Original Article

Activating Mutations of the Stimulatory G Protein in the McCune–Albright Syndrome

Lee S. Weinstein, M.D., Andrew Shenker, M.D., Ph.D., Pablo V. Gejman, M.D., Maria J. Merino, M.D., Eitan Friedman, M.D., and Allen M. Spiegel, M.D.

N Engl J Med 1991; 325:1688-1695December 12, 1991

Abstract

Abstract

Background.

The McCune-Albright syndrome is a sporadic disease characterized by polyostotic fibrous dysplasia, café au lait spots, sexual precocity, and hyperfunction of multiple endocrine glands. These manifestations may be explained by a somatic mutation in affected tissues that results in activation of the signal-transduction pathway generating cyclic AMP (cAMP). We analyzed DNA from tissues of patients with the McCune-Albright syndrome for the presence of activating mutations of the gene for the a subunit of the G protein (Gsα) that stimulates cAMP formation.

Full Text of Background. ...

Methods.

Genomic DNA fragments encompassing regions (exons 8 and 9) previously found to contain activating missense mutations of the Gsα gene (gsp mutations) in sporadically occurring pituitary tumors were amplified in tissues from four patients with the McCune-Albright syndrome by the polymerase chain reaction. The amplified DNA was analyzed for mutations by denaturing gradient gel electrophoresis and allele-specific oligonucleotide hybridization.

Full Text of Methods. ...

Results.

We detected one of two activating mutations within exon 8 of the Gsα gene in tissues from all four patients, including affected endocrine organs (gonads, adrenal glands, thyroid, and pituitary) and tissues not classically involved in the McCune-Albright syndrome. In two of the patients histidine was substituted for arginine at position 201 of Gsα, and in the other two patients cysteine was substituted for the same arginine residue. In each patient the proportion of cells affected varied from tissue to tissue. In two endocrine organs, the highest proportion of mutant alleles was found in regions of abnormal cell proliferation.

Full Text of Results. ...

Conclusions.

Mutations within exon 8 of the Gsα gene that result in increased activity of the Gs protein and increased cAMP formation are present in various tissues of patients with the McCune-Albright syndrome. Somatic mutation of this gene early in embryogenesis could result in the mosaic population of normal and mutant-bearing tissues that may underlie the clinical manifestations of this disease. (N Engl J Med 1991;325:1688–95.)

Full Text of Conclusions. ...

Read the Full Article...

Article Activity

291 articles have cited this article

Article

THE McCune–Albright syndrome, a disease of unknown cause, is characterized by polyostotic fibrous dysplasia, café au lait pigmentation of the skin, and multiple endocrinopathies, including sexual precocity, hyperthyroidism, pituitary adenomas secreting growth hormone, and autonomous adrenal hyperplasia.1 2 3 4 Because of the sporadic occurrence of the McCune–Albright syndrome and the pattern of the cutaneous hyperpigmentation, it has been postulated that this disorder is due to a dominant somatic mutation occurring early in development. The early mutational event would result in a mosaic population of cells, those with and those without the mutation. The occurrence and severity of bone, skin, and endocrine abnormalities in a specific patient would depend on the number and location of cells bearing the mutation.

The endocrine glands that are hyperactive in the McCune–Albright syndrome have autonomous function.4 5 6 7 8 9 One explanation for the manifestations of the disease is that affected tissues have an overactive cyclic AMP (cAMP) signaling pathway, which is known to stimulate the growth and function of the gonads, thyroid, adrenal cortex, specific pituitary-cell populations, melanocytes, and osteoblasts.4 , 6 , 10 11 12 Possible derangements include abnormalities in components of the signal-transduction pathways that control the production of cAMP (adenylate cyclase, the stimulatory G [guanine nucleotide—binding] protein G_s, and the inhibitory G protein G_i), enzymes that degrade cAMP (phosphodiesterases), or downstream effectors (such as cAMP-dependent protein kinase).

The G proteins involved in signal transduction are heterotrimers consisting of α,β, and γ subunits, each of which is the product of separate genes.13 14 15 Each G protein is defined by its α subunit, which binds guanine nucleotide and interacts with specific receptors and effectors. The activation of G proteins normally requires the interaction of the inactive guanosine diphosphate (GDP)—bound heterotrimer with the ligand-occupied receptor, resulting in the exchange of guanosine triphosphate (GTP) for GDP and dissociation of the α subunit. In the case of G_s, the GTP-bound α subunit interacts with and stimulates adenylate cyclase and specific ion channels.15 The intrinsic GTPase activity of the α subunit inactivates the G protein by hydrolyzing the bound GTP to GDP.14 Modifications that inhibit the GTPase activity of the α subunit of G_s (G_sα) result in increased adenylate cyclase activity in the absence of stimulatory hormone. The addition of an adenosine diphosphate—ribose group to a specific amino acid residue (Arg²⁰¹) of G_sα by the exotoxin of Vibrio cholerae is one such modification.15 Substitution of the amino acid residues Arg²⁰¹ or Gin²²⁷ also results in constitutive activation of G_sα.16 17 18 19

Modifications of G_sα can produce marked effects in vivo. Somatic mutations of Arg²⁰¹ or Gin²²⁷, referred to as gsp mutations, have been identified in human growth hormone—secreting pituitary adenomas and thyroid tumors.16 , 20 21 22 Both human growth hormone—secreting pituitary adenomas and thyroid nodules are associated with the McCune–Albright syndrome.3 , 4 Targeted expression of the catalytic subunit of cholera toxin produces pituitary somatotroph hyperplasia and gigantism in transgenic mice, presumably through the constitutive activation of G_s.²³ In Albright's hereditary osteodystrophy, an inherited deficiency of G_s is associated with multiple phenotypic abnormalities, including generalized hormone resistance.24 , 25

The features of the McCune–Albright syndrome are consistent with an early somatic mutation of the G_sα gene and the expression of an activated G_s protein in multiple tissues. In this study, we amplified genomic DNA fragments encompassing the sites of known activating missense mutations of G_sα (Arg²⁰¹ in exon 8 and Gin²²⁷ in exon 9) from tissues from patients with the McCune–Albright syndrome by the polymerase chain reaction (PCR) and screened for mutations using denaturing gradient gel electrophoresis (DGGE) and allele-specific oligonucleotide hybridization. Using this approach we identified activating somatic mutations of G_sα in tissues from four patients with the McCune–Albright syndrome.

Methods

Patients

The four patients studied had the classic features of the McCune–Albright syndrome, including sexual precocity, café au lait pigmentation, and polyostotic fibrous dysplasia. Multiple tissue samples, obtained surgically or at autopsy, were studied in all four patients.

Patient 1 was a three-year-old girl with mild hyperthyroidism, growth retardation, developmental delay, and chronic unexplained elevation of serum hepatocellular enzyme levels. She was born at 39 weeks of gestation weighing 2.1 kg and measuring 47 cm in length. She had transient direct hyperbilirubinemia that resolved by the third week of life, but elevations of serum hepatocellular enzymes persisted. At the age of one year she had a serum aspartate aminotransferase level of 329 U per liter, an alanine aminotransferase level of 324 U per liter, and a γ-glutamyltransferase level of 1113 U per liter; a liver biopsy showed only mild central lobular congestion. She was subsequently evaluated at the National Institute of Child Health and Human Development, Bethesda, Maryland. Her serum estrogen concentrations were elevated, and serum gonadotropin responses to luteinizing hormone—releasing hormone were abnormally low on two occasions, indicating autonomous ovarian function. Because of persistent heavy vaginal bleeding, progressive advance of bone age, and an unsatisfactory response to testolactone, an inhibitor of estrogen synthesis, the patient underwent bilateral ovariectomy at the age of two years and five months. Pathological examination of the ovaries showed thickening of the capsule, multiple follicles at all stages of development — some cystically dilated — and areas of luteinized stroma. Analysis of a liverbiopsy specimen obtained during surgery revealed mild, nonspecific changes. Frozen and paraffin-embedded specimens from both ovaries, paraffin-embedded tissue from the second liver biopsy, and a blood sample were examined.

Patient 2 was a severely affected boy with hypercortisolism, goiter, pituitary adenoma, and cardiopulmonary disease who died suddenly at the age of 17.26 The clinical history of Patient 3, a severely affected boy with hypercortisolism, hyperthyroidism, and hypersecretion of growth hormone, has been described previously.4 This patient had unexplained cardiac arrest and died at the age of five after orthopedic surgery. The thyroid and pituitary were not available for analysis. The clinical history of and pathological findings in Patient 4, a girl with congenital Cushing's syndrome, have been described elsewhere.5 The adrenal glands were not available for analysis.

DNA Preparation

DNA was isolated from paraffin-embedded specimens,20 blood,27 or frozen tissue.28 Slides stained with hematoxylin and eosin were used to identify regions of interest in thin, paraffin-embedded sections. The regions were then scraped into tubes and processed. DNA isolated from paraffin-embedded normal tissues was used as a negative-control DNA. DNA samples from pituitary tumors with known heterozygous G_sα-activating mutations, kindly provided by J. Lyons, were used as positive-control DNA.

PCR Amplification of Genomic DNA

Either 2 μg of crude DNA prepared from paraffin-embedded tissues or 0.1 to 1 μg of DNA from blood or frozen tissue was amplified in a 100-μl PCR29 mixture containing deoxynucleotide triphosphates (200 μmol per liter each), upstream and downstream oligonucleotide primers (0.5 μmol per liter each), 0.01 percent (wt/vol) gelatin, 50 mmol of potassium chloride per liter, 10 mmol of TRIS–hydrochloric acid per liter (pH 8.3), 1.5 or 2.5 mmol of magnesium chloride per liter, and 2.5 U of Taq polymerase (Perkin—Elmer Cetus). The reactions contained 2.5 mmol of magnesium chloride per liter for exon 9 and 1.5 or 2.5 mmol per liter for exon 8. Strict precautions were taken to keep amplified DNA separate from areas in which patient samples were handled. In all PCR experiments several reactions containing no DNA were included to control for the possibility of contamination. PCR reagents were treated with ultraviolet light (254 nm) before the addition of Taq polymerase, mineral oil, and DNA. Amplification consisted of denaturation at 94°C for 5 minutes, followed by 35 to 45 cycles consisting of annealing at 58°C for 45 seconds, primer extension at 72°C for 1 minute, and denaturation at 94°C for 1 minute, and 1 final cycle with a 3-minute primer extension. The PCR products were analyzed on 5 percent nondenaturing acrylamide gels.

"Melting" maps (plots of the midpoint melting temperature as a function of position along a DNA sequence) were generated for genomic fragments encompassing exon 8 and exon 9 by a computer algorithm30 and were used to determine the site of attachment of a stable, GC-rich fragment (the GC clamp).31 The addition of a GC clamp to one end of a DNA fragment increases the ability of DGGE to detect mismatches in the sequence of interest. For exon 8 the primers were 5'TCGGTTGGCTTTGGTGAATCCA3' (intron 7 sequence) and 5'CGCCCGCCGCGCCCCGCGCCCGTCCCGCCGCCCCCGCCCCAGAAACCATGATCTCTGTTATA3' (the GC clamp was attached to the 5' end of a complementary sequence of intron 8, which is underlined).32 For exon 9 the primers were 5'AACTGCAGCCAGTCCCTCTGGAATAACCAG3' (the sequence of intron 8 is underlined) and 5'CGCCCGCCGCGCCCCGCGCCCGTCCCGCCGCCCCCGCCCCAGCGACCCTGATCCCTAACAAC3' (the GC clamp was attached to the 5' end of a complementary sequence of intron 9, which is underlined).32 Oligonucleotides were synthesized and purified as previously described.24

DGGE

DGGE was performed as previously described.24 , 35 PCR samples (10 to 15 μl) were heated to 95°C for 5 minutes, rapidly cooled, and then subjected to electrophoresis for 15 to 20 hours at 85 V on a 7 percent acrylamide vertical gel with a parallel gradient of linearly increasing denaturing conditions. The denaturing gradients used were 35 to 65 percent for exon 8 and 35 to 90 percent for exon 9 (100 percent denaturing condition is created by 7 mol of urea per liter and 40 percent [vol/vol] formamide). Gels were stained with silver (Bio-Rad kit). Melting maps of the exon 8 and 9 fragments predicted that DGGE would detect mutations anywhere within the coding sequences.

Allele-Specific Oligonucleotide Hybridization

PCR samples (3 to 20 μl) were denatured in 0.2 N sodium hydroxide, 15 mmol of TRIS–hydrochloric acid per liter (pH 7.5), and 3.75 mmol of EDTA per liter for 30 minutes at room temperature and then dot blotted onto nylon filters (Oncor Sure Blot). The filters were incubated for two hours in an 80°C vacuum oven and then hybridized with oligonucleotide probes end-labeled with phosphorus-32 (20 bases in length) that contained the wild-type sequence of arginine at position 201 (R201; codon sequence, CGT), a substitution of cysteine for arginine at position 201 (R201C; codon sequence, TGT), or a substitution of histidine for arginine at position 201 (R201H; codon sequence, CAT). The oligonucleotideprobe sequences as well as hybridization and washing conditions have been described previously.20 Results from representative positive and negative tissues were confirmed by analyzing an independent DNA preparation from the same paraffin block.

