Poliovirus Vaccine Contaminated With Simian Virus 40. JNCI Journal of the National Cancer Institute 95:7, 532-539
CrossRef54
Jimmy T. Efird, Elizabeth A. Holly, Susan Preston-Martin, Beth A. Mueller, Flora Lubin, G. Filippini, Rafael Peris-Bonet, Margaret McCredie, Sylvaine Cordier, Annie Arslan, Paige M. Bracci. (2003) Farm-related exposures and childhood brain tumours in seven countries: results from the SEARCH International Brain Tumour Study. Paediatric and Perinatal Epidemiology 17:2, 201-211
CrossRef55
John A Lednicky, Regis A Vilchez, Wendy A Keitel, Fehmida Visnegarwala, Zoe S White, Claudia A Kozinetz, Dorothy E Lewis, Janet S Butel. (2003) Polyomavirus JCV excretion and genotype analysis in HIV-infected patients receiving highly active antiretroviral therapy. AIDS 17:6, 801-807
CrossRef56
Regis A Vilchez, Claudia A Kozinetz, Janet S Butel. (2003) Conventional epidemiology and the link between SV40 and human cancers. The Lancet Oncology 4:3, 188-191
CrossRef57
H. D. Strickler, J. J. Goedert, S. S. Devesa, J. Lahey, J. F. Fraumeni, P. S. Rosenberg. (2003) Trends in U.S. Pleural Mesothelioma Incidence Rates Following Simian Virus 40 Contamination of Early Poliovirus Vaccines. JNCI Journal of the National Cancer Institute 95:1, 38-45
CrossRef58
M. Wong. (2002) New Associations of Human Papillomavirus, Simian Virus 40, and Epstein-Barr Virus with Human Cancer. CancerSpectrum Knowledge Environment 94:24, 1832-1836
CrossRef59
Michele Reni, Alba A Brandes. (2002) Current management and prognostic factors for adult ependymoma. Expert Review of Anticancer Therapy 2:5, 537-545
CrossRef60
Marcella Martinelli, Fernanda Martini, Eliana Rinaldi, Laura Caramanico, Eros Magri, Enrico Grandi, Francesco Carinci, Antonio Pastore, Mauro Tognon. (2002) Simian Virus 40 Sequences and Expression of the Viral Large T Antigen Oncoprotein in Human Pleomorphic Adenomas of Parotid Glands. The American Journal of Pathology 161:4, 1127-1133
CrossRef61
J. Y.H. Kim, I. J. Koralnik, M. LeFave, R. A. Segal, L.-A. Pfister, S. L. Pomeroy. (2002) Medulloblastomas and primitive neuroectodermal tumors rarely containpolyomavirus DNA sequences. Neuro-Oncology 4:3, 165-170
CrossRef62
Annick Bingen, Huguette Nonnenmacher, Michèle Bastien-Valle, Jean-Pierre Martin. (2002) Tissues rich in macrophagic cells are the major sites of feline immunodeficiency virus uptake after intravenous inoculation into cats. Microbes and Infection 4:8, 795-803
CrossRef63
Antony D. Hale, Danguol
Bartkevičiūte, Aušra Dargevičiūt, Li Jin, Wendy Knowles, Juozas Staniulis, David W.G. Brown, Kestutis Sasnauskas. (2002) Expression and antigenic characterization of the major capsid proteins of human polyomaviruses BK and JC in Saccharomyces cerevisiae. Journal of Virological Methods 104:1, 93-98
CrossRef64
Regis A. Vilchez, Claudia A. Kozinetz, Jeffrey L. Jorgensen, Michael H. Kroll, Janet S. Butel. (2002) AIDS-Related Systemic Non-Hodgkin's Lymphoma at a Large Community Program. AIDS Research and Human Retroviruses 18:4, 237-242
CrossRef65
Regis A Vilchez, Charles R Madden, Claudia A Kozinetz, Steven J Halvorson, Zoe S White, Jeffrey L Jorgensen, Chris J Finch, Janet S Butel. (2002) Association between simian virus 40 and non-Hodgkin lymphoma. The Lancet 359:9309, 817-823
CrossRef66
Regis A. Vilchez, John A. Lednicky, Steven J. Halvorson, Zoe S. White, Claudia A. Kozinetz, Janet S. Butel. (2002) Detection of Polyomavirus Simian Virus 40 Tumor Antigen DNA in AIDS-Related Systemic Non-Hodgkin Lymphoma. JAIDS Journal of Acquired Immune Deficiency Syndromes 29:2, 109-116
CrossRef67
John C. Egelhoff. 2002. Pediatric Central Nervous System Tumors. , 719-759.
