Original Article
Preclinical Diagnosis of Familial Hypertrophic Cardiomyopathy by Genetic Analysis of Blood Lymphocytes
N Engl J Med 1991; 325:1753-1760December 19, 1991
- Abstract
Background.
The clinical diagnosis of familial hypertrophic cardiomyopathy is usually made on the basis of the physical examination, electrocardiogram, and echocardiogram. Making an accurate diagnosis can be particularly difficult in children, who may not have cardiac hypertrophy until adulthood. Recently, we demonstrated that mutations in the cardiac myosin heavy-chain genes cause familial hypertrophic cardiomyopathy In some families. We report a diagnostic test for familial hypertrophic cardiomyopathy that relies on the detection of mutations In the β myosin heavy-chain gene in circulating lymphocytes that we used to evaluate three generations of a family, including the children.
Methods and Results.
Using the polymerase chain reaction, we found that normal and mutant β cardiac myosin heavy-chain genes are transcribed in circulating lymphocytes. This allowed us to examine β cardiac myosin heavy-chain messenger RNA from blood lymphocytes, even though ordinary expression of the gene is virtually restricted to the heart. Base sequences amplified from this messenger RNA were analyzed with a ribonuclease protection assay to identify small deletions, abnormal splicing, or missense mutations. Using this technique we identified a novel missense mutation in a patient with familial hypertrophic cardiomyopathy. We evaluated 15 of the patient's adult relatives and found perfect agreement with the clinical diagnosis (8 affected and 7 not affected). Clinical analysis of 14 of the children (age, 1 to 20 years) of these affected family members revealed 1 child with echocardiographic findings diagnostic of familial hypertrophic cardiomyopathy. However, genetic analyses showed that six other children had also inherited the missense mutation and might later manifest the disease.
Conclusions.
Transcripts of β cardiac myosin heavy-chain gene can be detected in blood lymphocytes and used to screen for mutations that cause familial hypertrophic cardiomyopathy. This approach makes practical the identification of mutations responsible for this disorder and may be applicable to other diseases in which direct analysis is difficult because the mutated gene is expressed only in certain tissues. Preclinical or prenatal screening in an affected family will make it possible to study the disease longitudinally and to develop preventive interventions. (N Engl J Med 1991;325:1753–60.)
Article Activity
- Article
FAMILIAL hypertrophic cardiomyopathy is an autosomal dominant disorder characterized by unexplained myocardial hypertrophy.1 2 3 Diagnosis in childhood is particularly difficult, since the standard clinical and echocardiographic features of the disease may not be present until adulthood.4 Identification of affected young people is important because the first manifestation of the disorder may be sudden death.5 , 6 A genetic approach to the diagnosis would be valuable, particularly if it led to the development of preventive interventions.
Genetic diagnosis in persons with inherited disorders can be indirect and based on linkage analysis or direct and based on the identification of a specific gene mutation.7 Since familial hypertrophic cardio-myopathy is genetically linked to the cardiac myosin heavy-chain genes in many families,8 9 10 11 direct analysis of these genes for mutations is warranted. Several methods have been successfully used to detect disease-causing mutations in genes,7 , 12 and recently two mutations in the myosin heavy-chain genes have been identified that cause familial hypertrophic cardiomyopathy in two unrelated families.13 , 14 Many approaches are based on the analysis of nucleotide sequence variants within exons, which are often disease-causing mutations, unlike those that occur within introns, which are usually without consequence. Because the β cardiac myosin heavy-chain polypeptide is encoded in 40 exons spread over 30 kilobases of DNA,15 , 16 independent analyses of each exon would be laborious. Access to messenger RNA (mRNA) would provide a more efficient method of screening for disease-causing mutations, because intron sequences have been excised from these transcripts. However, although cardiac myosin heavy-chain mRNA is abundant in the heart and slow-twitch skeletal muscle, its expression in other tissues is extremely low.17 18 19 20
Using the polymerase chain reaction (PCR), we demonstrated that normal and mutant β cardiac myosin heavy-chain mRNA was present in blood lymphocytes, a phenomenon called "ectopic transcription."21 22 23 Most familial hypertrophic cardiomyopathy is not due to large deletions or insertions of the cardiac myosin heavy-chain genes (unpublished data), and we have therefore combined PCR amplification with ribonuclease (RNase) protection assays (explained below) to screen for small deletions, insertions, or missense mutations. We demonstrated the clinical usefulness of this technique by our analysis of a large family with familial hypertrophic cardiomyopathy. We were able to make an accurate genetic diagnosis of familial hypertrophic cardiomyopathy by identifying a novel missense mutation.