Results

Amplification and Analysis of Exons 8 and 9

A genomic fragment of DNA of 204 base pairs (bp) encompassing exon 8 was amplified by PCR from tissue or blood samples from the four patients. Attempts to amplify a number of paraffin-embedded bone samples from Patients 2 and 3 were unsuccessful, probably because DNA degradation had occurred during acidic decalcification of these specimens.34 , 35

The PCR products were then analyzed by DGGE, a method that allows rapid screening for mutations, including single-base substitutions, in a DNA region. Double-stranded DNA fragments consisting of mismatched wild-type and mutant strands (heteroduplexes) will melt more readily than those consisting of two matched strands (homoduplexes) and will therefore migrate a shorter distance in a gradient of denaturant.33 DNA amplified from normal tissues revealed only a wild-type homoduplex band (Fig. 1Figure 1Analysis of Tissue Samples from Patient 1, a Negative Control, and a Positive Control., negative control). DNA amplified from pituitary tumors known to contain either the R201C or R201H substitution revealed an abnormal pattern with two slower-migrating heteroduplex bands and a mutant homoduplex band in addition to the wild-type band (Fig. 1, positive control; data shown only for R201C). Analysis of several tissue samples from Patient 1 revealed a pattern resembling that of the pituitary tumors, with varying ratios of abnormal and wild-type bands (Fig. 1). Similar results were obtained with tissues from the three other patients (data not shown).

To identify the specific mutations responsible for the abnormal patterns, the amplified DNA samples were analyzed by allele-specific oligonucleotide hybridization. In this technique DNA is bound to nylon filters and hybridized at high stringency to Radio-labeled oligonucleotide probes that either match the wild-type sequence or contain specific single-base substitutions. Analysis with the wild-type R201 and mutant R201C and R201H oligonucleotide probes revealed that the DNA abnormalities revealed by DGGE in each patient could be accounted for by either one of the two previously defined activating missense mutations at Arg²⁰¹. Different tissues from an individual patient all had varying amounts of the same mutant allele (either R201C or R201H). Moreover, for each sample the relative proportion of DNA present in the abnormal upper bands in DGGE correlated well with the relative proportion of mutant allele determined by allele-specific oligonucleotide hybridization (Fig. 1). The results were negative with use of DNA prepared from six paraffin-embedded tissues from patients without the McCune–Albright syndrome.

Screening of a PCR-amplified 218-bp genomic fragment encompassing exon 9 from selected tissues from the four patients revealed no evidence of mutations (data not shown). In these experiments pituitary-tumor samples known to contain two different missense mutations coding for substitutions at Gin²²⁷ within exon 9 produced abnormal patterns.

Patient 1

Screening for mutations in exon 8 revealed the R201C mutation in frozen surgical specimens of both ovaries from Patient 1 (Fig. 1). The same mutation was also present in genomic DNA isolated from a paraffin-embedded liver specimen and from whole blood (Fig. 1). The R201C mutation was confirmed by direct sequencing of DNA amplified from liver and ovary (data not shown). An area of histologically abnormal ovarian tissue contained a higher proportion of mutant alleles than an adjacent normal area (Fig. 2Figure 2Correlation of the Abundance of Mutant Alleles with the Pathological Abnormalities in Ovarian Tissue from Patient 1.). DNA isolated from a region of the paraffin-embedded sample containing cortical stroma and primordial follicles contained almost no mutant alleles, whereas that from a region of luteinized follicular cells, whose presence is abnormal in a three-year-old girl, had equally intense signals for normal and mutant sequences, suggesting that almost all cells from this area were heterozygous for the activating mutation. DNA from the whole slice, which included affected and unaffected regions, contained an intermediate amount of mutant G_sα that corresponded to the results obtained with the frozen ovary specimens (Fig. 1). DNA isolated from skin fibroblasts derived from normal and pigmented areas did not contain the R201C mutation (data not shown).

Patient 2

The R201C mutation was found in several tissues from Patient 2 (Fig. 3Figure 3Analysis of Tissue Samples from Patient 2.), including the thyroid, pituitary adenoma, and right and left adrenal glands. Immunostaining of the pituitary adenoma for hormones was positive only for growth hormone (data not shown). The mutant allele was also detected, but in lower proportions, in testis, thymus, lung, liver, heart, kidney, and spleen; it was not detected in the parathyroid or bowel (Fig. 3). The R201C mutation was confirmed by direct sequencing of DNA amplified from the left adrenal adenoma (data not shown). The left adrenal specimen included one region of adrenocortical adenoma and another of normal adrenal tissue. When these regions were analyzed separately, the relative proportion of mutant alleles was much higher in adenomatous tissue than in the normal adrenal tissue (Fig. 3).

Patient 3

The R201H mutation was found in a number of tissue samples from Patient 3 (Fig. 4Figure 4Analysis of Tissue Samples from Patient 3.). The mutation was confirmed by direct sequencing of DNA amplified from liver (data not shown). The adrenal glands, testis, liver, and heart had the highest proportion of mutant alleles, whereas most of the other tissues examined, including gastric adenomatous polyps, thymus, lung, pancreas, kidney, and mesenteric lymph node, contained detectable but lower proportions of the mutant alleles. The mutant DNA was barely detectable in the esophagus.

Patient 4

In Patient 4 the R201H mutation was found in paraffin-embedded surgical specimens of the cystic right ovary and histologically normal right fallopian tube but not the left ovary (data not shown). Although the left ovary was reported to be histologically abnormal, the specimen available for analysis contained mostly stroma with primordial follicles, findings that perhaps explain our inability to detect the mutation in this specimen. The R201H mutant allele was also present in a low proportion in DNA amplified from a recent blood sample from this patient (data not shown).

Discussion

We identified activating mutations of the G_sα gene in tissues from four patients with the McCune–Albright syndrome. It has been postulated that the McCune–Albright syndrome may be caused by either an early postzygotic somatic mutation or a gametic half-chromatid mutation that results in the widespread, mosaic distribution of abnormal cells.36 Clinical features that support this concept include the sporadic occurrence of the syndrome and the characteristic, often lateralized, pattern of skin and bone involvement. Our findings also support this model. First, in each patient only one specific mutation (R201C or R201H) was detected, a finding that is consistent with the presence of a single monoclonal population of abnormal cells. Second, the widespread distribution of the mutation in tissues derived from all three embryologie germ layers (ectoderm [pituitary], endoderm [thyroid], and mesoderm [adrenal glands] in Patient 2, for example) suggests a mutational event that occurs before the development of the trilaminar disk. Third, the variable representation of the mutation among the different tissues in an individual patient and the absence of a mutation in at least one tissue from each patient are consistent with a somatic rather than a germ-line mutation.

Preliminary positive results in four of six other patients suggest that mutations of Arg²⁰¹ may be common in the McCune–Albright syndrome (unpublished observations). The ability of mutant G_sα genes to be expressed as messenger RNA and their association with defined biochemical abnormalities have been well documented in human pituitary tumors.16 We have similarly found that the mutant R201C gene is expressed as messenger RNA in ovarian tissue from Patient 1 (data not shown). Direct biochemical evidence of inappropriate activation of the cAMP pathway in the McCune–Albright syndrome is lacking, however, and may be difficult to obtain because of the mosaic distribution of the mutation within tissues and the need to collect appropriate control tissues.

Activating Arg²⁰¹ mutations (gsp oncogenes) were first described in sporadic growth hormone—secreting pituitary adenomas, in which they are associated with autonomous cAMP synthesis.16 , 20 , 21 Replacement of the Arg²⁰¹ residue in G_sα with cysteine or histidine causes a 30-fold decrease in intrinsic GTPase activity, and cell membranes containing these altered proteins produce cAMP at an elevated rate in the absence of any stimulatory hormone.16 The proliferation of certain cells is stimulated by cAMP.11 , 12 , 37 In our patients, Arg²⁰¹ mutations were associated with cellular hyperplasia and adenomas, although malignant tumors have occasionally been reported in association with the McCune–Albright syndrome.4 , 10 , 38

G_sα mutations were present in virtually all affected endocrine tissues that were analyzed. Moreover, in ovarian tissue from Patient 1 and adrenal tissue from Patient 2, specific regions of abnormal tissue contained a higher proportion of mutant cells than adjacent normal tissue. Primordial ovarian follicles containing activated G_s may undergo maturation independently of gonadotropins, resulting in the development of cystic ovaries and sexual precocity. Increased synthesis of cAMP has been shown to have acute and chronic stimulatory effects on steroidogenesis in adrenal glands and gonads.39 Hyperplastic expansion of abnormal cells during follicular maturation would result in a region in the ovary rich in cells bearing the mutation. Proliferation of mutant cells may also account for their being more abundant in an adrenocortical adenoma than in the normal adrenal gland in Patient 2. Although the role of increased synthesis of cAMP in stimulating the proliferation of ovarian and adrenal cortical cells has been questioned,20 the association of activating G_sα mutations with cellular proliferation in the McCune–Albright syndrome suggests that both gonadotropins and corticotropin may use the G_s pathway to stimulate proliferation of their respective target tissues in vivo.

The growth hormone—producing pituitary adenoma in Patient 2 had a high level of the R201C mutant allele. R201 substitutions are the most common gsp mutations found in pituitary tumors.16 , 20 , 21 The transcription of growth hormone factor 1 (GHF1), a protein that promotes differentiation and proliferation of somatotrophs, is induced by cAMP.40 Only growth hormone—secreting pituitary tumors have been described in the McCune–Albright syndrome. Somatic mutations of G_s may occur in other pituitary cell lines, but perhaps only the somatotrophs respond with uncontrolled proliferation.

Thus far, we have been unable to determine whether activating mutations are present in dysplastic bone and café au lait spots, two of the prominent characteristics of the McCune–Albright syndrome. Attempts to amplify specimens of bone and skin from several patients were unsuccessful, and cultured skin fibroblasts from Patient 1 did not harbor the activating mutation. In both dysplastic bone and café au lait spots there are very few of the potentially relevant types of cells (osteoblasts and melanocytes, respectively),11 , 41 so that even in appropriately prepared specimens it may be difficult to identify mutations.

It remains to be determined whether G_s mutations are causally related to the nonendocrine abnormalities in three of our patients, including chronic liver disease (Patient 1), thymic hyperplasia (Patients 2 and 3), gastrointestinal adenomatous polyps (Patient 3), cardiopulmonary disease (Patient 2), and sudden death (Patients 2 and 3). Unexpectedly widespread pathology, including thymic hyperplasia and gastrointestinal polyps, has previously been noted,26 , 38 , 42 but to our knowledge liver disease has not. In addition to Patient 1, Patient 2 also had evidence of mild liver abnormalities (Fig. 3). We are aware of two other severely affected patients whose histories included chronic, unexplained liver disease and unexpected cardiopulmonary arrest (Pescovitz O, Charest N, Van Wyk JJ: personal communication). Further attention should be focused on the potential clinical implications of constitutive activation of G_s in nonendocrine tissues, such as the liver and the cardiac pacemaker.43 , 44

G_sα mutations were detected in a few tissues (e.g., pancreas, kidney, and blood) with no clinical abnormalities. One explanation for this finding is that there is low expression of the mutant gene as messenger RNA or protein in these tissues. Another possibility is that increased cAMP production has minimal consequences in some cells, possibly because of a compensatory increase in phosphodiesterase activity.45

The correlation of activating G_sα mutations with endocrine pathology and the physiologic relevance of constitutive cAMP production to the autonomous endocrine hyperfunction of the McCune–Albright syndrome are compelling evidence that these mutations represent the pathogenetic basis of this disease. The McCune–Albright syndrome is a potential in vivo model of the role of G_s signaling pathways in biologic systems and human disease.

Presented in part at the Seventh International Symposium on Cellular Endocrinology, Lake Placid, N.Y., September 1991.

We are indebted to P. Feuillan, G. Cutler, J. Lyons, R. Blizzard, C. Thornton, L. Lerman, and E. Gershon; and to P. Benedict, M. Pitman, N. Harris, N. Mauras, S. Tabbara, J. Crawford, and S. Scholl for assistance in obtaining blood and pathological specimens.

Source Information

From the Molecular Pathophysiology Branch, National Institute of Diabetes and Digestive and Kidney Diseases (L.S.W., A.S., E.F., A.M.S.), the Clinical Neurogenetics Branch, National Institute of Mental Health (P.V.G.), and the Laboratory of Pathology, National Cancer Institute (M.J.M.), National Institutes of Health, Bethesda, Md. Address reprint requests to Dr. Weinstein at the Molecular Pathophysiology Branch, NIDDK, NIH, Bldg. 10, Rm. 8D–17, Bethesda, MD 20892.