CrossRef68
F. J. Reuther, J. L
hler, J. Herms, H.-H. Hugo, C. Schindler, F. Leith
CrossRef69
Tomohiko Kouhata, Kouzou Fukuyama, Naoshi Hagihara, Kazuo Tabuchi. (2001) Detection of simian virus 40 DNA sequence in human primary glioblastomas multiforme. Journal of Neurosurgery 95:1, 96-101
CrossRef70
Beverly A. Kidney, Deborah M. Haines, John A. Ellis, Micheline L. Burnham, Marion L. Jackson. (2001) Evaluation of formalin-fixed paraffin-embedded tissues from vaccine site-associated sarcomas of cats for polyomavirus DNA and antigen. American Journal of Veterinary Research 62:6, 828-832
CrossRef71
P.D Minor, G Dunn, P.A Pipkin. (2001) Detection and growth kinetics of SV40 preparations with different enhancer element copy number. Vaccine 19:25-26, 3467-3471
CrossRef72
B. Jasani, A. Cristaudo, S.A. Emri, A.F. Gazdar, A. Gibbs, B. Krynska, C. Miller, L. Mutti, C. Radu, M. Tognon, A. Procopio. (2001) Association of SV40 with human tumours. Seminars in Cancer Biology 11:1, 49-61
CrossRef73
John A. Lednicky, Janet S. Butel. (2001) Simian virus 40 regulatory region structural diversity and the association of viral archetypal regulatory regions with human brain tumors. Seminars in Cancer Biology 11:1, 39-47
CrossRef74
Heldi David, Susana Mendoza, Tamiko Konishi, Carl W Miller. (2001) Simian virus 40 is present in human lymphomas and normal blood. Cancer Letters 162:1, 57-64
CrossRef75
Antonio Procopio, Luigi Strizzi, Giovina Vianale, Piergiacomo Betta, Riccardo Puntoni, Vincenzo Fontana, Gianfranco Tassi, Francesco Gareri, Luciano Mutti. (2000) Simian virus-40 sequences are a negative prognostic cofactor in patients with malignant pleural mesothelioma. Genes, Chromosomes and Cancer 29:2, 173-179
CrossRef76
B. R. Mclaren, T. Haenel, S. Stevenson, S. Mukherjee, B. W. S. Robinson, R. A. Lake. (2000) Simian virus (SV) 40 like sequences in cell lines and tumour biopsies from Australian malignant mesotheliomas. Australian and New Zealand Journal of Medicine 30:4, 450-456
CrossRef77
H. Yeni-Komshian, E.A. Holly. (2000) Childhood brain tumours and exposure to animals and farm life: a review. Paediatric and Perinatal Epidemiology 14:3, 248-256
CrossRef78
Gabriella Gamberi, Maria Serena Benassi, Franca Pompetti, Cristina Ferrari, Paola Ragazzini, Maria Rosa Sollazzo, Lara Molendini, Mara Merli, Giovanna Magagnoli, Fulvio Chiesa, Alessandra Giuliana Gobbi, Amy Powers, Piero Picci. (2000) Presence and expression of the Simian virus-40 genome in human giant cell tumors of bone. Genes, Chromosomes and Cancer 28:1, 23-30
CrossRef79
Narayan Shivapurkar, Thorsten Wiethege, Ignacio I. Wistuba, Eli Salomon, Sara Milchgrub, Klaus-Michael Muller, Andrew Churg, Harvey Pass, Adi F. Gazdar. (2000) Presence of simian virus 40 sequences in malignant mesotheliomas and mesothelial cell proliferations. Journal of Cellular Biochemistry 76:2, 181-188
CrossRef80
Keerti V. Shah. (2000) Does SV40 infection contribute to the development of human cancers?. Reviews in Medical Virology 10:1, 31-43
CrossRef81