Methods
Cell Lines and DNA and RNA Extraction
After informed consent was obtained in accordance with the guidelines of the Brigham and Women's Hospital Committee for the Protection of Human Subjects from Research Risks, blood was drawn from family members and normal subjects. The blood samples were used to prepare DNA from red-cell pellets24 and to establish lymphoblastoid cell lines.25 RNA was prepared from fresh peripheral-blood mononuclear cells or Epstein–Barr virus—transformed cell lines by acid guanidinium thiocyanate—phenol—chloroform extraction.26
PCR and Restriction-Enzyme and Sequence Analysis
Nested PCR22 was used to amplify β cardiac myosin heavy-chain mRNA from fresh peripheral-blood mononuclear cells and cell lines transformed by Epstein–Barr virus (Fig. 1AFigure 1
Identification of β Cardiac Myosin Heavy-Chain Transcripts in Mononuclear Cells.). One to 2 μg of total RNA was reverse-transcribed with Moloney murine leukemia virus reverse transcriptase (BRL) with 0.5 μg of the antisense primer from the outer primer pair. The first round of amplification was then performed by the addition of 0.5 μg of the outer sense primer (Fig. 1A, A or C) and 0.2 mmol of each deoxynucleoside triphosphate (Pharmacia), in a volume of 100 μl (final dilution, 1:1000) containing 10 mmol of TRIS–hydrochloric acid (pH 8.3), 50 mmol of potassium chloride, 1.5 mmol of magnesium chloride, and 0.01 percent (wt/vol) gelatin. Forty cycles were carried out in a thermocycler (Perkin-Elmer Cetus) under the following conditions: 0.5 minute of denaturation at 94°C, 1 minute of primer annealing at 55°C, and 2 minutes of primer extension at 72°C. PCR products were then diluted 1:100, and 10 μl was used as the template for the reaction in a volume of 100μl of PCR buffer (final dilution, 1:1000), in which the inner primer pair (Fig. 1A, A' and B' or C and D') was used for an additional 40 cycles. After the second reaction, 10 μl of the PCR product was electrophoresed on a 2 percent agarose gel to confirm successful amplification. To avoid contamination of the PCR products, positive displacement or filtered pipette systems were used and a number of negative controls were run with each amplification. Restriction analysis of these products was performed according to previously described techniques.27 , 28 The PCR products were sequenced by performing an additional round of asymmetric amplification27 followed by direct sequence analysis, as previously described for single-stranded products.29 Genomic DNA was amplified for 35 cycles with primers B9.1F and B9.1R, including denaturation for 0.5 minute at 94°C, primer annealing for 1 minute at 55°C, and primer extension for 1 minute at 72°C. The sequences of the PCR primers were as follows: A, 5'CAAGGATCGCTACGGCTCCTGGAT3'; B, 5'GCGGATCCAGGTAGGCAGACTTGTCAGCCT3'; A', 5'ATGCCAACCCTGCTCTGGAGGCCT3'; B', 5'CTTCATGTTTCCAAAGTGCATGAT3'; C, 5'CTGGGCTTCACTTCAGAGGAGAAAA3'; D, 5'GCGGTACCCCAGCAGCCCGGCCTTGAAGAA3'; C, 5'GGGAATTCGCGGAGCCAGACGGCACTGAAG3'; D', 5'CCCTCCTTCTTGTACTCCTCCTGCTC3'; B9.1F, 5'CAACTCATCACCACTCTCTTCCATC3'; and B9.1R, 5'GCTGAGCCTAGCAGATTCATGGCAC3'.RNase Protection
RNase protection was performed according to a modification of the method described by Myers et al.30 (Fig. 2AFigure 2
Identification of Mutations in the β Cardiac Myosin Heavy-Chain Gene.) with the use of volumes that were scaled down threefold. First, 4 μl of PCR-amplified product (Fig. 1A) was hybridized to a 32P-labeled RNA probe (200,000 counts per minute), and the resulting RNA—DNA hybrid was then digested with RNase A (Sigma) and analyzed by denaturing acrylamide-gel electrophoresis. RNase reactions were stopped by the simultaneous addition of proteinase K and sodium dodecyl sulfate, and 15 μl of the final product was added to 20 μl of loading bufTer for electrophoresis without phenol—chloroform extraction or ethanol precipitation.Clinical Evaluation
Family members were evaluated by physical examination, 12-lead electrocardiography, Doppler ultrasonography, and two-dimensional echocardiography, with left and right ventricular views.31 32 33 Electrocardiograms were interpreted according to standard criteria.34 Echocardiographic measurements of wall thickness and cavity dimensions and the presence or absence of systolic anterior motion of the mitral valve were determined according to established protocols.31 32 33 , 35 The diagnosis of familial hypertrophic cardiomyopathy was based on the demonstration of unexplained ventricular hypertrophy. Clinical diagnoses were made by two experienced clinicians who had no knowledge of the genotypic results. None of the family members evaluated had a history of systemic hypertension or a blood pressure higher than 140/90 mm Hg at rest.
Results
Limited access to cardiac tissue prompted us to determine whether there was ectopic expression of the β cardiac myosin heavy-chain gene in blood mononuclear cells. To detect extremely low levels of β cardiac myosin heavy-chain mRNA, we used a strategy of nested PCR amplification (Fig. 1A). After the first round of amplification with primers C and D (or A and B), no specific product was visible on ethidium bromide staining. A second round of PCR was then performed with internal primers C' and D' (or A' and B') after a 1000-fold dilution of the initial products. Sequential amplification yielded a product of 275 base pairs (bp) (Fig. 1B, lane 1), which is the size predicted from the β cardiac myosin heavy-chain sequence. To demonstrate that the products obtained were derived specifically from the β cardiac myosin heavy-chain gene, partial nucleotide-sequence analysis was performed on several PCR-generated fragments (data not shown). The sequence was identical to that previously published by Jaenicke et al.15
To determine whether mutated as well as normal transcripts of the β cardiac myosin heavy-chain gene could be detected in peripheral-blood mononuclear cells, we analyzed samples obtained from a family with familial hypertrophic cardiomyopathy (Family A). Affected members of this family have previously been shown to have a missense mutation in exon 13 of the β cardiac myosin heavy-chain gene that creates a novel DdeI restriction-enzyme site.13 RNA was prepared from Epstein–Barr virus—transformed cells from both affected and unaffected members of Family A and sequentially amplified with primers C and D followed by C' and D' (Fig. 1A). The amplified product was then digested with the restriction enzyme DdeI and fractionated according to size on an agarose gel. The digested samples from unaffected persons produced two fragments. The larger of these was readily visible on ethidium bromide staining and consisted of approximately 215 bp (Fig. 1B, lanes 2 and 4). The digested samples from affected persons yielded a third visible fragment consisting of approximately 180 bp (Fig. 1B, lanes 3 and 5), in addition to those present in unaffected persons. This is the size predicted by the additional DdeI site conferred by this mutation for familial hypertrophic cardiomyopathy.13 Ectopic transcription of both the normal and the mutant allele was therefore evident in affected persons, as expected in an autosomal dominant disorder. Because it should be possible to amplify mutant and normal sequences with equal efficiency, the intensity of the ethidium bromide staining of the fragments accurately reflects the relative abundance of these two transcripts and demonstrates that the mutant and normal alleles were transcribed equally in cell lines transformed by Epstein–Barr virus.