References

References

1. 1

   McCune DJ. Osteitis fibrosa cystica; the case of a nine year old girl who also exhibits precocious puberty, multiple pigmentation of the skin and hyperthyroidism . Am J Dis Child 1936;52:743–4
   

2. 2

   Albright F, Butler AM, Hampton AO, Smith P. Syndrome characterized by osteitis fibrosa disseminata, areas of pigmentation and endocrine dysfunction, with precocious puberty in females: report of five cases . N Engl J Med 1937;216:727–46
   Full Text | Web of Science

3. 3

   Benedict PH. Endocrine features in Albright's syndrome (fibrous dysplasia of bone) . Metabolism 1962;11:30–45
   Web of Science | Medline

4. 4

   Mauras N, Blizzard RM. The McCune–Albright syndrome . Acta Endocrinol Suppl (Copenh) 1986;279:207–17
   Medline

5. 5

   Danon M, Robboy SJ, Kim S, Scully R, Crawford JD. Cushing syndrome, sexual precocity, and polyostotic fibrous dysplasia (Albright syndrome) in infancy . J Pediatr 1975;87:917–21
   CrossRef | Web of Science | Medline

6. 6

   Case Records of the Massachusetts General Hospital (Case 4–1975) . N Engl J Med 1975;292:199–203
   Full Text | Web of Science | Medline

7. 7

   D'Armiento M, Reda G, Camagna A, Tardella L. McCune–Albright syndrome: evidence for autonomous multiendocrine hyperfunction . J Pediatr 1983;102:584–6
   CrossRef | Web of Science | Medline

8. 8

   Foster CM, Ross JL, Shawker T, et al. Absence of pubertal gonadotropin secretion in girls with McCune–Albright syndrome . J Clin Endocrinol Metab 1984;5:1161–5
   CrossRef

9. 9

   Feuillan PP, Shawker T, Rose SR, Jones J, Jeevanram RK, Nisula BC. Thyroid abnormalities in the McCune–Albright syndrome: ultrasonography and hormone studies . J Clin Endocrinol Metab 1990;71:1596–601
   CrossRef | Web of Science | Medline

10. 10

    Lee PA, Van Dop C, Migeon CJ. McCune–Albright syndrome: long-term follow-up . JAMA 1986;256:2980–4
    CrossRef | Web of Science | Medline

11. 11

    Dumont JE, Jauniaux J-C, Roger pp. The cyclic AMP-mediated stimulation of cell proliferation . Trends Biochem Sci 1989;14:67–71
    CrossRef | Web of Science | Medline

12. 12

    Maenhaut C, Roger PP, Reuse S, Dumont JE. Activation of the cyclic AMP cascade as an oncogenic mechanism: the thyroid example . Biochimie 1991;73:29–36
    CrossRef | Web of Science | Medline

13. 13

    Simon Ml, Strathmann MP, Gautam N. Diversity of G proteins in signal transduction . Science 1991;252:802–8
    CrossRef | Web of Science | Medline

14. 14

    Bourne HR, Sanders DA, McCormick F. The GTPase superfamily: a conserved switch for diverse cell functions . Nature 1990;348:125–32
    CrossRef | Web of Science | Medline

15. 15

    Bimbaumer L, Abramowitz J, Brown AM. Receptor-effector coupling by G-proteins . Biochim Biophys Acta 1990;1031:163–224
    Web of Science | Medline

16. 16

    Landis CA, Masters SB, Spada A, Pace AM, Bourne HR, Vallar L. GTPase inhibiting mutations activate the α chain of Gs and stimulate adenylyl cyclase in human pituitary tumours . Nature 1989;340:692–6
    CrossRef | Web of Science | Medline

17. 17

    Masters SB, Miller RT, Chi M-H, et al. Mutations in the GTP-binding site of G,α alter stimulation of adenylyl cyclase . J Biol Chem 1989;264:15467–74
    Web of Science | Medline

18. 18

    Graziano MP, Gilman AG. Synthesis in Escherichia coli of GTPase-deficient mutants of Gsα . J Biol Chem 1989;264:15475–82
    Web of Science | Medline

19. 19

    Freissmuth M, Gilman AG. Mutations of Gsα designed to alter the reactivity of the protein with bacterial toxins: substitutions at Arg187 result in loss of GTPase activity . J Biol Chem 1989;264:21907–14
    Web of Science | Medline

20. 20

    Lyons J, Landis CA, Harsh G, et al. Two G protein oncogenes in human endocrine tumors . Science 1990;249:655–9
    CrossRef | Web of Science | Medline

21. 21

    Clementi E, Malgaretti N, Meldolesi J, Taramelli R. A new constitutively activating mutation of the Gs protein α subunit-gsp oncogene is found in human pituitary tumours . Oncogene 1990;5:1059–61
    Web of Science | Medline

22. 22

    Suarez HG, du Villard JA, Caillou B, Schlumberger M, Parmentier C, Monier R. gsp mutations in human thyroid tumours . Oncogene 1991;6:677–9
    Web of Science | Medline

23. 23

    Burton FH, Hasel KW, Bloom FE, Sutcliffe JG. Pituitary hyperplasia and gigantism in mice caused by a cholera toxin transgene . Nature 1991;350:74–7
    CrossRef | Web of Science | Medline

24. 24

    Weinstein LS, Gejman PV, Friedman E, et al. Mutations of the Gs a-subunit gene in Albright hereditary osteodystrophy detected by denaturing gradient gel electrophoresis . Proc Natl Acad Sci U S A 1990;87:8287–90
    CrossRef | Web of Science | Medline

25. 25

    Patten JL, Johns DR, Valle D, et al. Mutation in the gene encoding the stimulatory G protein of adenylate cyclase in Albright's hereditary osteodystrophy . N Engl J Med 1990;322:1412–9
    Full Text | Web of Science | Medline

26. 26

    Benjamin DR, McRoberts JW. Polyostotic fibrous dysplasia associated with Cushing syndrome . Arch Pathol 1973;96:175–8
    Web of Science | Medline

27. 27

    Jeanpierre M. A rapid method for the purification of DNA from blood . Nucleic Acids Res 1987;15:9611
    CrossRef | Web of Science | Medline

28. 28

    Davis LG, Dibner MD, Battey JF. Basic methods in molecular biology. New York: Elsevier, 1986:47–50
    

29. 29

    Saiki RK, Gelfand DH, Stoffel S, et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase . Science 1988; 239:487–91
    CrossRef | Web of Science | Medline

30. 30

    Lerman LS, Silverstein K. Computational stimulation of DNA melting and its application to denaturing gradient gel electrophoresis. In: Wu R, ed. Recombinant DNA. Part F. Vol. 155 of Methods in enzymology. San Diego, Calif.: Academic Press, 1985:482–501
    

31. 31

    Sheffield VC, Cox DR, Lerman LS, Myers RM. Attachment of a 40-base pair G + C-rich sequence (GC-clamp) to genomic DNA fragments by the polymerase chain reaction results in improved detection of single-base changes . Proc Natl Acad Sci U S A 1989;86:232–6
    CrossRef | Web of Science | Medline

32. 32

    Kozasa T, Itoh H, Tsukamoto T, Kaziro Y. Isolation and characterization of the human Gsα gene . Proc Natl Acad Sci U S A 1988;85:2081–5
    CrossRef | Web of Science | Medline

33. 33

    Myers RM, Maniatis T, Lerman LS. Detection and localization of single base changes by denaturing gradient gel electrophoresis. In: Wu R, ed. Recombinant DNA. Part F. Vol. 155 of Methods in enzymology. San Diego, Calif.: Academic Press, 1985:501–27
    

34. 34

    Shibata D, Martin WJ, Amheim N. Analysis of DNA sequences in forty-year-old paraffin-embedded thin-tissue sections: a bridge between molecular biology and classical histology . Cancer Res 1988;48:4564–6
    Web of Science | Medline

35. 35

    Greer CE, Peterson SL, Kiviat NB, Manos MM. PCR amplification from paraffin-embedded tissues: effects of fixative and fixation time . Am J Clin Pathol 1991;95:117–24
    Web of Science | Medline

36. 36

    Happle R. The McCune–Albright syndrome: a lethal gene surviving by mosaicism . Clin Genet 1986;29:321–4
    CrossRef | Web of Science | Medline

37. 37

    Cho-Chung YS, Clair T, Tortora G, Yokozaki H, Pepe S. Suppression of malignancy targeting the intracellular signal transducing proteins of cAMP: the use of site-selective cAMP analogs, antisense strategy, and gene transfer . Life Sci 1991;48:1123–32
    CrossRef | Web of Science | Medline

38. 38

    Di George AM. Albright syndrome: is it coming of age? J Pediatr 1975;87:1018–20
    CrossRef | Web of Science | Medline

39. 39

    Waterman MR, Simpson ER. Regulation of steroid hydroxylase gene expression is multifactorial in nature . Recent Prog Horm Res 1989;45:533–66
    Web of Science | Medline

40. 40

    Castrillo J-L, Theill LE, Karin M. Function of the homeodomain protein GHF1 in pituitary cell proliferation . Science 1991;253:197–9
    CrossRef | Web of Science | Medline

41. 41

    Chanson P, Dib A, Marie P, Guillausseau PJ, Warnet A, Lubetzki J. Acromegaly and McCune–Albright syndrome. In: Program and abstracts of the 73rd Annual Meeting of the Endocrine Society, June 19–22, 1991. Bethesda, Md.: Endocrine Society Press, 1991:425. abstract
    

42. 42

    MacMahon HE. Albright's syndrome — thirty years later (polyostotic fibrous dysplasia) . Pathol Annu 1971;6:81–146
    Medline

43. 43

    DiFrancesco D, Tortora P. Direct activation of cardiac pacemaker channels by intracellular cyclic AMP . Nature 1991;351:145–7
    CrossRef | Web of Science | Medline

44. 44

    Yatani A, Okabe K, Codina J, Birnbaumer L, Brown AM. Heart rate regulation by G proteins acting on the cardiac pacemaker channel . Science 1990;249:1163–6
    CrossRef | Web of Science | Medline

45. 45

    Zachary I, Masters SB, Bourne HR. Increased mitogenic responsiveness of Swiss 3T3 cells expressing constitutively active Gsα . Biochem Biophys Res Commun 1990;168:1184–93
    CrossRef | Web of Science | Medline

Citing Articles (291)

Citing Articles

1. 1

   Jyothsna Gattineni, Michel Baum. (2012) Genetic disorders of phosphate regulation. Pediatric Nephrology
   CrossRef

2. 2

   A.l.i. Mohamadi, Roberto Salvatori. 2012. Neuroendocrine Growth Disorders – Dwarfism, Gigantism. , 707-721.
   CrossRef

3. 3

   Robert P. Millar, Claire L. Newton, Antonia K. Roseweir. 2012. Neuroendocrine GPCR Signaling. , 21-53.
   CrossRef

4. 4

   Seung Eun Lee, Enu Hee Lee, Heejung Park, Ji-Youn Sung, Hyoun Wook Lee, So Young Kang, Sungwook Seo, Byung Heon Kim, Hyojin Lee, An Na Seo, Geunghwan Ahn, Yoon-La Choi. (2012) The diagnostic utility of the GNAS mutation in patients with fibrous dysplasia: meta-analysis of 168 sporadic cases. Human Pathology
   CrossRef

5. 5

   Paolo Bianco, Shlomo Wientroub. 2012. Fibrous Dysplasia. , 589-624.
   CrossRef

6. 6

   J. B. Regard, N. Cherman, D. Palmer, S. A. Kuznetsov, F. S. Celi, J.-M. Guettier, M. Chen, N. Bhattacharyya, J. Wess, S. R. Coughlin, L. S. Weinstein, M. T. Collins, P. G. Robey, Y. Yang. (2011) Wnt/ -catenin signaling is differentially regulated by G  proteins and contributes to fibrous dysplasia. Proceedings of the National Academy of Sciences 108:50, 20101-20106
   CrossRef

7. 7

   Alberto Schreiber, Andrea B. Villaret, Roberto Maroldi, Piero Nicolai. (2011) Fibrous dysplasia of the sinonasal tract and adjacent skull base. Current Opinion in Otolaryngology & Head and Neck Surgery1
   CrossRef

8. 8

   L. Soriano Guillén, J. Argente. (2011) Pubertad precoz periférica: fundamentos clínicos y diagnóstico-terapéuticos. Anales de Pediatría
   CrossRef

9. 9

   Jennifer L. Bercaw-Pratt, Tracy Patel Moorjani, Xiomara M. Santos, Lefkothea Karaviti, Jennifer E. Dietrich. (2011) Diagnosis and Management of Precocious Puberty in Atypical Presentations of McCune-Albright Syndrome: A Case Series Review. Journal of Pediatric and Adolescent Gynecology
   CrossRef

10. 10

    Jan M. Wit, Matti Hero, Susan B. Nunez. (2011) Aromatase inhibitors in pediatrics. Nature Reviews Endocrinology
    CrossRef

11. 11

    Alfred Tenore, Daniela Driul. (2011) Genomics in Pediatric Endocrinology—Genetic Disorders and New Techniques. Pediatric Clinics of North America 58:5, 1061-1081
    CrossRef

12. 12

    Guangdong Chen, Huilin Yang, Minfeng Gan, Xuefeng Li, Kangwu Chen, Badri Nalajala, Genlin Wang. (2011) Polyostotic Fibrous Dysplasia of the Thoracic Spine. Spine 36:22, E1485-E1488
    CrossRef

13. 13

    Sridhar Subbiah, Gaurav Palikhe, Sanjay Kumar Bhadada, Kanchan Kumar Mukherjee, Anil Bhansali. (2011) Acrogigantism and facial asymmetry: McCune-Albright syndrome. Journal of Pediatric Endocrinology and Metabolism 24:9-10, 835-837
    CrossRef

14. 14

    Isaac Levy, Anelia Horvath, Monalisa Azevedo, Rodrigo Bertollo de Alexandre, Constantine A Stratakis. (2011) Phosphodiesterase function and endocrine cells: links to human disease and roles in tumor development and treatment. Current Opinion in Pharmacology
    CrossRef