Hai-Ning Zhen, Xiang Zhang, Xing-Yao Bu, Zhi-Wen Zhang, Wen-Jin Huang, Ping Zhang, Jing-Wen Liang, Xi-Ling Wang. (1999) Expression of the simian virus 40 large tumor antigen (Tag) and formation of Tag-p53 and Tag-pRb complexes in human brain tumors. Cancer 86:10, 2124-2132
CrossRef82
Malcolm A. Smith, Howard D. Strickler, Monica Granovsky, Gregory Reaman, Martha Linet, Richard Daniel, Keerti V. Shah. (1999) Investigation of leukemia cells from children with common acute lymphoblastic leukemia for genomic sequences of the primate polyomaviruses JC virus, BK virus, and Simian virus 40. Medical and Pediatric Oncology 33:5, 441-443
CrossRef83
C.G Fedele, M Ciardi, S Delia, J.M Echevarria, A Tenorio. (1999) Multiplex polymerase chain reaction for the simultaneous detection and typing of polyomavirus JC, BK and SV40 DNA in clinical samples. Journal of Virological Methods 82:2, 137-144
CrossRef84
Claire M. Mazewski, Roger J. Hudgins, Andrew Reisner, J. Russell Geyer. (1999) Neonatal brain tumors: A review. Seminars in Perinatology 23:4, 286-298
CrossRef85
Michael R. Goldman, Marisa J. Brock. (1999) Contaminated polio vaccines. Journal of Legal Medicine 20:2, 223-249
CrossRef86
J. A. Biegel. (1999) Cytogenetics and molecular genetics of childhood brain tumors. Neuro-Oncology 1:2, 139-151
CrossRef87
Mark A. van Gorder, Patricia Della Pelle, John W. Henson, David H. Sachs, A. Benedict Cosimi, Robert B. Colvin. (1999) Cynomolgus Polyoma Virus Infection. The American Journal of Pathology 154:4, 1273-1284
CrossRef88
Fernanda Martini, Riccardo Dolcetti, Annunziata Gloghini, Laura Iaccheri, Antonino Carbone, Mauro Boiocchi, Mauro Tognon. (1998) Simian-virus-40 footprints in human lymphoproliferative disorders of HIV− and HIV+ patients. International Journal of Cancer 78:6, 669-674
CrossRef89
Todd A. Patrick, David M. Kranz, James F. Zachary, Edward J. Roy. (1998) Intracerebral bispecific ligand-antibody conjugate increases survival of animals bearing endogenously arising brain tumors. International Journal of Cancer 78:4, 470-479
CrossRef90
Edward J. Roy, Bryan K. Cho, Laurie A. Rund, Todd A. Patrick, David M. Kranz. (1998) Targeting T cells against brain tumors with a bispecific ligand-antibody conjugate. International Journal of Cancer 76:5, 761-766
CrossRef91
Sanjeeda Jafar, Maria Rodriguez-Barradas, David Y. Graham, Janet S. Butel. (1998) Serological evidence of SV40 infections in HIV-infected and HIV-negative adults. Journal of Medical Virology 54:4, 276-284
CrossRef92
Atsuo Yoshino, Yoichi Katayama, Takao Watanabe, Jun Kurihara, Shigeyoshi Kimura. (1998) Multiple choroid plexus papillomas of the lateral ventricle distinct from villous hypertrophy. Journal of Neurosurgery 88:3, 581-585
CrossRef93
F. Galateau-Salle, Ph. Bidet, Y. Iwatsubo, E. Gennetay, A. Renier, M. Letourneux, J. C. Pairon, S. Moritz, P. Brochard, M. C. Jaurand, F. Freymuth. (1998) SV40-like DNA sequences in pleural mesothelioma, bronchopulmonary carcinoma, and non-malignant pulmonary diseases. The Journal of Pathology 184:3, 252-257
CrossRef94
Glenn L. Applegate, Maryanne H. Marymont. (1998) Intracranial Ependymomas: A Review. Cancer Investigation 16:8, 588-593
CrossRef95
David W. G. Brown. (1997) Threat to Humans from Virus Infections of Non-human Primates. Reviews in Medical Virology 7:4, 239-246