The detection of transcripts from both normal and mutant β cardiac myosin heavy-chain genes in peripheral-blood cells provides a mechanism for the rapid identification of mutations that cause familial hypertrophic cardiomyopathy. This is particularly important because, unlike disorders such as sickle cell anemia, different β cardiac myosin heavy-chain mutations can cause familial hypertrophic cardiomyopathy in unrelated families13 , 14 (and unpublished data). To identify single base-pair substitutions or small deletions in the β cardiac myosin heavy-chain gene in persons with familial hypertrophic cardiomyopathy, we combined the nested PCR technique with an RNase protection assay. Figure 2A illustrates this technique. Most point mutations can be detected by RNase A protection assays.30 , 36 , 37 Mismatched base pairs detected by RNase are excellent candidates for disease-causing mutations.
To assess the usefulness of this method for detecting new β cardiac myosin heavy-chain mutations, we isolated mRNA from Epstein–Barr virus—transformed cell lines derived from affected persons in different, unrelated families. RNA samples were used as the template in PCRs with nested primers (Fig. 1A, A and B followed by A' and B'), and the amplified test strands of DNA were hybridized to a β cardiac myosin heavy-chain probe (Fig. 1A) for RNase protection assays (Fig. 2B). Although this assay yields a complex pattern of bands, novel fragments are easily identified because of the homogeneity of patterns in unrelated probands (Fig. 2B, lanes 1 through 3). A unique band is present in the sample analyzed in lane 3 of Figure 2B. To exclude the possibility that this band arose because erroneous sequences were introduced during sequential PCRs, a second RNA sample from this person was analyzed. This analysis confirmed the presence of a new band, implying a sequence difference between the affected person's DNA and DNA from an unaffected person. Furthermore, we screened all other peptide-encoding regions of the β cardiac myosin heavy-chain gene and did not detect any other abnormalities in this person (data not shown).
To determine whether this sequence difference is coinherited with disease status, we studied this person's family (Family QQ); part of the pedigree is shown in Figure 3AFigure 3
Clinical and Genetic Diagnosis of Familial Hypertrophic Cardiomyopathy in Family QQ.. Ten affected family members had died of hypertrophic cardiomyopathy before the study. Four of the deaths were sudden. Clinical evaluations of adult family members (generations I and II) identified eight affected persons (age, 28 to 68 years). Four were asymptomatic. All had abnormal electrocardiograms. Seven had typical left ventricular hypertrophy on two-dimensional echocardiography, with a maximal left-ventricular-wall thickness of 1.5 to 2.5 cm (mean, 2.2). Family member II-11 had apical left ventricular hypertrophy on two-dimensional echocardiography, but a maximal left-ventricular-wall thickness of 1.0 cm and mild mitral regurgitation. The left atrial dimension was increased in all eight affected members (4.0 to 5.1 cm; mean, 4.5). None had complete systolic anterior motion of the mitral valve or evidence of a left ventricular gradient on Doppler ultrasonography.If the sequence difference detected by the RNase protection assay in family member I-1 (arrow in Fig. 2B) represents a mutation of the β cardiac myosin heavy-chain gene that causes familial hypertrophic cardiomyopathy, it should also be present in all affected members of Family QQ. Figure 2B (lanes 3 through 14) shows analyses of RNase protection assays for several adults in this family. Samples from all adults who were clinically affected on the basis of two-dimensional echocardiography had a band that was absent from samples derived from unaffected adult family members. There was complete concordance between clinical and molecular genetic diagnoses in all members of generations I and II. The probability of obtaining this result by chance (i.e., if the mutation and disease were not linked) is 1 in 10,000 (lod score, 4.0 at θ = 0).
The difference in the nucleotide base pair that accounts for the novel band in the RNase protection assays was identified by nucleic acid sequence analysis of this region of the β cardiac myosin heavy-chain gene derived from family member I-1 (data not shown). A guanine residue normally present at position 832 (exon 9) was converted to an adenine residue. This missense mutation creates a nonconservative amino acid substitution of glutamine for arginine (position 249), which results in a change in charge from +1 to 0. We have not identified this amino acid substitution among 100 normal chromosomes or 50 chromosomes from unrelated patients with familial hypertrophic cardiomyopathy (data not shown). Furthermore, this arginine residue has been stringently conserved throughout evolution and is invariant in all muscle myosins characterized to date.15 , 16 , 38 39 40 41 42 43 44 45 46 47 48 Collectively, these data suggest that the change in the nucleotide sequence detected by the RNase protection assay is the mutation that causes familial hypertrophic cardiomyopathy in this family.
This missense mutation abolishes an EcoRI restriction-enzyme site normally present in exon 9,15 , 16 which provides an independent method of assessing genetic diagnoses. Exon 9 sequences of the β cardiac myosin heavy-chain gene were amplified with the use of whole-blood DNA. The PCR products were digested with EcoRI and fractionated according to size on agarose gels. The normal sequence produced two fragments that were 79 and 45 bp long. In contrast, the mutated sequence lacked this EcoRI site, and so half of the PCR product derived from affected persons was uncut (Fig. 3B, lane 1, showing results for affected member I-1, as compared with lane 2, showing results for unaffected member I-2). In each sample two small fragments derived from the normal allele are present. An additional larger fragment is visible in the sample from family member I-1, confirming the loss of an EcoRI restriction-enzyme site in the mutant sequence. All adult family members were assessed by this method, and as with RNase protection assays, there was complete agreement between clinical and genetic disease assignment.