15. 15

    Lindhurst, Marjorie J., Sapp, Julie C., Teer, Jamie K., Johnston, Jennifer J., Finn, Erin M., Peters, Kathryn, Turner, Joyce, Cannons, Jennifer L., Bick, David, Blakemore, Laurel, Blumhorst, Catherine, Brockmann, Knut, Calder, Peter, Cherman, Natasha, Deardorff, Matthew A., Everman, David B., Golas, Gretchen, Greenstein, Robert M., Kato, B. Maya, Keppler-Noreuil, Kim M., Kuznetsov, Sergei A., Miyamoto, Richard T., Newman, Kurt, Ng, David, O'Brien, Kevin, Rothenberg, Steven, Schwartzentruber, Douglas J., Singhal, Virender, Tirabosco, Roberto, Upton, Joseph, Wientroub, Shlomo, Zackai, Elaine H., Hoag, KimberlyWhitewood-Neal, TraceyRobey, Pamela G., Schwartzberg, Pamela L., Darling, Thomas N., Tosi, Laura L., Mullikin, James C., Biesecker, Leslie G., . (2011) A Mosaic Activating Mutation in AKT1 Associated with the Proteus Syndrome. New England Journal of Medicine 365:7, 611-619
    Full Text

16. 16

    D. Vezzosi, J. Bertherat. (2011) Phosphodiesterases in endocrine physiology and disease. European Journal of Endocrinology 165:2, 177-188
    CrossRef

17. 17

    Helen Madsen, Manuel Thomas Borges, Janice M. Kerr, Kevin O. Lillehei, B. K. Kleinschmidt-DeMasters. (2011) McCune–Albright syndrome: surgical and therapeutic challenges in GH-secreting pituitary adenomas. Journal of Neuro-Oncology 104:1, 215-224
    CrossRef

18. 18

    Joseph C. Whitt, James W. Rokos, Charles L. Dunlap, Bruce F. Barker. (2011) Segmental odontomaxillary dysplasia: report of a series of 5 cases with long-term follow-up. Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology, and Endodontology 112:2, e29-e47
    CrossRef

19. 19

    Karina Sotomayor, German Iñiguez, Francisca Ugarte, Claudio Villarroel, Patricia López, Alejandra Avila, Ethel Codner, Fernando Cassorla. (2011) Ovarian function in adolescents with McCune-Albright syndrome. Journal of Pediatric Endocrinology and Metabolism 24:7-8, 525-528
    CrossRef

20. 20

    Jean Charles Nault, Monique Fabre, Gabrielle Couchy, Camilla Pilati, Emmanuelle Jeannot, Jeanne Tran Van Nhieu, Marie-Christine Saint-Paul, Anne De Muret, Marie-José Redon, Catherine Buffet, Sylvie Salenave, Charles Balabaud, Sophie Prevot, Philippe Labrune, Paulette Bioulac-Sage, Jean-Yves Scoazec, Philippe Chanson, Jessica Zucman-Rossi. (2011) GNAS-activating mutations define a rare subgroup of inflammatory liver tumors characterized by STAT3 activation. Journal of Hepatology
    CrossRef

21. 21

    Steven A. Lietman. (2011) Preimplantation Genetic Diagnosis for Hereditary Endocrine Disease. Endocrine Practice 17:0, 28-32
    CrossRef

22. 22

    Luciana Nogueira Delfino, Giuseppe Fariello, Carlo Cosimo Quattrocchi, Costanza Aiello, Laura Menchini, Rita Devito, Mario Zama, Dianella Claps, Federico Vigevano, Daniela Longo. (2011) Encephalocraniocutaneous lipomatosis (ECCL): Neuroradiological findings in three patients and a new association with fibrous dysplasia. American Journal of Medical Genetics Part A 155:7, 1690-1696
    CrossRef

23. 23

    Monalisa F. Azevedo, Constantine A. Stratakis. (2011) The Transcriptome that Mediates Increased Cyclic Adenosine Monophosphate Signaling in <i>PRKAR1A</i> Defects and Other Settings. Endocrine Practice 17:0, 2-7
    CrossRef

24. 24

    Andrea Saggini, Maria Luisa Brandi. (2011) Skin Lesions in Hereditary Endocrine Tumor Syndromes. Endocrine Practice 17:0, 47-57
    CrossRef

25. 25

    Rudolf Happle. 2011. Principles of Genetics, Mosaicism and Molecular Biology. , 115.1-115.29.
    CrossRef

26. 26

    Kenshi Sakayama, Yoshifumi Sugawara, Teruki Kidani, Taketsugu Fujibuchi, Katsumi Kito, Nozomu Tanji, Atsushi Nakamura. (2011) Polyostotic fibrous dysplasia with gigantism and huge pelvic tumor: a rare case of McCune–Albright syndrome. International Journal of Clinical Oncology 16:3, 270-274
    CrossRef

27. 27

    Shlomo Melmed. (2011) Pathogenesis of pituitary tumors. Nature Reviews Endocrinology 7:5, 257-266
    CrossRef

28. 28

    Madson Q. Almeida, Constantine A. Stratakis. (2011) How does cAMP/protein kinase A signaling lead to tumors in the adrenal cortex and other tissues?. Molecular and Cellular Endocrinology 336:1-2, 162-168
    CrossRef

29. 29

    Ming Gang Su, Rong Tian, Qiu Ping Fan, Ye Tian, Fang Lan Li, Lin Li, An Ren Kuang, John Howard Miller. (2011) Recognition of fibrous dysplasia of bone mimicking skeletal metastasis on 18F-FDG PET/CT imaging. Skeletal Radiology 40:3, 295-302
    CrossRef

30. 30

    Marie-Lise Jaffrain-Rea, Adrian F Daly, Mariolina Angelini, Patrick Petrossians, Vincent Bours, Albert Beckers. (2011) Genetic susceptibility in pituitary adenomas: from pathogenesis to clinical implications. Expert Review of Endocrinology & Metabolism 6:2, 195-214
    CrossRef

31. 31

    A. Saussine, L. Valeyrie-Allanore, D. Vidaud, A. Rahmouni, P. Wolkenstein. (2011) Syndrome de McCune-Albright. Annales de Dermatologie et de Vénéréologie 138:2, 163-165
    CrossRef

32. 32

    Hugo Néstor CABRERA, Patricia DELLA GIOVANNA, María Daniela HERMIDA. (2011) Syndromic nevoid hypermelanosis: Description of seven cases with a 10-year follow up. The Journal of Dermatology 38:2, 125-130
    CrossRef

33. 33

    Jon F. Wilkins, Francisco Úbeda. 2011. Diseases Associated with Genomic Imprinting. , 401-445.
    CrossRef

34. 34

    V. Nebes, J. Wall. 2011. Membrane Receptor-Linked Disease States. .
    CrossRef

35. 35

    Shlomo Melmed. 2011. Acromegaly. , 433-474.
    CrossRef

36. 36

    Xavier Bertagna, Laurence Guignat, Marie-Charles Raux-Demay, Brigitte Guilhaume, François Girard. 2011. Cushing's disease. , 533-617.
    CrossRef

37. 37

    Delphine Vezzosi, Jérôme Bertherat, Lionel Groussin. (2010) Pathogenesis of benign adrenocortical tumors. Best Practice & Research Clinical Endocrinology & Metabolism 24:6, 893-905
    CrossRef

38. 38

    P Castronovo, A Delahaye-Duriez, C Gervasini, J Azzollini, F Minier, S Russo, M Masciadri, A Selicorni, A Verloes, L Larizza. (2010) Somatic mosaicism in Cornelia de Lange syndrome: a further contributor to the wide clinical expressivity?. Clinical Genetics 78:6, 560-564
    CrossRef

39. 39

    Geetika Khanna, Kartikeya Kantawala, Marwan Shinawi, Sandhya Sarwate, Louis P. Dehner. (2010) McCune-Albright syndrome presenting with unilateral macroorchidism and bilateral testicular masses. Pediatric Radiology 40:S1, 16-20
    CrossRef

40. 40

    Amir S. Alizadeh Naderi, Robert F. Reilly. (2010) Hereditary disorders of renal phosphate wasting. Nature Reviews Nephrology 6:11, 657-665
    CrossRef

41. 41

    Kara N. Shah. (2010) The Diagnostic and Clinical Significance of Café-au-lait Macules. Pediatric Clinics of North America 57:5, 1131-1153
    CrossRef

42. 42

    S. Idziaszczyk, C.H. Wilson, C.G. Smith, D.J. Adams, J.P. Cheadle. (2010) Analysis of the frequency of GNAS codon 201 mutations in advanced colorectal cancer. Cancer Genetics and Cytogenetics 202:1, 67-69
    CrossRef

43. 43

    Lela S. Mansoori, Colin P. Catel, Micol S. Rothman. (2010) Bisphosphonate Treatment in Polyostotic Fibrous Dysplasia of the Cranium: Case Report and Literature Review. Endocrine Practice 16:5, 851-854
    CrossRef

44. 44

    C H Wilson, R E McIntyre, M J Arends, D J Adams. (2010) The activating mutation R201C in GNAS promotes intestinal tumourigenesis in ApcMin/+ mice through activation of Wnt and ERK1/2 MAPK pathways. Oncogene 29:32, 4567-4575
    CrossRef

45. 45

    Zoran Gucev, Velibor Tasic, Aleksandra Jancevska, Marina Krstevska-Konstantinova, Nada Pop-Jordanova. (2010) McCune-Albright Syndrome (MAS): Early and Extensive Bone Fibrous Dysplasia Involvement and “Mistaken Identity” Oophorectomy. Journal of Pediatric Endocrinology and Metabolism 23:8, 837-842
    CrossRef

46. 46

    Hridesh Dixit, Lakshmi Rao, Venkata Padmalatha, Turlapati Raseswari, Anil Kumar Kapu, Bineet Panda, Kanakavalli Murthy, Durgadutta Tosh, Pratibha Nallari, Mamata Deenadayal, Nalini Gupta, Baidyanath Chakrabarthy, Lalji Singh. (2010) Genes governing premature ovarian failure. Reproductive BioMedicine Online 20:6, 724-740
    CrossRef

47. 47

    Shruti Chakrabarti, Ian Marshall. (2010) Another Unusual Presentation of McCune Albright Syndrome with Fibrous Dysplasia, Unilateral Testicular Enlargement, and Testicular Microlithiasis. Journal of Pediatric Endocrinology and Metabolism 23:5, 513-515
    CrossRef

48. 48

    Milan M. Patel, Jonathan F. Wilkey, Rafik Abdelsayed, Nisha J. D'Silva, Carl Malchoff, Sanjay M. Mallya. (2010) Analysis of GNAS mutations in cemento-ossifying fibromas and cemento-osseous dysplasias of the jaws. Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology, and Endodontology 109:5, 739-743
    CrossRef

49. 49

    J. Aidan Carney, Rolf C. Gaillard, Jérôme Bertherat, Constantine A. Stratakis. (2010) Familial Micronodular Adrenocortical Disease, Cushing Syndrome, and Mutations of the Gene Encoding Phosphodiesterase 11A4 (PDE11A). The American Journal of Surgical Pathology 34:4, 547-555
    CrossRef

50. 50

    Jyothsna Gattineni, Michel Baum. (2010) Regulation of phosphate transport by fibroblast growth factor 23 (FGF23): implications for disorders of phosphate metabolism. Pediatric Nephrology 25:4, 591-601
    CrossRef

51. 51

    Anélia Horvath, Jérôme Bertherat, Lionel Groussin, Marine Guillaud-Bataille, Kitman Tsang, Laure Cazabat, Rosella Libé, Elaine Remmers, Fernande René-Corail, Fabio Rueda Faucz, Eric Clauser, Alain Calender, Xavier Bertagna, J. Aidan Carney, Constantine A. Stratakis. (2010) Mutations and polymorphisms in the gene encoding regulatory subunit type 1-alpha of protein kinase A ( PRKAR1A ): an update. Human Mutation 31:4, 369-379
    CrossRef

52. 52

    Adrienne M. Flanagan, David Delaney, Paul O’Donnell. (2010) Benefits of molecular pathology in the diagnosis of musculoskeletal disease. Skeletal Radiology 39:3, 213-224
    CrossRef

53. 53

    Yoshihiko Noguchi, Norikazu Harii, Cesidio Giuliani, Ichiro Tatsuno, Koichi Suzuki, Leonard D. Kohn. (2010) Thyroglobulin (Tg) induces thyroid cell growth in a concentration-specific manner by a mechanism other than thyrotropin/cAMP stimulation. Biochemical and Biophysical Research Communications 391:1, 890-894
    CrossRef

54. 54

    Hong Joong Kim, Sang Yul Shim, Chang Ho Lee, Chul Chang. (2010) Monostotic Fibrous Dysplasia of Inferior Turbinate. Korean Journal of Otorhinolaryngology-Head and Neck Surgery 53:7, 456
    CrossRef

55. 55

    R. D. Chapurlat. (2010) Fibrous Dysplasia of Bone and McCune-Albright Syndrome. IBMS BoneKEy 7:1, 18-26
    CrossRef

56. 56

    Suvi Savola, Tom Böhling, Sakari Knuutila. 2010. Cytogenetic and Molecular Genetic Alterations in Bone Tumors. , 137-149.
    CrossRef

57. 57

    Gaya S. Aranoff, Jennifer J. Bell. 2010. Sexual Development, Growth, and Puberty in Children. , 18-34.
    CrossRef

58. 58

    Rossella Libé, Lionel Groussin, Jérôme Bertherat, Xavier Bertagna. 2010. Genetics of Adrenocortical Tumors (ACT) and Hypersecretory Syndromes. , 173-179.
    CrossRef

59. 59

    A M A Rahman, S N Madge, K Billing, P J Anderson, I Leibovitch, D Selva, D David. (2009) Craniofacial fibrous dysplasia: clinical characteristics and long-term outcomes. Eye 23:12, 2175-2181
    CrossRef