CrossRef96
Allison M Watts, Michael H Shearer, Harvey I Pass, Ronald C Kennedy. (1997) Development of an experimental murine pulmonary metastasis model incorporating a viral encoded tumor specific antigen. Journal of Virological Methods 69:1-2, 93-102
CrossRef97
Jaclyn A. Biegel. (1997) Genetics of Pediatric Central Nervous System Tumors. Journal of Pediatric Hematology/Oncology 19:6, 492-501
CrossRef98
Barbara Krynska, Jennifer Gordon, Jessica Otte, Roberta Franks, Robert Knobler, Antonio DeLuca, Antonio Giordano, Kamel Khalili. (1997) Role of cell cycle regulators in tumor formation in transgenic mice expressing the human neurotropic virus, JCV, early protein. Journal of Cellular Biochemistry 67:2, 223-230
CrossRef99
John A. Lednicky, A. Renee Stewart, Jesse J. Jenkins, Milton J. Finegold, Janet S. Butel. (1997) SV40 DNA in human osteosarcomas shows sequence variation among T-antigen genes. International Journal of Cancer 72:5, 791-800
CrossRef100
Satoshi O. Suzuki, Masahiro Mizoguchi, Toru Iwaki. (1997) Detection of SV40 T antigen genome in human gliomas. Brain Tumor Pathology 14:2, 125-129
CrossRef101
Antonio De Luca, Alfonso Baldi, Vincenzo Esposito, Candace M. Howard, Luigi Bagella, Paoloa Rizzo, Mario Caputi, Harvey I. Pass, Giovan Giacomo Giordano, Feliciano Baldi, Michele Carbone, Antonio Giordano. (1997) The retinoblastoma gene family pRb/p105, p107, pRb2/p130 and simian virus-40 large T-antigen in human mesotheliomas. Nature Medicine 3:8, 913-916
CrossRef102
Michele Carbone, Paola Rizzo, Philip M. Grimley, Antonio Procopio, Daphne J.Y. Mew, Viji Shridhar, Andrea De Bartolomeis, Vincenzo Esposito, Maria Teresa Giuliano, Seth M. Steinberg, Arthur S. Levine, Antonio Giordano, Harvey I. Pass. (1997) Simian virus-40 large-T antigen binds p53 in human mesotheliomas. Nature Medicine 3:8, 908-912
CrossRef103
Jian J. Li, Yao-Q Huang, Clay J. Cockerell, Wei G. Zhang, Alexander Nicolaides, Alvin E. Friedman-Kien. (1997) Expression and Mutation of the Tumor Suppressor Gene p53 in AIDS-Associated Kaposi's Sarcoma. The American Journal of Dermatopathology 19:4, 373-378
CrossRef104
John P. Hurley, Petr O. Ilyinskii, Christopher J. Horvath, Meredith A. Simon. (1997) A malignant astrocytoma containing simian virus 40 DNA in a macaque infected with simian immunodeficiency virus. Journal of Medical Primatology 26:3, 172-180
CrossRef105
Ronald L. Hamilton, Ian F. Pollack. (1997) The Molecular Biology of Ependymomas. Brain Pathology 7:2, 807-822
CrossRef106
Francisco G. La Rosa, Frank S. Adams, Gregory E. Krause, Arlen D. Meyers, Judith Edwards-Prasad, Rita Kumar, Curt R. Freed, Kedar N. Prasad. (1997) Inhibition of proliferation and expression of T-antigen in SV40 large T-antigen gene-induced immortalized cells following transplantations. Cancer Letters 113:1-2, 55-60
CrossRef107
John A. Lednicky, Janet S. Butel. (1997) A coupled PCR and restriction digest method for the detection and analysis of the SV40 regulatory region in infected-cell lysates and clinical samples. Journal of Virological Methods 64:1, 1-9
CrossRef108