Because accurate diagnosis based on genetic techniques should permit the diagnosis of persons at risk for, but without clinical evidence of, familial hypertrophic cardiomyopathy, we evaluated 14 children of affected parents in this family. None of these children, who ranged in age from 1 to 20 years, were previously known to be affected, and none had symptoms suggestive of familial hypertrophic cardiomyopathy. Their two-dimensional echocardiographic and electrocardiographic findings are shown in Table 1Table 1
Results of Clinical and Genetic Analysis of Generation III of Family QQ.. Only one child (III-2) had findings diagnostic of familial hypertrophic cardiomyopathy. Two children (III-1 and III-4) had subtle features of focal hypertrophy noted by one investigator, but a definite clinical diagnosis of familial hypertrophic cardiomyopathy could not be made. Five children had electrocardiographic abnormalities, including left ventricular hypertrophy (III-2 and III-4), abnormal Q waves (III-1), T-wave abnormalities (III-1, III-2, III-4, and III-6), and a QRS complex that was longer than expected for age (III-10).49 A genetic diagnosis, based on a 5-ml blood sample, was made in all 14 children without knowledge of the clinical findings. DNA digestion with the restriction enzyme.EcoRI (Fig. 3B, lanes 3 through 15) and RNase protection assays were performed on PCR products amplified from exon 9. Each analysis identified seven children with a missense mutation of the β cardiac myosin heavy-chain gene at amino acid residue 249, and the results were completely concordant. These seven children included all children with any abnormalities present on two-dimensional echocardiograms or electrocardiograms. A genetic diagnosis of familial hypertrophic cardiomyopathy was also made in two children (III-9 and 111–12; ages, 2 and 4 years) who had completely normal clinical studies.
Discussion
In recent years there has been an explosive growth in our knowledge of the molecular genetics of many medical disorders.7 , 50 Through analysis of restriction-fragmentlength polymorphisms, many diseases have been linked to various positions in the human genome. In a smaller but growing number of disorders, the actual gene responsible for the disorder has been defined. Identification of the disease-causing mutation or mutations in this gene then becomes the focus. In the simplest case, exemplified by sickle cell anemia, a single mutation in one particular gene causes the disorder. Screening for this known mutation in a person at risk for the disease can be accomplished relatively easily through many well-described methods.7 , 12 The process of screening is considerably more complex if multiple genes and multiple mutations within these genes cause a particular disease.
Familial hypertrophic cardiomyopathy falls into the complex category. In approximately 50 percent of families, this disease is due to defects in the β cardiac myosin heavy-chain gene8 9 10 11 , 13 , 14 (and unpublished data). The large size of this gene makes identifying disease-causing mutations laborious. We have devised an approach to this problem that exploits the ectopic expression of this gene in peripheral-blood mononuclear cells. Access to β cardiac myosin heavy-chain transcripts from peripheral blood permits efficient amplification of coding sequences, which can be analyzed for small deletions, alternative splicing, or point mutations with RNase protection assays. Because this technique is based on the analysis of only one affected person, mutations in the β cardiac myosin heavy-chain gene can be rapidly identified even in families that are too small for conventional linkage analyses. Familial hypertrophic cardiomyopathy that results from mutations in genes other than the β cardiac myosin heavy-chain gene will not be detected in this screening assay. Mutations that do not affect the primary sequence of the peptide may also be missed, although those that produce aberrant initiation sites or abnormal splicing of the β cardiac myosin heavy-chain transcripts should be detected.
The evaluation of persons with hypertrophic cardiomyopathy can now include genetic studies. Identification of the precise mutation responsible for familial hypertrophic cardiomyopathy in one proband permits rapid, cost-effective evaluation of all family members by peripheral-blood analyses. Genetic test ing will not only assist diagnosis when the clinical evaluation is complicated by concurrent hypertension, valvular heart disease, or athletic conditioning but also permit accurate preclinical or prenatal diagnosis. Equally important, genetic analyses also allow the diagnosis of familial hypertrophic cardiomyopathy to be unequivocally excluded in unaffected members of families with identified mutations.
The clinical diagnosis of familial hypertrophic cardiomyopathy in children and young adults may be particularly difficult, but is also particularly important. The incidence of sudden death appears to be higher in this group51 and may be the first manifestation of the disease.5 , 6 In many series, hypertrophic cardiomyopathy is one of the most common autopsy findings among young athletes who die suddenly, and in the large majority of these cases, the diagnoses were made post mortem.52 , 53 Echocardiographic features of familial hypertrophic cardiomyopathy may not be fully evident until adulthood and are particularly subtle or absent in prepubescent children.4 Six of the seven affected children in the family that we studied had neither physical findings nor echocardiographic features diagnostic of familial hypertrophic cardiomyopathy, although five of the seven had abnormal electrocardiograms. Although these abnormalities were all nonspecific, the concordance between the genetic diagnosis and electrocardiographic abnormalities suggests that these nonspecific findings should be taken as an early indication of disease. Gregor et al.54 recently reported that electrocardiographic abnormalities preceded the development of echocardiographic features of hypertrophic cardiomyopathy in two young patients. Electrocardiography is therefore an important and relatively inexpensive part of the clinical evaluation of children in this setting. Two youngsters in this family had mutations in their β cardiac myosin heavy-chain genes but had completely normal clinical studies. These children, who were two and four years of age, illustrate the insensitivity of standard clinical tests in the very young and emphasize the need for serial evaluations before a diagnosis of familial hypertrophic cardiomyopathy can be excluded.4 Seven children in this family did not inherit the mutant β cardiac myosin heavy-chain gene and can be assured that neither they nor their progeny will be affected by this condition.
Preclinical diagnosis based on genetic analysis affords us a unique opportunity to assess the factors important for the clinical expression of familial hypertrophic cardiomyopathy. Longitudinal evaluations of children with a genetic predisposition for familial hypertrophic cardiomyopathy may identify stimuli that foster aberrant cardiac growth. Eventually, accurate genetic diagnosis of familial hypertrophic cardiomyopathy will make possible preclinical interventional trials that may decrease the morbidity and mortality of this disease.