60. 60

    Shlomo Melmed. (2009) Acromegaly pathogenesis and treatment. Journal of Clinical Investigation 119:11, 3189-3202
    CrossRef

61. 61

    Anelia Horvath, Constantine A. Stratakis. (2009) Carney complex and lentiginosis. Pigment Cell & Melanoma Research 22:5, 580-587
    CrossRef

62. 62

    Ippei Kanazawa, Mika Yamauchi, Shozo Yano, Yasuo Imanishi, Riko Kitazawa, Yoshiki Nariai, Asuka Araki, Keisuke Kobayashi, Masaaki Inaba, Riruke Maruyama, Toru Yamaguchi, Toshitsugu Sugimoto. (2009) Osteosarcoma in a pregnant patient with McCune–Albright syndrome. Bone 45:3, 603-608
    CrossRef

63. 63

    Alfred Tenore, Daniela Driul. (2009) Genomics in Pediatric Endocrinology—Genetic Disorders and New Techniques. Endocrinology & Metabolism Clinics of North America 38:3, 471-490
    CrossRef

64. 64

    Jakub Mieszczak, Christopher P. Houk, Peter A. Lee. 2009. Management of Disordered Puberty. , 239-249.
    CrossRef

65. 65

    Mehul T. Dattani, Vaitsa Tziaferi, Peter C. Hindmarsh. 2009. Evaluation of Disordered Puberty. , 213-238.
    CrossRef

66. 66

    Stefan M. Willems, Alex B. Mohseny, Crina Balog, Raj Sewrajsing, Inge H. Briaire-de Bruijn, Jeroen Knijnenburg, Anne-Marie Cleton-Jansen, Raf Sciot, Christopher D. M. Fletcher, André M. Deelder, Karoly Szuhai, Paul J. Hensbergen, Pancras C. W. Hogendoorn. (2009) Cellular/intramuscular myxoma and grade I myxofibrosarcoma are characterized by distinct genetic alterations and specific composition of their extracellular matrix. Journal of Cellular and Molecular Medicine 13:7, 1291-1301
    CrossRef

67. 67

    Yasuhisa Ohata, Takehisa Yamamoto, Ikuko Mori, Toru Kikuchi, Toshimi Michigami, Yasuo Imanishi, Kenichi Satomura, Shinobu Ida, Keiichi Ozono. (2009) Severe arterial hypertension: a possible complication of McCune-Albright syndrome. European Journal of Pediatrics 168:7, 871-876
    CrossRef

68. 68

    M. Werner, K. Hauptmann, C.H. Lohmann, G. Jundt. (2009) Tumoren des Bewegungsapparats. Der Orthopäde 38:6, 546-556
    CrossRef

69. 69

    Koji Takano, Junko Yasufuku-Takano, Koji Morita, Shigetoshi Mori, Mao Takei, Robert Yoshiyuki Osamura, Akira Teramoto, Toshiro Fujita. (2009) Evidence that PKA activity is constitutively activated in human GH-secreting adenoma cells in a patient with Carney complex harbouring a PRKAR1A mutation. Clinical Endocrinology 70:5, 769-775
    CrossRef

70. 70

    Yu Chen, Xueqiang Ding, Yiqiang Yang, Wangxiang Yan, Dan Chen, Zhibin Li. (2009) Craniofacial Fibrous Dysplasia Associated With McCune-Albright Syndrome. Journal of Oral and Maxillofacial Surgery 67:3, 637-644
    CrossRef

71. 71

    NOEL WEIDNER, GRACE Y. LIN, MICHAEL KYRIAKOS. 2009. Joint and Bone Pathology. , 1784-1840.
    CrossRef

72. 72

    Reiner A. Veitia, James A. Birchler. (2009) Dominance and gene dosage balance in health and disease: why levels matter!. The Journal of Pathologyn/a-n/a
    CrossRef

73. 73

    Selma Feldman Witchel, Tony M. Plant. 2009. PubertyGonadarche and Adrenarche. , 395-431.
    CrossRef

74. 74

    Kristin D. Helm, Ralf M. Nass, William S. Evans. 2009. Physiologic and Pathophysiologic Alterations of the Neuroendocrine Components of the Reproductive Axis. , 441-488.
    CrossRef

75. 75

    Harald JÜppner, Anthony A. Portale. 2009. Endocrine Regulation of Phosphate Homeostasis. , 105-126.
    CrossRef

76. 76

    Ertug Kovanci, Joe Leigh Simpson, Paula Amato, Jan Rohozinski, Michael J. Heard, Colin E. Bishop, Sandra A. Carson. (2008) Oocyte-specific G-protein–coupled receptor 3 (GPR3): no perturbations found in 82 women with premature ovarian failure (first report). Fertility and Sterility 90:4, 1269-1271
    CrossRef

77. 77

    Anelia Horvath, Constantine A Stratakis. (2008) Unraveling the molecular basis of micronodular adrenal hyperplasia. Current Opinion in Endocrinology, Diabetes and Obesity 15:3, 227-233
    CrossRef

78. 78

    G Mantovani, S Bondioni, A G Lania, M Rodolfo, E Peverelli, N Polentarutti, T Veliz Rodriguez, S Ferrero, S Bosari, P Beck-Peccoz, A Spada. (2008) High expression of PKA regulatory subunit 1A protein is related to proliferation of human melanoma cells. Oncogene 27:13, 1834-1843
    CrossRef

79. 79

    Anat Ben-Shlomo, Shlomo Melmed. (2008) Acromegaly. Endocrinology & Metabolism Clinics of North America 37:1, 101-122
    CrossRef

80. 80

    Anelia Horvath, Constantine A. Stratakis. (2008) Clinical and molecular genetics of acromegaly: MEN1, Carney complex, McCune–Albright syndrome, familial acromegaly and genetic defects in sporadic tumors. Reviews in Endocrine and Metabolic Disorders 9:1, 1-11
    CrossRef

81. 81

    Roland D. Chapurlat, Philippe Orcel. (2008) Fibrous dysplasia of bone and McCune–Albright syndrome. Best Practice & Research Clinical Rheumatology 22:1, 55-69
    CrossRef

82. 82

    E. C. Hsiao, B. M. Boudignon, W. C. Chang, M. Bencsik, J. Peng, T. D. Nguyen, C. Manalac, B. P. Halloran, B. R. Conklin, R. A. Nissenson. (2008) From the Cover: Osteoblast expression of an engineered Gs-coupled receptor dramatically increases bone mass. Proceedings of the National Academy of Sciences 105:4, 1209-1214
    CrossRef

83. 83

    DELBERT A. FISHER, ANNETTE GRUETERS. 2008. Thyroid Disorders in Childhood and Adolescence. , 227-253.
    CrossRef

84. 84

    ALAN M. RICE, SCOTT A. RIVKEES. 2008. Receptor Transduction of Hormone Action. , 26-73.
    CrossRef

85. 85

    Adam S. Kanter, Jay Jagannathan, Christopher I. Shaffrey, Jean A. Ouellet, Praveen V. Mummaneni. (2008) Inflammatory and Dysplastic Lesions Involving the Spine. Neurosurgery Clinics of North America 19:1, 93-109
    CrossRef

86. 86

    M. H. Kelly, B. Brillante, M. T. Collins. (2008) Pain in fibrous dysplasia of bone: age-related changes and the anatomical distribution of skeletal lesions. Osteoporosis International 19:1, 57-63
    CrossRef

87. 87

    Wanchen Dou, Ning Lin, Wenbin Ma, Yi Yang, Huijuan Zhu, Juan Sun, Wei Lian, Zhong Yang, Wuyi Li, Renzhi Wang. (2008) Transsphenoidal surgery in a patient with acromegaly and McCune–Albright syndrome: application of neuronavigation. Journal of Neurosurgery 108:1, 164-169
    CrossRef

88. 88

    Joshua E. Medow, Basheal M. Agrawal, Daniel K. Resnick. (2007) Polyostotic fibrous dysplasia of the cervical spine: case report and review of the literature. The Spine Journal 7:6, 712-715
    CrossRef

89. 89

    Zeina M. Nabhan, Karen W. West, Erica A. Eugster. (2007) Oophorectomy in McCune-Albright syndrome: a case of mistaken identity. Journal of Pediatric Surgery 42:9, 1578-1583
    CrossRef

90. 90

    Elizabeth S Hart, Marilyn H Kelly, Beth Brillante, Clara C Chen, Navid Ziran, Janice S Lee, Penelope Feuillan, Arabella I Leet, Harvey Kushner, Pamela G Robey, Michael T Collins. (2007) Onset, Progression, and Plateau of Skeletal Lesions in Fibrous Dysplasia and the Relationship to Functional Outcome. Journal of Bone and Mineral Research 22:9, 1468-1474
    CrossRef

91. 91

    Heinrich Schmidt, Birgit Kammer, Monika Grasser, Angelika Enders, Imma Rost, Wieland Kiess. (2007) Endochondral gigantism: A newly recognized skeletal dysplasia with pre- and postnatal overgrowth and endocrine abnormalities. American Journal of Medical Genetics Part A 143A:16, 1868-1875
    CrossRef

92. 92

    Marianne Andersen. (2007) The role of lanreotide Autogel ^® in the treatment of acromegaly. Expert Review of Endocrinology & Metabolism 2:4, 433-441
    CrossRef

93. 93

    Alain Taïeb, Franck Boralevi. (2007) Hypermelanoses of the Newborn and of the Infant. Dermatologic Clinics 25:3, 327-336
    CrossRef

94. 94

    Marco Conti, Joseph Beavo. (2007) Biochemistry and Physiology of Cyclic Nucleotide Phosphodiesterases: Essential Components in Cyclic Nucleotide Signaling. Annual Review of Biochemistry 76:1, 481-511
    CrossRef

95. 95

    B D Idowu, M Al-Adnani, P O'Donnell, L Yu, E Odell, T Diss, R E Gale, A M Flanagan. (2007) A sensitive mutation-specific screening technique for GNAS1 mutations in cases of fibrous dysplasia: the first report of a codon 227 mutation in bone. Histopathology 50:6, 691-704
    CrossRef

96. 96

    Ji Zhou, Li-hao Sun, Bin Cui, Huai-dong Song, Xiao-ying Li, Guang Ning, Jian-min Liu. (2007) Genetic diagnosis of multiple affected tissues in a patient with McCune–Albright syndrome. Endocrine 31:2, 212-217
    CrossRef

97. 97

    Satoru Toyosawa, Michiko Yuki, Mitsunobu Kishino, Yuzo Ogawa, Takafumi Ueda, Shumei Murakami, Eiichi Konishi, Seiji Iida, Mikihiko Kogo, Toshihisa Komori, Yasuhiko Tomita. (2007) Ossifying fibroma vs fibrous dysplasia of the jaw: molecular and immunological characterization. Modern Pathology 20:3, 389-396
    CrossRef

98. 98

    Todd D. Nebesio, Erica A. Eugster. (2007) Current Concepts in Normal and Abnormal Puberty. Current Problems in Pediatric and Adolescent Health Care 37:2, 50-72
    CrossRef

99. 99

    Sigrun Egner-Höbarth, H. Welkerling, R. Windhager. (2007) Bisphosphonate in der Therapie der fibrösen Dysplasie. Der Orthopäde 36:2, 124-130
    CrossRef

100. 100

     Sang Hun Sung, Hyun Dae Yoon, Ho Sang Shon, Hong Tae Kim, Woo Young Choi, Chang Jin Seo, Joo Hyoung Lee. (2007) A Case of McCune-Albright Syndrome with Associated Multiple Endocrinopathies. The Korean Journal of Internal Medicine 22:1, 45
     CrossRef

101. 101

     Steven K. Feske, Thomas I. Cochrane. 2007. Degenerative and Compressive Structural Disorders. , 593-611.
     CrossRef

102. 102

     Andrea G Lania, Giovanna Mantovani, Anna Spada. (2006) Mechanisms of Disease: mutations of G proteins and G-protein-coupled receptors in endocrine diseases. Nature Clinical Practice Endocrinology &#38; Metabolism 2:12, 681-693
     CrossRef

103. 103

     Ori Shulman, Yael Laitman, Anita Vilan, Amos Leviav, Eitan Friedman. (2006) Response to van Steensel and Frank. Journal of Investigative Dermatology 126:12, 2729-2730
     CrossRef

104. 104

     Mehmet Tezer, Erden Erturer, Cagatay Ozturk, Mehmet Aydogan, Azmi Hamzaoglu. (2006) Symptomatic polyostotic fibrous dysplasia of the thoracic spine. Joint Bone Spine 73:6, 742-744
     CrossRef

105. 105

     M. Michael Cohen Jr.. (2006) The new bone biology: Pathologic, molecular, and clinical correlates. American Journal of Medical Genetics Part A 140A:23, 2646-2706
     CrossRef

106. 106

     Lee S Weinstein. (2006) Gsα Mutations in Fibrous Dysplasia and McCune-Albright Syndrome. Journal of Bone and Mineral Research 21:S2, P120-P124
     CrossRef

107. 107

     Roland D Chapurlat. (2006) Medical Therapy in Adults With Fibrous Dysplasia of Bone. Journal of Bone and Mineral Research 21:S2, P114-P119
     CrossRef

108. 108

     Francis H Glorieux, Frank Rauch. (2006) Medical Therapy of Children With Fibrous Dysplasia. Journal of Bone and Mineral Research 21:S2, P110-P113
     CrossRef