Franca Pompetti, Paola Rizzo, Richard M. Simon, Boris Freidlin, Daphne J. Mew, Harvey I. Pass, Piero Picci, Arthur S. Levine, Michele Carbone. (1996) Oncogene alterations in primary, recurrent, and metastatic human bone tumors. Journal of Cellular Biochemistry 63:1, 37-50
CrossRef109
M. Tognon, R. Casalone, F. Martini, M. De Mattei, P. Granata, E. Minelli, C. Arcuri, P. Collini, V. Bocchini. (1996) Large T antigen coding sequences of two DNA tumor viruses, BK and SV40, and nonrandom chromosome changes in two glioblastoma cell lines. Cancer Genetics and Cytogenetics 90:1, 17-23
CrossRef110
Paolo Monini, Antonella Rotola, Laura de Lellis, Alfredo Corallini, Paola Secchiero, Adriana Albini, Roberto Bennelli, Carlo Parravicini, Giuseppe Barbanti-Brodano, Enzo Cassai. (1996) Latent BK virus infection and Kaposi's sarcoma pathogenesis. International Journal of Cancer 66:6, 717-722
CrossRef111
C.J. Perrons, J.D. Fox, S.B. Lucas, N.S. Brink, R.S. Tedder, R.F. Miller. (1996) Detection of polyomaviral DNA in clinical samples from immunocompromised patients: Correlation with clinical disease. Journal of Infection 32:3, 205-209
CrossRef112
Paul Kleihues, Figen Soylemezoglu, Barbara Schäuble, Bernd W. Scheithauer, Peter C. Burger. (1995) Histopathology, classification, and grading of gliomas. Glia 15:3, 211-221
CrossRef113
Michael Woloschak, Aiqin Yu, Kalmon D. Post. (1995) Detection of polyomaviral DNA sequences in normal and adenomatous human pituitary tissues using the polymerase chain reaction. Cancer 76:3, 490-496
CrossRef114
Monica De Mattei, Fernanda Martini, Alfredo Corallini, Massimo Gerosa, Katia Scotlandi, Paolo Carinci, Giuseppe Barbanti-Brodano, Mauro Tognon. (1995) High incidence of bk virus large-T-antigen-coding sequences in normal human tissues and tumors of different histotypes. International Journal of Cancer 61:6, 756-760
CrossRef115
C. Tornatore, K. Amemiya, W. Atwood, K. Conant, E. O. Major, J. Berger. (1994) JC virus: Current concepts and controversies in the molecular virology and pathogenesis of progressive multifocal leucoencephalopathy. Reviews in Medical Virology 4:3, 197-219
CrossRef116
Hope H. Punnett, Ewa Z. Tomczak, Jean-Pierre De Chadarevian, Paul M. Kanev. (1994) Cytogenetic analysis of a choroid plexus papilloma. Genes, Chromosomes and Cancer 10:4, 282-285
CrossRef117
Maurizio Aricáog, Emanuela Raiteri, Grazia Bossi, Maria Teresa Giordana, Franco Corbella, Davide Locatelli, Stefano Pezzotta. (1994) Choroid plexus carcinoma: Report of one case with favourable response to treatment. Medical and Pediatric Oncology 22:4, 274-278
CrossRef118
Lars Anker, Hiroko Ohgaki, Barbara I. Ludeke, Hans-Dietrich Herrmann, Paul Kleihues, Manfred Westphal. (1993) p53 protein accumulation and gene mutations in human glioma cell lines. International Journal of Cancer 55:6, 982-987
CrossRef119
MAURICE R. HILLEMAN. (1993) The Promise and the Reality of Viral Vaccines against Cancer. Annals of the New York Academy of Sciences 690:1 Specific Immu, 6-18
CrossRef120
Gerald L. Stoner. (1993) Polyomavirus Models of Brain Infection and the Pathogenesis of Multiple Sclerosis. Brain Pathology 3:3, 213-227
CrossRef