Supported by grants from the National Institutes of Health (HL02228, HL46320, HL35877, HL41474, and HL42467), the British Heart Foundation, the Howard Hughes Medical Foundation, the American Heart Association, and Bristol-Myers Squibb Company.
We are indebted to the family members, without whose participation none of these studies would have been possible; and to T. Levi, D. Ladd, S.K. Traill, and M.D. Duke for their invaluable technical assistance.
Source Information
From the Cardiac Unit, Massachusetts General Hospital, Boston (A.R.); the Department of Genetics, Harvard Medical School, Boston (A.R., M.M., J.G.S.); the Cardiology Division, Brigham and Women's Hospital and Harvard Medical School, Boston (H.W., D.-S.H., C.E.S.); the Department of Cardiological Sciences, St. George's Hospital Medical School, London (H.W., W.M.); the Division of Cardiology, Taichung Veterans General Hospital, Taichung, Taiwan (D.-S.H.); the Division of Cardiology, Johns Hopkins Hospital, Baltimore (T.A.T.); and the Howard Hughes Medical Institute, Boston (M.M., J.G.S.). Address reprint requests to Dr. Rosenzweig at Harvard Medical School, Department of Genetics, 25 Shattuck St., Boston, MA 02115.
- References
References
1
Maron
Full Text | Web of Science | Medline2
Maron
Full Text | Web of Science | Medline3
McKenna WJ. Hypertrophic cardiomyopathy. In: Julian DG, Camm AJ, Fox KM, Hall RJC, Poole-Wilson PA, eds. Diseases of the heart. London: Baillière Tindall, 1989:933–50.
4
Maron
Full Text | Web of Science | Medline5
Maron
Web of Science | Medline6
Maron
CrossRef | Web of Science | Medline7
Antonarakis
Full Text | Web of Science | Medline8
Jarcho
Full Text | Web of Science | Medline9
Solomon
CrossRef | Web of Science | Medline10
Solomon
Web of Science | Medline11
Hejtmancik
Web of Science | Medline12
Cotton
Web of Science | Medline13
Geisterfer-Lowrance
CrossRef | Web of Science | Medline14
Tanigawa
CrossRef | Web of Science | Medline15
Jaenicke
CrossRef | Web of Science | Medline16
Liew
CrossRef | Web of Science | Medline17
Mahdavi
CrossRef | Web of Science | Medline18
Lompre
Web of Science | Medline19
Lichter
CrossRef | Medline20
Harbarth
CrossRef | Medline21
Chelly
CrossRef | Web of Science | Medline22
Sarkar
CrossRef | Web of Science | Medline23
Roberts
CrossRef | Web of Science | Medline24
Gross-Bellard
CrossRef | Medline25
Holcombe
CrossRef | Medline26
Chomczynski
CrossRef | Web of Science | Medline27
Ausubel FM, Brent R, Kingston RE, et al., eds. Current protocols in molecular biology. New York: Greene Publishing Associates, 1989.
28
Sambrook J, Fritsch EF, Maniatis T, eds. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory, 1989.
29
Sanger
CrossRef | Web of Science | Medline30
Myers
CrossRef | Web of Science | Medline31
Maron
CrossRef | Web of Science | Medline32
Shapiro
CrossRef | Web of Science | Medline33
McKenna
CrossRef | Web of Science | Medline34
Surawicz
CrossRef | Web of Science | Medline35
Wigle
CrossRef | Web of Science | Medline36
Forrester
CrossRef | Web of Science | Medline37
Kaufman
CrossRef | Web of Science | Medline38
Dibb
CrossRef | Web of Science | Medline39
Jung
CrossRef | Web of Science | Medline40
Kam
CrossRef | Web of Science | Medline41
McNally
CrossRef | Web of Science | Medline42
Molina
Web of Science | Medline43
Rozek
CrossRef | Web of Science | Medline44
Shohet
CrossRef | Web of Science | Medline45
Stedman
Web of Science | Medline46
Strehler
CrossRef | Web of Science | Medline47
Tong
Web of Science | Medline48
Yanagisawa
CrossRef | Web of Science | Medline49
Perry
CrossRef | Web of Science | Medline50
McKusick
Full Text | Web of Science | Medline51
McKenna
CrossRef | Web of Science | Medline52
Maron
Web of Science | Medline53
Maron
CrossRef | Web of Science | Medline54
Gregor
CrossRef | Web of Science | Medline
- Citing Articles (54)
Citing Articles
1
Moira Kessler, Sara Saberi, Sharlene Day, Tamara Gay, Linda Baty, C. Edward Deneke. 2011. Hypertrophic Cardiomopathy. , 106-115.