109. 109

     Mara Riminucci, Isabella Saggio, Pamela Gehron Robey, Paolo Bianco. (2006) Fibrous Dysplasia as a Stem Cell Disease. Journal of Bone and Mineral Research 21:S2, P125-P131
     CrossRef

110. 110

     Jérôme Bertherat, Lionel Groussin, Xavier Bertagna. (2006) Mechanisms of Disease: adrenocortical tumors—molecular advances and clinical perspectives. Nature Clinical Practice Endocrinology &#38; Metabolism 2:11, 632-641
     CrossRef

111. 111

     Dagmar Führer. (2006) Molecular determination of benign and malignant thyroid tumors. Expert Review of Endocrinology & Metabolism 1:6, 763-773
     CrossRef

112. 112

     R. Fölster-Holst, F. G. Riepe, W. Ahrens, M. Möller, J. Brasch, C.-J. Partsch, O. Hiort, W. G. Sippell. (2006) Calcinosis cutis bei hereditärer Albright-Osteodystrophie. Der Hautarzt 57:10, 893-897
     CrossRef

113. 113

     Adam M Sonabend, Wael Musleh, Maciej S Lesniak. (2006) Oncogenesis and mutagenesis of pituitary tumors. Expert Review of Anticancer Therapy 6:9s, S3-S14
     CrossRef

114. 114

     Nicolas Kalfa, Serge Lumbroso, Nathalie Boulle, Jacques Guiter, Laurent Soustelle, Pierre Costa, Heliette Chapuis, Pierre Baldet, Charles Sultan. (2006) Activating Mutations of Gsα in Kidney Cancer. The Journal of Urology 176:3, 891-895
     CrossRef

115. 115

     Laure Cazabat, Bruno Ragazzon, Lionel Groussin, Jérôme Bertherat. (2006) PRKAR1A mutations in primary pigmented nodular adrenocortical disease. Pituitary 9:3, 211-219
     CrossRef

116. 116

     Anelia Horvath, Sosipatros Boikos, Christoforos Giatzakis, Audrey Robinson-White, Lionel Groussin, Kurt J Griffin, Erica Stein, Elizabeth Levine, Georgia Delimpasi, Hui Pin Hsiao, Meg Keil, Sarah Heyerdahl, Ludmila Matyakhina, Rossella Libè, Amato Fratticci, Lawrence S Kirschner, Kevin Cramer, Rolf C Gaillard, Xavier Bertagna, J Aidan Carney, Jérôme Bertherat, Ioannis Bossis, Constantine A Stratakis. (2006) A genome-wide scan identifies mutations in the gene encoding phosphodiesterase 11A4 (PDE11A) in individuals with adrenocortical hyperplasia. Nature Genetics 38:7, 794-800
     CrossRef

117. 117

     Serge A. Jabbour, Batya B. Davidovici, Ronni Wolf. (2006) Rare syndromes. Clinics in Dermatology 24:4, 299-316
     CrossRef

118. 118

     Karine Bertaux, Odile Broux, Christophe Chauveau, Pierre Hardouin, Joseph Jeanfils, Jean-Christophe Devedjian. (2006) Runx2 regulates the expression of GNAS on SaOs-2 cells. Bone 38:6, 943-950
     CrossRef

119. 119

     John Newell-Price, Xavier Bertagna, Ashley B Grossman, Lynnette K Nieman. (2006) Cushing's syndrome. The Lancet 367:9522, 1605-1617
     CrossRef

120. 120

     Keisuke Kobayashi, Yasuo Imanishi, Hiroyuki Koshiyama, Akimitsu Miyauchi, Kenichi Wakasa, Takehisa Kawata, Hitoshi Goto, Hirotsugu Ohashi, Hajime M. Koyano, Ryuichi Mochizuki, Takami Miki, Masaaki Inaba, Yoshiki Nishizawa. (2006) Expression of FGF23 is correlated with serum phosphate level in isolated fibrous dysplasia. Life Sciences 78:20, 2295-2301
     CrossRef

121. 121

     Lee S Weinstein. 2006. Gain-of-function Mutations in Human Genetic Disorders. .
     CrossRef

122. 122

     Micheala A Aldred, Richard C Trembath. 2006. Activating and Inactivating Mutations in the GNAS1 Gene. .
     CrossRef

123. 123

     Judith G Hall. 2006. Mosaicism. .
     CrossRef

124. 124

     Harish S Hosalkar, Julieta E Barroeta, Jesse T Torbert, Richard D Lackman. (2006) 14-year-old Boy with Forearm Pain. Clinical Orthopaedics and Related Research 442:&amp;NA;, 276-282
     CrossRef

125. 125

     Laura S. Ooms, Matthew J. Koster, Joshua R. Mitchell, Robin Pals-Rylaarsdam. (2006) Identification of a second-site suppressor mutation of the GTPase defect associated with McCune – Albright syndrome: A model using the yeast heterotrimeric G protein, GPA1. Archives Of Physiology And Biochemistry 112:3, 166-173
     CrossRef

126. 126

     Takehisa Yamamoto. (2005) Clinical approach to clarifying the mechanism of abnormal bone metabolism in McCune–Albright syndrome. Journal of Bone and Mineral Metabolism 24:1, 7-10
     CrossRef

127. 127

     Carrie L. Heike, Michael L. Cunningham, Robert D. Steiner, Deborah Wenkert, Robin L. Hornung, Joseph S. Gruss, Francis H. Gannon, William H. McAlister, Steven Mumm, Michael P. Whyte. (2005) Skeletal changes in epidermal nevus syndrome: Does focal bone disease harbor clues concerning pathogenesis?. American Journal of Medical Genetics Part A 139A:2, 67-77
     CrossRef

128. 128

     E. F. McCarthy, M. Sundaram. (2005) Heterotopic ossification: a review. Skeletal Radiology 34:10, 609-619
     CrossRef

129. 129

     Marilyn H. Kelly, Beth Brillante, Harvey Kushner, Pamela Gehron Robey, Michael T. Collins. (2005) Physical function is impaired but quality of life preserved in patients with fibrous dysplasia of bone. Bone 37:3, 388-394
     CrossRef

130. 130

     Lee S. Weinstein, Min Chen, Akio Sakamoto, Jie Liu. 2005. Imprinting at the GNAS locus and endocrine disease. .
     CrossRef

131. 131

     Svetlana D. Pack, Liu-Xiu Qin, Evgenia Pak, Yun Wang, David O. Ault, Poonam Mannan, Sivakumar Jaikumar, Constantine A. Stratakis, Edward H. Oldfield, Zhengping Zhuang, Robert J. Weil. (2005) Common genetic changes in hereditary and sporadic pituitary adenomas detected by comparative genomic hybridization. Genes, Chromosomes and Cancer 43:1, 72-82
     CrossRef

132. 132

     Roland Chapurlat. (2005) Current pharmacological treatment for fibrous dysplasia and perspectives for the future. Joint Bone Spine 72:3, 196-198
     CrossRef

133. 133

     Ab Sadeghi-Nejad, Lawrence I. Karlin. (2005) A provisionally unique syndrome of macrosomia, bone overgrowth, macrocephaly, and tall stature. American Journal of Medical Genetics Part A 134A:4, 443-446
     CrossRef

134. 134

     Xijie Yu, Kenneth E. White. (2005) FGF23 and disorders of phosphate homeostasis. Cytokine & Growth Factor Reviews 16:2, 221-232
     CrossRef

135. 135

     Michael T Collins, Harvey Kushner, James C Reynolds, Caroline Chebli, Marilyn H Kelly, Anurag Gupta, Beth Brillante, Arabella I Leet, Mara Riminucci, Pamela Gehron Robey, Paolo Bianco, Shlomo Wientroub, Clara C Chen. (2005) An Instrument to Measure Skeletal Burden and Predict Functional Outcome in Fibrous Dysplasia of Bone. Journal of Bone and Mineral Research 20:2, 219-226
     CrossRef

136. 136

     Hisao Osada, Rie Sakamoto, Katsuyoshi Seki, Souei Sekiya. (2005) Accelerated Bone Turnover in Pregnant Women with McCune-Albright Syndrome. Gynecologic and Obstetric Investigation 60:2, 102-107
     CrossRef

137. 137

     André Lacroix, Valérie Baldacchino, Isabelle Bourdeau, Pavel Hamet, Johanne Tremblay. (2004) Cushing's syndrome variants secondary to aberrant hormone receptors. Trends in Endocrinology & Metabolism 15:8, 375-382
     CrossRef

138. 138

     Tara L. Huston, Rache M. Simmons. (2004) Ductal Carcinoma in Situ in a 27-Year-Old Woman with McCune-Albright Syndrome. The Breast Journal 10:5, 440-442
     CrossRef

139. 139

     S.R. Antonini, N. N’Diaye, V. Baldacchino, P. Hamet, J. Tremblay, A. Lacroix. (2004) Analysis of the putative regulatory region of the gastric inhibitory polypeptide receptor gene in food-dependent Cushing’s syndrome. The Journal of Steroid Biochemistry and Molecular Biology 91:3, 171-177
     CrossRef

140. 140

     R.D Chapurlat, P Hugueny, P.D Delmas, P.J Meunier. (2004) Treatment of fibrous dysplasia of bone with intravenous pamidronate: long-term effectiveness and evaluation of predictors of response to treatment. Bone 35:1, 235-242
     CrossRef

141. 141

     Michael Jude Welsch, Sarah L. Stein. (2004) A Syndrome of Hemimaxillary Enlargement, Asymmetry of the Face, Tooth Abnormalities, and Skin Findings (HATS). Pediatric Dermatology 21:4, 448-451
     CrossRef

142. 142

     Sotirios G. Stergiopoulos, Mones S. Abu-Asab, Maria Tsokos, Constantine A. Stratakis. (2004) Pituitary Pathology in Carney Complex Patients. Pituitary 7:2, 73-82
     CrossRef

143. 143

     Arabella I Leet, Caroline Chebli, Harvey Kushner, Clara C Chen, Marilyn H Kelly, Beth A Brillante, Pamela G Robey, Paolo Bianco, Shlomo Wientroub, Michael T Collins. (2004) Fracture Incidence in Polyostotic Fibrous Dysplasia and the McCune-Albright Syndrome. Journal of Bone and Mineral Research 19:4, 571-577
     CrossRef

144. 144

     Maurice A.M. van Steensel. (2004) Poland anomaly: Not unilateral or bilateral but mosaic. American Journal of Medical Genetics 125A:2, 211-212
     CrossRef

145. 145

     Allen M. Spiegel, Lee S. Weinstein. (2004) Inherited Diseases Involving G Proteins and G Protein–Coupled Receptors *. Annual Review of Medicine 55:1, 27-39
     CrossRef

146. 146

     Erica A Eugster. (2004) Aromatase Inhibitors in Precocious Puberty. Treatments in Endocrinology 3:3, 141-151
     CrossRef

147. 147

     N El-Rifai, S Lumbroso, M Cartigny, J Weill, C Sultan, F Gottrand. (2004) Infant cholestasis in McCune-Albright syndrome. Acta Paediatrica 93:1, 141-141
     CrossRef

148. 148

     Lin Lin, John C. Achermann. (2004) The Adrenal. Hormone Research 62:Suppl. 3, 22-29
     CrossRef

149. 149

     Shlomo Melmed. (2003) Mechanisms for pituitary tumorigenesis: the plastic pituitary. Journal of Clinical Investigation 112:11, 1603-1618
     CrossRef

150. 150

     Michael Natochin, Nikolai O. Artemyev. (2003) A point mutation uncouples transducin-α from the photoreceptor RGS and effector proteins. Journal of Neurochemistry 87:5, 1262-1271
     CrossRef

151. 151

     Muriel S Parisi, Beatriz Oliveri, Carlos A Mautalen. (2003) Effect of intravenous pamidronate on bone markers and local bone mineral density in fibrous dysplasia. Bone 33:4, 582-588
     CrossRef

152. 152

     M Riminucci, S.A Kuznetsov, N Cherman, A Corsi, P Bianco, P.Gehron Robey. (2003) Osteoclastogenesis in fibrous dysplasia of bone: in situ and in vitro analysis of IL-6 expression. Bone 33:3, 434-442
     CrossRef

153. 153

     Mara Riminucci, Michael T. Collins, Neal S. Fedarko, Natasha Cherman, Alessandro Corsi, Kenneth E. White, Steven Waguespack, Anurag Gupta, Tamara Hannon, Michael J. Econs, Paolo Bianco, Pamela Gehron Robey. (2003) FGF-23 in fibrous dysplasia of bone and its relationship to renal phosphate wasting. Journal of Clinical Investigation 112:5, 683-692
     CrossRef

154. 154

     Dian Donnai, Andrew P Read. (2003) How clinicians add to knowledge of development. The Lancet 362:9382, 477-484
     CrossRef

155. 155

     Alessandro Corsi, Michael T Collins, Mara Riminucci, Peter GT Howell, Alan Boyde, Pamela Gehron Robey, Paolo Bianco. (2003) Osteomalacic and Hyperparathyroid Changes in Fibrous Dysplasia Of Bone: Core Biopsy Studies and Clinical Correlations. Journal of Bone and Mineral Research 18:7, 1235-1246
     CrossRef

156. 156

     G Van Vliet. (2003) Development of the thyroid gland: lessons from congenitally hypothyroid mice and men. Clinical Genetics 63:6, 445-455
     CrossRef

157. 157

     C GRACIA, D DRISCOLL. (2003) Molecular basis of pubertal abnormalities. Obstetrics and Gynecology Clinics of North America 30:2, 261-277
     CrossRef

158. 158

     Ernesto Ippolito, Edward W. Bray, Alessandro Corsi, Fernando De Maio, Ulrich G. Exner, Pamela Gehron Robey, Franz Grill, Roberto Lala, Marco Massobrio, Oswald Pinggera, Mara Riminucci, Slawomir Snela, Christos Zambakidis, Paolo Bianco. (2003) Natural history and treatment of fibrous dysplasia of bone: a multicenter clinicopathologic study promoted by the European Pediatric Orthopaedic Society. Journal of Pediatric Orthopaedics B 12:3, 155-177
     CrossRef

159. 159

     Robert P. Erickson. (2003) Somatic gene mutation and human disease other than cancer. Mutation Research/Reviews in Mutation Research 543:2, 125-136
     CrossRef

160. 160

     Fabiano Sandrini, Constantine Stratakis. (2003) Clinical and molecular genetics of Carney complex. Molecular Genetics and Metabolism 78:2, 83-92
     CrossRef

161. 161

     Lindsay F. Fowles, Jennifer S. Bennetts, Jennifer L. Berkman, Elizabeth Williams, Peter Koopman, Rohan D. Teasdale, Carol Wicking. (2003) Genomic screen for genes involved in mammalian craniofacial development. genesis 35:2, 73-87
     CrossRef

162. 162

     Geoffrey B. Thompson, William F. Young. (2003) Adrenal incidentaloma. Current Opinion in Oncology 15:1, 84-90
     CrossRef

163. 163

     Anil BHANSALI, Bhawani S SHARMA, Polupoina SREENIVASULU, Paramjit SINGH, Rakesh K. VASHISTH, Radharaman J DASH. (2003) Acromegaly with Fibrous Dysplasia: McCune-Albright Syndrome - Clinical Studies in 3 Cases and Brief Review of Literature -. Endocrine Journal 50:6, 793-799
     CrossRef

164. 164

     Lee, Janice S., FitzGibbon, Edmond, Butman, John A., Dufresne, Craig R., Kushner, Harvey, Wientroub, Shlomo, Robey, Pamela G., Collins, Michael T., . (2002) Normal Vision despite Narrowing of the Optic Canal in Fibrous Dysplasia. New England Journal of Medicine 347:21, 1670-1676
     Full Text

165. 165

     Anna Spada, Andrea Lania. (2002) Growth factors and human pituitary adenomas. Molecular and Cellular Endocrinology 197:1-2, 63-68
     CrossRef

166. 166

     Hagop Youssoufian, Reed E. Pyeritz. (2002) Mechanisms and consequences of somatic mosaicism in humans. Nature Reviews Genetics 3:10, 748-758
     CrossRef

167. 167

     Caroline Chebli, Mark D. Murphey, Shlomo Wientroub, Michael T. Collins. (2002) Orthopedic Concerns in Children with Endocrine Disorders. Journal of Pediatric Orthopaedics B 11:3, 183-191
     CrossRef

168. 168

     Catherine E Keegan, Gary D Hammer. (2002) Recent insights into organogenesis of the adrenal cortex. Trends in Endocrinology & Metabolism 13:5, 200-208
     CrossRef

169. 169

     D. ROSENBERG, L. GROUSSIN, E. JULLIAN, K. PERLEMOINE, X. BERTAGNA, J. BERTHERAT. (2002) Role of the PKA-Regulated Transcription Factor CREB in Development and Tumorigenesis of Endocrine Tissues. Annals of the New York Academy of Sciences 968:1, 65-74
     CrossRef

170. 170

     ISABELLE BOURDEAU, CONSTANTINE A. STRATAKIS. (2002) Cyclic AMP-Dependent Signaling Aberrations in Macronodular Adrenal Disease. Annals of the New York Academy of Sciences 968:1, 240-255
     CrossRef

171. 171

     LEE S. WEINSTEIN, MIN CHEN, JIE LIU. (2002) Gs _α Mutations and Imprinting Defects in Human Disease. Annals of the New York Academy of Sciences 968:1, 173-197
     CrossRef

172. 172

     S. DREMIER, K. COULONVAL, S. PERPETE, F. VANDEPUT, N. FORTEMAISON, A. KEYMEULEN, S. DELEU, C. LEDENT, S. CLÉMENT, S. SCHURMANS, J. E. DUMONT, F. LAMY, P. P. ROGER, C. MAENHAUT. (2002) The Role of Cyclic AMP and Its Effect on Protein Kinase A in the Mitogenic Action of Thyrotropin on the Thyroid Cell. Annals of the New York Academy of Sciences 968:1, 106-121
     CrossRef

173. 173

     Isabelle Bourdeau, André Lacroix. (2002) Aberrant hormone receptors in adrenal Cushing's syndrome. Current Opinion in Endocrinology & Diabetes 9:3, 230-236
     CrossRef

174. 174

     Esther A. Gonzalez, Richard J. Lund, Kevin J. Martin, John E. McCartney, M. Mehrdad Tondravi, T. Kuber Sampath, Keith A. Hruska. (2002) Treatment of a murine model of high-turnover renal osteodystrophy by exogenous BMP-7. Kidney International 61:4, 1322-1331
     CrossRef

175. 175

     ROBERT WASHECKA, MARTIN I. DRESNER, STACEY A.A. HONDA. (2002) TESTICULAR TUMORS IN CARNEY’S COMPLEX. The Journal of Urology 167:3, 1299-1302
     CrossRef

176. 176

     ROBERT WASHECKA, MARTIN I. DRESNER, STACEY A. A. HONDA. (2002) TESTICULAR TUMORS IN CARNEY???S COMPLEX. The Journal of Urology1299-1302
     CrossRef

177. 177

     Toni R. Prezant, Shlomo Melmed. (2002) Molecular pathogenesis of pituitary disorders. Current Opinion in Endocrinology & Diabetes 9:1, 61-78
     CrossRef

178. 178

     Catherine Beauregard, Gabriel Dickstein, Andr?? Lacroix. (2002) Classic and Recent Etiologies of Cushing??s Syndrome. Treatments in Endocrinology 1:2, 79-94
     CrossRef

179. 179

     Gerhard Baumann. (2002) Genetic Characterization of Growth Hormone Deficiency and Resistance. American Journal of PharmacoGenomics 2:2, 93-111
     CrossRef

180. 180

     Jérôme Bertherat, Helen Mosnier-Pudar, Xavier Bertagna. (2002) Adrenal incidentalomas. Current Opinion in Oncology 14:1, 58-63
     CrossRef

181. 181

     Justin H. Davies, John S. Barton, John W. Gregory, Caroline Mills. (2001) Infantile McCune–Albright Syndrome. Pediatric Dermatology 18:6, 504-506
     CrossRef

182. 182

     B. Corvilain, J. Van Sande, J. E. Dumont, G. Vassart. (2001) Somatic and germline mutations of the TSH receptor and thyroid diseases. Clinical Endocrinology 55:2, 143-158
     CrossRef

183. 183

     Mary P. Gillam, Peter Kopp. (2001) Genetic defects in thyroid hormone synthesis. Current Opinion in Pediatrics 13:4, 364-372
     CrossRef

184. 184

     Magnus Kjellman, Catharina Larsson, Martin Bäckdahl. (2001) Genetic background of adrenocortical tumor development. World Journal of Surgery 25:7, 948-956
     CrossRef

185. 185

     John Sondek, David P. Siderovski. (2001) Gγ-like (ggl) domains: new frontiers in g-protein signaling and β-propeller scaffolding2. Biochemical Pharmacology 61:11, 1329-1337
     CrossRef

186. 186

     Muriel S. Parisi, Maria B. Oliveri, Claudia Gómez Acotto, Carlos A. Mautalen. (2001) Bone Mineral Density Response to Long-Term Bisphosphonate Therapy in Fibrous Dysplasia. Journal of Clinical Densitometry 4:2, 167-172
     CrossRef

187. 187

     Michael T. Collins, Caroline Chebli, Janet Jones, Harvey Kushner, Mark Consugar, Piero Rinaldo, Shlomo Wientroub, Paolo Bianco, Pamela Gehron Robey. (2001) Renal Phosphate Wasting in Fibrous Dysplasia of Bone Is Part of a Generalized Renal Tubular Dysfunction Similar to That Seen in Tumor-Induced Osteomalacia. Journal of Bone and Mineral Research 16:5, 806-813
     CrossRef

188. 188

     Bruce E. Hayward, Anne Barlier, Márta Korbonits, Ashley B. Grossman, Philippe Jacquet, Alain Enjalbert, David T. Bonthron. (2001) Imprinting of the Gsα gene GNAS1 in the pathogenesis of acromegaly. Journal of Clinical Investigation 107:6, R31-R36
     CrossRef

189. 189

     M. Michael Cohen. (2001) Fibrous dysplasia is a neoplasm. American Journal of Medical Genetics 98:4, 290-293
     CrossRef

190. 190

     Marie-Christine Lebrethon, Jean-Pierre Bourguignon. (2001) Central and peripheral isosexual precocious puberty. Current Opinion in Endocrinology & Diabetes 8:1, 17-22
     CrossRef

191. 191

     J. Gonzalez-Martin, S. Glover, S. Dixon, A. Fryer, H. Carty, C. Smith, S.B. Kaye, J. Verbov. (2000) Neurofibromatosis type 1 and McCune-Albright syndrome occurring in the same patient. British Journal of Dermatology 143:6, 1288-1291
     CrossRef

192. 192

     William D. Fraser, Cathy A. Walsh, Mark A. Birch, Brian Durham, Jane P. Dillon, David McCreavy, James A. Gallagher. (2000) Parathyroid hormone-related protein in the aetiology of fibrous dysplasia of bone in the McCune Albright syndrome. Clinical Endocrinology 53:5, 621-628
     CrossRef

193. 193

     Micheala A. Aldred, Richard C. Trembath. (2000) Activating and inactivating mutations in the human GNAS1 gene. Human Mutation 16:3, 183-189
     CrossRef

194. 194

     Akio Sakamoto, Yoshinao Oda, Yukihide Iwamoto, Masazumi Tsuneyoshi. (2000) A Comparative Study of Fibrous Dysplasia and Osteofibrous Dysplasia with Regard to GSα Mutation at the Arg201 Codon. The Journal of Molecular Diagnostics 2:2, 67-72
     CrossRef

195. 195

     Joe C. Watson, Constantine A. Stratakis, Peter K. Bryant-Greenwood, Christian A. Koch, Lawrence S. Kirschner, Tung Nguyen, J. Aidan Carney, Edward H. Oldfield. (2000) Neurosurgical implications of Carney complex. Journal of Neurosurgery 92:3, 413-418
     CrossRef

196. 196

     Christine Gicquel, Jerome Bertherat, Yves Le Bouc, Xavier Bertagna. (2000) PATHOGENESIS OF ADRENOCORTICAL INCIDENTALOMAS AND GENETIC SYNDROMES ASSOCIATED WITH ADRENOCORTICAL NEOPLASMS. Endocrinology & Metabolism Clinics of North America 29:1, 1-13
     CrossRef

197. 197

     Bernardo Leo Wajchenberg, Maria A. Albergaria Pereira, Berenice B. Medonca, Ana C. Latronico, Paulo Campos Carneiro, Venancio A. Ferreira Alves, Maria Claudia N. Zerbini, Bernardo Liberman, Gilberto Carlos Gomes, Marvin A. Kirschner. (2000) Adrenocortical carcinoma. Cancer 88:4, 711-736
     CrossRef

198. 198

     R Lala, P Matarazzo, S Bertelloni, F Buzi, F Rigon, C Sanctis. (2000) Pamidronate treatment of bone fibrous dysplasia in nine children with McCune-Albright syndrome. Acta Paediatrica 89:2, 188-193
     CrossRef

199. 199

     P. Bianco, M. Riminucci, A. Majolagbe, S. A. Kuznetsov, M. T. Collins, M. H. Mankani, A. Corsi, H. G. Bone, S. Wientroub, A. M. Spiegel, L. W. Fisher, P. Gehron ROBEY. (2000) Mutations of the GNAS1 Gene, Stromal Cell Dysfunction, and Osteomalacic Changes in Non-McCune-Albright Fibrous Dysplasia of Bone. Journal of Bone and Mineral Research 15:1, 120-128
     CrossRef

200. 200

     Brunner, Han G., Otten, Barto J., . (1999) Precocious Puberty in Boys. New England Journal of Medicine 341:23, 1763-1765
     Full Text

201. 201

     Liu, Guoquan, Duranteau, Lise, Carel, Jean-Claude, Monroe, Jason, Doyle, Daniel A., Shenker, Andrew, . (1999) Leydig-Cell Tumors Caused by an Activating Mutation of the Gene Encoding the Luteinizing Hormone Receptor. New England Journal of Medicine 341:23, 1731-1736
     Full Text

202. 202

     G.B. Downes, N. Gautam. (1999) The G Protein Subunit Gene Families. Genomics 62:3, 544-552
     CrossRef

203. 203

     M Levine. (1999) Clinical Implications of Genetic Defects in G Proteins Oncogenic Mutations in Gαs as the Molecular Basis for the McCune-Albright Syndrome. Archives of Medical Research 30:6, 522-531
     CrossRef