CrossRef2
Bernard J. Gersh, Barry J. Maron, Robert O. Bonow, Joseph A. Dearani, Michael A. Fifer, Mark S. Link, Srihari S. Naidu, Rick A. Nishimura, Steve R. Ommen, Harry Rakowski, Christine E. Seidman, Jeffrey A. Towbin, James E. Udelson, Clyde W. Yancy, Alice K. Jacobs, Sidney C. Smith, Jeffrey L. Anderson, Nancy M. Albert, Christopher E. Buller, Mark A. Creager, Steven M. Ettinger, Robert A. Guyton, Jonathan L. Halperin, Judith S. Hochman, Harlan M. Krumholz, Frederick G. Kushner, Rick A. Nishimura, E. Magnus Ohman, Richard L. Page, William G. Stevenson, Lynn G. Tarkington, Clyde W. Yancy. (2011) 2011 ACCF/AHA guideline for the diagnosis and treatment of hypertrophic cardiomyopathy: Executive summary. The Journal of Thoracic and Cardiovascular Surgery 142:6, 1303-1338
CrossRef3
Bernard J. Gersh, Barry J. Maron, Robert O. Bonow, Joseph A. Dearani, Michael A. Fifer, Mark S. Link, Srihari S. Naidu, Rick A. Nishimura, Steve R. Ommen, Harry Rakowski, Christine E. Seidman, Jeffrey A. Towbin, James E. Udelson, Clyde W. Yancy, Alice K. Jacobs, Sidney C. Smith, Jeffrey L. Anderson, Nancy M. Albert, Christopher E. Buller, Mark A. Creager, Steven M. Ettinger, Robert A. Guyton, Jonathan L. Halperin, Judith S. Hochman, Harlan M. Krumholz, Frederick G. Kushner, Rick A. Nishimura, E. Magnus Ohman, Richard L. Page, William G. Stevenson, Lynn G. Tarkington, Clyde W. Yancy. (2011) 2011 ACCF/AHA guideline for the diagnosis and treatment of hypertrophic cardiomyopathy. The Journal of Thoracic and Cardiovascular Surgery 142:6, e153-e203
CrossRef4
Bernard J. Gersh, Barry J. Maron, Robert O. Bonow, Joseph A. Dearani, Michael A. Fifer, Mark S. Link, Srihari S. Naidu, Rick A. Nishimura, Steve R. Ommen, Harry Rakowski, Christine E. Seidman, Jeffrey A. Towbin, James E. Udelson, Clyde W. Yancy. (2011) 2011 ACCF/AHA Guideline for the Diagnosis and Treatment of Hypertrophic Cardiomyopathy: Executive Summary. Journal of the American College of Cardiology
CrossRef5
Bernard J. Gersh, Barry J. Maron, Robert O. Bonow, Joseph A. Dearani, Michael A. Fifer, Mark S. Link, Srihari S. Naidu, Rick A. Nishimura, Steve R. Ommen, Harry Rakowski, Christine E. Seidman, Jeffrey A. Towbin, James E. Udelson, Clyde W. Yancy. (2011) 2011 ACCF/AHA Guideline for the Diagnosis and Treatment of Hypertrophic Cardiomyopathy. Journal of the American College of Cardiology
CrossRef6
Jessica E. Rodríguez, Christopher R. McCudden, Monte S. Willis. (2009) Familial hypertrophic cardiomyopathy: Basic concepts and future molecular diagnostics. Clinical Biochemistry 42:9, 755-765
CrossRef7
Mónica García-Castro, Eliecer Coto, Julián R. Reguero, José R. Berrazueta, Victoria Álvarez, Belén Alonso, Rocío Sainz, María Martín, Cesar Morís. (2009) Espectro mutacional de los genes sarcoméricos MYH7, MYBPC3, TNNT2, TNNI3 y TPM1 en pacientes con miocardiopatía hipertrófica. Revista Española de Cardiología 62:1, 48-56
CrossRef8
Rune Frank-Hansen, Stephen P Page, Petros Syrris, William J McKenna, Michael Christiansen, Paal Skytt Andersen. (2008) Micro-exons of the cardiac myosin binding protein C gene: flanking introns contain a disproportionately large number of hypertrophic cardiomyopathy mutations. European Journal of Human Genetics 16:9, 1062-1069
CrossRef9
Todd E. Miller, Lijing You, Robert J. Myerburg, Paul J. Benke, Nanette H. Bishopric. (2007) Whole blood RNA offers a rapid, comprehensive approach to genetic diagnosis of cardiovascular diseases. Genetics in Medicine 9:1, 23-33
CrossRef10
Antonio Pelliccia, Domenico Corrado, Hans Halvor Bj??rnstad, Nicole Panhuyzen-Goedkoop, Axel Urhausen, Francois Carre, Aris Anastasakis, Luc Vanhees, Eloisa Arbustini, Silvia Priori. (2006) Recommendations for participation in competitive sport and leisure-time physical activity in individuals with cardiomyopathies, myocarditis and pericarditis. European Journal of Cardiovascular Prevention & Rehabilitation 13:6, 876-885
CrossRef11
J. Binder, S. R. Ommen, B. J. Gersh, S. L. Van Driest, A. J. Tajik, R. A. Nishimura, M. J. Ackerman. (2006) Echocardiography-Guided Genetic Testing in Hypertrophic Cardiomyopathy: Septal Morphological Features Predict the Presence of Myofilament Mutations. Mayo Clinic Proceedings 81:4, 459-467
CrossRef12
Carolyn Y. Ho, Christine E. Seidman. 2006. Genetics and Heart Failure: Hypertrophic Cardiomyopathy. , 589-606.
CrossRef13
Barry J. Maron, Michael J. Ackerman, Rick A. Nishimura, Reed E. Pyeritz, Jeffrey A. Towbin, James E. Udelson. (2005) Task Force 4: HCM and other cardiomyopathies, mitral valve prolapse, myocarditis, and Marfan syndrome. Journal of the American College of Cardiology 45:8, 1340-1345
CrossRef14
Barry J. Maron, J.G. Seidman, Christine E. Seidman. (2004) Proposal for contemporary screening strategies in families with hypertrophic cardiomyopathy. Journal of the American College of Cardiology 44:11, 2125-2132
CrossRef15
Barry J. Maron, William J. McKenna, Gordon K. Danielson, Lukas J. Kappenberger, Horst J. Kuhn, Christine E. Seidman, Pravin M. Shah, William H. Spencer, Paolo Spirito, Folkert J. Ten Cate, E.Douglas Wigle, Robert A. Vogel, Jonathan Abrams, Eric R. Bates, Bruce R. Brodie, Peter G. Danias, Gabriel Gregoratos, Mark A. Hlatky, Judith S. Hochman, Sanjiv Kaul, Robert C. Lichtenberg, Jonathan R. Lindner, Robert A. O’rourke, Gerald M. Pohost, Richard S. Schofield, Cynthia M. Tracy, William L. Winters, Werner W. Klein, Silvia G. Priori, Angeles Alonso-Garcia, Carina Blomström-Lundqvist, Guy De Backer, Jaap Deckers, Markus Flather, Jaromir Hradec, Ali Oto, Alexander Parkhomenko, Sigmund Silber, Adam Torbicki. (2003) American College of Cardiology/European Society of Cardiology Clinical Expert Consensus Document on Hypertrophic Cardiomyopathy. Journal of the American College of Cardiology 42:9, 1687-1713
CrossRef16
Barry J. Maron. (2001) The Electrocardiogram as a Diagnostic Tool for Hypertrophic Cardiomyopathy: Revisited. Annals of Noninvasive Electrocardiology 6:4, 277-279
CrossRef17
Barry J Maron, Hideshi Niimura, Susan A Casey, Marjorie K Soper, Gregory B Wright, J.G Seidman, Christine E Seidman. (2001) Development of left ventricular hypertrophy in adults with hypertrophic cardiomyopathy caused by cardiac myosin-binding protein C gene mutations. Journal of the American College of Cardiology 38:2, 315-321
CrossRef18
Hugh C. Watkins, Marianna Goldrick. 2001. Detection of Mutations by RNase Cleavage. .
CrossRef19
Antonio Pelliccia. (2000) Athlete's heart and hypertrophic cardiomyopathy. Current Cardiology Reports 2:2, 166-171
CrossRef20
Steven D Nelson, Elizabeth A Sparks, Harry L Graber, Harisios Boudoulas, Ali A Mehdirad, Peter Baker, Charles Wooley. (1998) Clinical characteristics of sudden death victims in heritable (chromosome 1p1-1q1) conduction and myocardial disease. Journal of the American College of Cardiology 32:6, 1717-1723
CrossRef21
Niimura, Hideshi, Bachinski, Linda L., Sangwatanaroj, Somkiat, Watkins, Hugh, Chudley, Albert E., McKenna, William, Kristinsson, Arni, Roberts, Robert, Sole, Michael, Maron, Barry J., Seidman, J.G., Seidman, Christine E., Thierfelder, Ludwig, Jarcho, John A., Anastasakis, Aris, Toutouzas, Pavlos, Elstein, Eleanor, Liew, Choong-Chin, Liew, Jack, Mably, John, Rakowski, Harry, Wigle, E. Douglas, Zhao, Minshun, Salerni, RosemarieBjornsdottir, Halldora, . (1998) Mutations in the Gene for Cardiac Myosin-Binding Protein C and Late-Onset Familial Hypertrophic Cardiomyopathy. New England Journal of Medicine 338:18, 1248-1257
Full Text22
Barry J Maron. (1997) Hypertrophic cardiomyopathy. The Lancet 350:9071, 127-133
CrossRef23
LAMEH FANANAPAZIR, DOROTHEA McAREAVEY. (1997) Hypertrophic Cardiomyopathy: valuation and Treatment of Patients at High Risk for Sudden Death. Pacing and Clinical Electrophysiology 20:2, 478-501
CrossRef24
Robert Roberts, Ali J. Marian, Linda Bachinski. (1996) Molecular genetics of hypertrophic cardiomyopathy. Journal of Cardiac Failure 2, S87-S95
CrossRef25
Y. L. Ko, J. J. Chen, J. J. Cheng, P. Kuan, W. P. Lien, T. K. Tang, S. Y. Lin, Y. C. Liou, C. W. Wu, C. C. Liew. (1996) Malignant familial hypertrophic cardiomyopathy in a family with a 453Arg→Cys mutation in the β-myosin heavy chain gene: Coexistence of sudden death and end-stage heart failure. Human Genetics 97:5, 585-590
CrossRef26
Yu-Lin Ko, Jin-Jer Chen, Tang-K. Tang, Ming-Sheng Teng, Sheng-Yu Lin, Peiliang Kuan, Cheng-Wen Wu, Wen-Pin Lien, Choong-Chin Liew. (1996) Mapping the locus for familial hypertrophic cardiomyopathy to chromosome 11 in a family with a case of apical hypertrophic cardiomyopathy of the Japanese type. Human Genetics 97:4, 457-461
CrossRef27
Karen L Vikstrom, Leslie A Leinwand. (1996) Contractile protein mutations and heart disease. Current Opinion in Cell Biology 8:1, 97-105
CrossRef28
M Ryan. (1995) The standard electrocardiogram as a screening test for hypertrophic cardiomyopathy. The American Journal of Cardiology 76:10, 689-694
CrossRef29
Shoichi Arai, Rumiko Matsuoka, Kenji Hirayama, Hisanao Sakurai, Masaharu Tamura, Tenkou Ozawa, Misa Kimura, Shin-Ichiro Imamura, Yoshiyuki Furutani, Kunitaka Joh-o, Masatoshi Kawana, Atsuyoshi Takao, Saichi Hosoda, Kazuo Momma. (1995) Missense mutation of the β-cardiac myosin heavy-chain gene in hypertrophic cardiomyopathy. American Journal of Medical Genetics 58:3, 267-276
CrossRef30
M.J. DAVIES, W.J. McKENNA. (1995) Hypertrophic cardiomyopathy ? pathology and pathogenesis. Histopathology 26:6, 493-500
CrossRef31
OLIVIER DUBOURG, RICHARD ISNARD, ALBERT HAGÈGE, GUILLAUME JONDEAU, MICHEL DESNOS, ANDRÉ SACREZ, JEAN BRIEUC BOUHOUR, PATRICK MESSNER PELLENC, ALAIN MILLAIRE, LUC FETLER, PASCAL GUICHENEY, KETTY SCHWARTZ, MICHEL KOMAJDA. (1995) Doppler Echocardiography in Familial Hypertrophic Cardiomyopathy.. Echocardiography 12:3, 235-241
CrossRef32
Ali J. Marian. (1995) Sudden cardiac death in patients with hypertrophic cardiomyopathy: From bench to bedside with an emphasis on genetic markers. Clinical Cardiology 18:4, 189-198
CrossRef33
ALDA ALFARANO, LUCIA GASTALDI, GIOVANNA GIGLIO TOS, ANTONELLA ROETTO, CLARA CAMASCHELLA. (1995) ?-Myosin Mutations in Hypertrophic Cardiomyopathies. Annals of the New York Academy of Sciences 752:1 Cardiac Growt, 227-229
CrossRef34
Thomas R. Mcminn, John Ross. (1995) Hereditary dilated cardiomyopathy. Clinical Cardiology 18:1, 7-15
CrossRef35
Mark C. Johnson, R. Mark Payne, James W. Grant, Arnold W. Strauss. (1995) The Genetic Basis of Paediatric Heart Disease. Annals of Medicine 27:3, 289-300
CrossRef36
Lynne M. Mullen, Kent W. Small. (1995) Molecular Genetic Techniques and Applications in Ophthalmology. Seminars in Ophthalmology 10:4, 268-278
CrossRef37
Barry J. Maron, Jeffrey M. Isner, William J. McKenna. (1994) Task force 3: Hypertrophic cardiomyopathy, myocarditis and other myopericardial diseases and mitral valve prolapse. Journal of the American College of Cardiology 24:4, 880-885
CrossRef38
Ilonna J. Rimm, David A. Fruman, Sunil Abhyankar, Hirohiko Sakamoto, Ian M. Orme, David Milstone, J.G. Seidman, James L.M. Ferrara. (1994) T cell receptor (β chain) transgenic mice have selective deficits in γδ T cell subpopulations. Transplant Immunology 2:3, 218-224
CrossRef39
Ludwig Thierfelder, Hugh Watkins, Calum MacRae, Roger Lamas, William McKenna, Hans-Peter Vosberg, J.G. Seldman, Christine E. Seidman. (1994) α-tropomyosin and cardiac troponin T mutations cause familial hypertrophic cardiomyopathy: A disease of the sarcomere. Cell 77:5, 701-712
CrossRef40
David N. Cooper, Lutz-Peter Berg, Vijay V. Kakkar, Jochen Reiss. (1994) Ectopic (Illegitimate) Transcription: New Possibilities for the Analysis and Diagnosis of Human Genetic Disease. Annals of Medicine 26:1, 9-14
CrossRef41
THOMAS N. JAMES. (1993) Congenital Disorders of Cardiac Rhythm and Conduction. Journal of Cardiovascular Electrophysiology 4:6, 702-718
CrossRef42
Martin R. Pollak, Edward M. Brown, Yah-Huei Wu Chou, Steven C. Hebert, Stephen J. Marx, Beat Stelnmann, Tatjana Levi, Christine E. Seidman, J.G. Seidman. (1993) Mutations in the human Ca2+-sensing receptor gene cause familial hypocalciuric hypercalcemia and neonatal severe hyperparathyroidism. Cell 75:7, 1297-1303
CrossRef43
Michael Burch, Michael Sharland, Elliot Shinebourne, Gillian Smith, Michael Patton, William McKenna. (1993) Cardiologic abnormalities in Noonan syndrome: Phenotypic diagnosis and echocardiographic assessment of 118 patients. Journal of the American College of Cardiology 22:4, 1189-1192
CrossRef44
(1993) LETTERS TO THE EDITOR. Journal of Internal Medicine 234:3, 339-343
CrossRef45
Scott D. Solomon, Simonetta Wolff, Hugh Watkins, Paul M. Ridker, Patricia Come, William J. McKenna, Christine E. Seidman, Richard T. Lee. (1993) Left ventricular hypertrophy and morphology in familial hypertrophic cardiomyopathy associated with mutations of the beta-myosin heavy chain gene. Journal of the American College of Cardiology 22:2, 498-505
CrossRef46
Richard L. Popp. (1993) How has echo/Doppler influenced the practice of adult cardiology?. The International Journal of Cardiac Imaging 9:S2, 11-15
CrossRef47
Hugh Watkins, Calum MacRae, Ludwig Thierfelder, Yah-Huei Chou, Michael Frenneaux, William McKenna, J.G. Seidman, Christine E. Seidman. (1993) A disease locus for familial hypertrophic cardiomyopathy maps to chromosome 1q3. Nature Genetics 3:4, 333-337
CrossRef48
Paul McCullagh, Patrick J. Gallagher. (1993) Familial hypertrophic cardiomyopathy. The Journal of Pathology 169:3, 289-290
CrossRef49
(1992) Genetic Testing for Hypertrophic Cardiomyopathy. New England Journal of Medicine 327:16, 1175-1176
Full Text50
Cabot, Richard C.Scully, Robert E., Mark, Eugene J., McNeely, William F., McNeely, Betty U., Freed, M.D.King, M.E.. (1992) Case 41-1992. New England Journal of Medicine 327:16, 1153-1159
Full Text51
Hirofumi Nishi, Akinori Kimura, Haruhito Harada, Hironori Toshima, Takehiko Sasazuki. (1992) Novel missense mutation in cardiac β myosin heavy chain gene found in a japanese patient with hypertrophic cardiomyopathy. Biochemical and Biophysical Research Communications 188:1, 379-387
CrossRef52
Curfman, Gregory D., . (1992) Molecular Insights into Hypertrophic Cardiomyopathy. New England Journal of Medicine 326:17, 1149-1151
Full Text53
Watkins, Hugh, Rosenzweig, Anthony, Hwang, Dar-San, Levi, Tatjana, McKenna, William, Seidman, Christine E., Seidman, J.G., . (1992) Characteristics and Prognostic Implications of Myosin Missense Mutations in Familial Hypertrophic Cardiomyopathy. New England Journal of Medicine 326:17, 1108-1114
Full Text54
Jean-Claude Kaplan, Axel Kahn, Jamel Chelly. (1992) Illegitimate transcription: Its use in the study of inherited disease. Human Mutation 1:5, 357-360
CrossRef
- Letters