204. 204

     Mara Riminucci, Larry W. Fisher, Adesola Majolagbe, Alessandro Corsi, Roberto Lala, Carlo De Sanctis, Pamela Gehron Robey, Paolo Bianco. (1999) A Novel GNAS1 Mutation, R201G, in McCune-Albright Syndrome. Journal of Bone and Mineral Research 14:11, 1987-1989
     CrossRef

205. 205

     Peter M. Steijlen, Maurice A.M. van Steensel. (1999) Paradominant inheritance, a hypothesis explaining occasional familial occurrence of sporadic syndromes. American Journal of Medical Genetics 85:4, 359-360
     CrossRef

206. 206

     Robert P. Stanton, Grace M. Hobson, Ben E. Montgomery, Priscilla A. Moses, Susan M. Smith-Kirwin, Vicky L. Funanage. (1999) Glucocorticoids Decrease Interleukin-6 Levels and Induce Mineralization of Cultured Osteogenic Cells from Children with Fibrous Dysplasia. Journal of Bone and Mineral Research 14:7, 1104-1114
     CrossRef

207. 207

     S. Dutta, A. Bagga. (1999) McCune albright syndrome and hypophosphatemic rickets. The Indian Journal of Pediatrics 66:4, 628-631
     CrossRef

208. 208

     Jeremy M.W. Kirk, Caroline E. Brain, Dennis J. Carson, John C. Hyde, David B. Grant. (1999) Cushing’s syndrome caused by nodular adrenal hyperplasia in children with McCune-Albright syndrome. The Journal of Pediatrics 134:6, 789-792
     CrossRef

209. 209

     Juan J. Mezzadri, Claudia Gomez Acotto, Carlos Mautalen, Armando Basso. (1999) Surgical Treatment of Cervical Spine Fibrous Dysplasia: Technical Case Report and Review. Neurosurgery 44:6, 1342-1346
     CrossRef

210. 210

     Epstein, Franklin H., , Farfel, Zvi, Bourne, Henry R., Iiri, Taroh, . (1999) The Expanding Spectrum of G Protein Diseases. New England Journal of Medicine 340:13, 1012-1020
     Full Text

211. 211

     Justin P. Rubio, Elaine R. Levy, Carol Dobson-Stone, Anthony P. Monaco. (1999) Genomic Organization of the Human Gα14 and Gαq Genes and Mutation Analysis in Chorea–Acanthocytosis (CHAC). Genomics 57:1, 84-93
     CrossRef

212. 212

     Sigrid Tinschert, Helga Gerl, Andreas Gewies, Hans-Peter Jung, Peter Nrnberg. (1999) McCune-Albright syndrome: Clinical and molecular evidence of mosaicism in an unusual giant patient. American Journal of Medical Genetics 83:2, 100-108
     CrossRef

213. 213

     Epstein, Franklin H., , Adashi, Eli Y., Hennebold, Jon D., . (1999) Single-Gene Mutations Resulting in Reproductive Dysfunction in Women. New England Journal of Medicine 340:9, 709-718
     Full Text

214. 214

     Paolo Bianco, Pamela Gehron Robey. (1999) Diseases of Bone and the Stromal Cell Lineage. Journal of Bone and Mineral Research 14:3, 336-341
     CrossRef

215. 215

     Magnus Kjellman, Leyla Roshani, Martin Bäckdahl, Catharina Larsson. (1999) Molecular genetics of adrenal cortical tumors. Current Opinion in Endocrinology & Diabetes 6:1, 70
     CrossRef

216. 216

     Mara Riminucci, Bin Liu, Alessandro Corsi, Andrew Shenker, Allen M. Spiegel, Pamela Gehron Robey, Paolo Bianco. (1999) The histopathology of fibrous dysplasia of bone in patients with activating mutations of the Gs? gene: site-specific patterns and recurrent histological hallmarks. The Journal of Pathology 187:2, 249-258
     CrossRef

217. 217

     Peter P. Sayeski, M.Showkat Ali, Dan J. Semeniuk, Thanh N. Doan, Kenneth E. Bernstein. (1998) Angiotensin II signal transduction pathways. Regulatory Peptides 78:1-3, 19-29
     CrossRef

218. 218

     Y. de Keyzer, P. Rene, C. Beldjord, F. Lenne, X. Bertagna. (1998) Overexpression of vasopressin (V3) and corticotrophin-releasing hormone receptor genes in corticotroph tumours. Clinical Endocrinology 49:4, 475-482
     CrossRef

219. 219

     Anna Spada, Andrea Lania, Emilia Ballarè. (1998) G protein abnormalities in pituitary adenomas. Molecular and Cellular Endocrinology 142:1-2, 1-14
     CrossRef

220. 220

     Takashi Motomura, Soji Kasayama, Miki Takagi, Shogo Kurebayashi, Hideo Matsui, Takahisa Hirose, Yoshihiro Miyashita, Keik Yamauchi-Takihara, Takehisa Yamamoto, Shintaro Okada, Tadamitsu Kishimoto. (1998) Increased Interleukin-6 Production in Mouse Osteoblastic MC3T3-E1 Cells Expressing Activating Mutant of the Stimulatory G Protein. Journal of Bone and Mineral Research 13:7, 1084-1091
     CrossRef

221. 221

     Eulalia Baselga, Beth A. Drolet, Peter van Tuinen, Nancy B. Esterly, Rudolf Happle. (1998) Dyskeratosis congenita with linear areas of severe cutaneous involvement. American Journal of Medical Genetics 75:5, 492-496
     CrossRef

222. 222

     Frank Slack, Gary Ruvkun. (1997) TEMPORAL PATTERN FORMATION BY HETEROCHRONIC GENES. Annual Review of Genetics 31:1, 611-634
     CrossRef

223. 223

     J Masliah. (1997) Les protéines G hétérotrimériques: rôle dans la transduction normale et pathologique. La Revue de Médecine Interne 18:10, 816-820
     CrossRef

224. 224

     Roland D. Chapurlat, Pierre D. Delmas, Daniel Liens, Pierre J. Meunier. (1997) Long-Term Effects of Intravenous Pamidronate in Fibrous Dysplasia of Bone. Journal of Bone and Mineral Research 12:10, 1746-1752
     CrossRef

225. 225

     C Pienkowski, S Lumbroso, E Bieth, C Sultan, P Rochiccioli, M Tauber. (1997) Recurrent ovarian cyst and mutation of the Gsα gene in ovarian cyst fluid cells: what is the link with McCune-Albright syndrome?. Acta Paediatrica 86:9, 1019-1021
     CrossRef

226. 226

     KEIICHI OZONO. (1997) Recent advances in molecular analysis of skeletal dysplasia. Pediatrics International 39:4, 491-498
     CrossRef

227. 227

     G.A. Candeliere, P.J. Roughley, F.H. Glorieux. (1997) Polymerase chain reaction-based technique for the selective enrichment and analysis of mosaic arg201 mutations in Gαs from patients with fibrous dysplasia of bone. Bone 21:2, 201-206
     CrossRef

228. 228

     Robert S. Weinstein. (1997) Long-Term Aminobisphosphonate Treatment of Fibrous Dysplasia: Spectacular Increase in Bone Density. Journal of Bone and Mineral Research 12:8, 1314-1315
     CrossRef

229. 229

     HENRY R. KRANZLER, MARY E. McCAUL, JOEL GELERNTER, GARY S. WAND. (1997) No allelic association of an exon 13 polymorphism of the Gs? gene to alcohol and/or drug dependence. Addiction Biology 2:3, 309-316
     CrossRef

230. 230

     GEORGE MASTORAKOS, NICHOLAS S. MITSIADES, ANTHONY G. DOUFAS, DEMETRIOS A. KOUTRAS. (1997) Hyperthyroidism in McCune-Albright Syndrome with a Review of Thyroid Abnormalities Sixty Years After the First Report. Thyroid 7:3, 433-439
     CrossRef

231. 231

     C. DACOU-VOUTETAKIS. (1997) Female Sexual Precocity. Annals of the New York Academy of Sciences 816:1 Adolescent Gy, 209-218
     CrossRef

232. 232

     Prisca Colaco. (1997) Precocious puberty. The Indian Journal of Pediatrics 64:2, 165-175
     CrossRef

233. 233

     C LOOMIS. (1997) Linear hypopigmentation and hyperpigmentation, including mosaicism†. Seminars in Cutaneous Medicine and Surgery 16:1, 44-53
     CrossRef

234. 234

     David P. Cohen, Lawrence C. Layman. (1997) Relevance of Molecular Medicine to Clinical Obstetrics and Gynecology. Obstetrical & Gynecological Survey 52:1, 73-80
     CrossRef

235. 235

     Gianluca Scuderi, Carlo Nucci, Andrea Laghi, Andrea Corsi, Luciano Cerulli. (1996) A rare case of McCune-Albright syndrome associated with glaucoma retinal degeneration and arteriovenous malformations. Eye 10:6, 752-755
     CrossRef

236. 236

     Leona Cuttler. (1996) THE REGULATION OF GROWTH HORMONE SECRETION. Endocrinology & Metabolism Clinics of North America 25:3, 541-571
     CrossRef

237. 237

     Lionel Van Maldergem, Alain Bachy, David Feldman, Roger Bouillon, Johannes Maassen, Manfred Dreyer, Rodolfo Rey, Cecilia Holm, Yves Gillerot. (1996) Syndrome of lipoatrophic diabetes, vitamin D resistant rickets, and persistent Müllerian ducts in a Turkish boy born to consanguineous parents. American Journal of Medical Genetics 64:3, 506-513
     CrossRef

238. 238

     Henry G. Burger, Peter J. Fuller. (1996) The inhibin/activin family and ovarian cancer. Trends in Endocrinology & Metabolism 7:6, 197-202
     CrossRef

239. 239

     Matthew D. Ringel, William F. Schwindinger, Michael A. Levine. (1996) Clinical Implications of Genetic Defects in G Proteins: The Molecular Basis of McCune-Albright Syndrome and Albright Hereditary Osteodystrophy. Medicine 75:4, 171-184
     CrossRef

240. 240

     K. Kruse. (1996) Albright's hereditary osteodystrophy. European Journal of Pediatrics 155:5, 349-350
     CrossRef

241. 241

     Benjamin A. Alman, Debra A. Greel, Hubert J. Wolfe. (1996) Activating mutations of Gs protein in monostotic fibrous lesions of bone. Journal of Orthopaedic Research 14:2, 311-315
     CrossRef

242. 242

     G SUTHERS. (1996) Mutations, malformations and mortality. Journal of Paediatrics and Child Health 32:1, 10-15
     CrossRef

243. 243

     Graeme Milligan. (1996) Endocrine disorders associated with mutations in guanine nucleotide binding proteins. Baillière's Clinical Endocrinology and Metabolism 10:1, 177-187
     CrossRef

244. 244

     Kelly E. Mayo. (1996) A little lesson in growth regulation. Nature Genetics 12:1, 8-9
     CrossRef

245. 245

     Richard N. Clayton. (1996) Gonadotrophin receptors. Baillière's Clinical Endocrinology and Metabolism 10:1, 1-8
     CrossRef

246. 246

     Flier, Jeffrey S., Underhill, Lisa H., Brown, Edward M., Pollak, Martin, Seidman, Christine E., Seidman, J.G., Chou, Ya-Huei Wu, Riccardi, Daniela, Hebert, Steven C., . (1995) Calcium-Ion–Sensing Cell-Surface Receptors. New England Journal of Medicine 333:4, 234-240
     Full Text

247. 247

     N. Dzimiri, S. Hussain, A. Moorji, G. Prabhakar, S. Bakr, M. Kumar, AA Almotrefi, Z. Halees. (1995) Characterization of lymphocyte β-adrenoceptor activity and G _s -protein in patients with rheumatic heart valvular disease. Fundamental & Clinical Pharmacology 9:4, 372-380
     CrossRef

248. 248

     Candeliere, G. Antonio, Glorieux, Francis H., Prud'homme, JoséeSt.-Arnaud, René, . (1995) Increased Expression of the c-fos Proto-Oncogene in Bone from Patients with Fibrous Dysplasia. New England Journal of Medicine 332:23, 1546-1551
     Full Text

249. 249

     Robert A. Langer, Inkyoon Yook, Levon M. Capan. (1995) Anesthetic Considerations in McCune-Albright Syndrome. Anesthesia & Analgesia 80:6, 1236-1239
     CrossRef

250. 250

     Allen M. Spiegel. (1995) G protein gene knockout hits the gut. Nature Genetics 1:6, 522-524
     CrossRef

251. 251

     Primus E. Mullis, Johannes K. Wagner. (1995) Molecular biology and its application in paediatric endocrinology. European Journal of Pediatrics 154:S4, S30-S39
     CrossRef

252. 252

     Kaoru Kobayashi, Yoshiyuki Tanaka, Shingo Ishiguro, Tohru Mori, Chiaki Shigemasa, Yasuo Mitani. (1995) Family with nonmedullary thyroid neoplasms. Journal of Surgical Oncology 58:4, 274-277
     CrossRef

253. 253

     Kayoko Saito, Kiyoko Ikeya, Eri Kondo, Satoshi Komine, Maki Komine, Makiko Osawa, Eizou Aikawa, Yukio Fukuyama. (1995) Somatic mosaicism for a DMD gene deletion. American Journal of Medical Genetics 56:1, 80-86
     CrossRef

254. 254

     Stephanie A Orellana, William E Sweeney, Christopher D Neff, Ellis D Avner. (1995) Epidermal growth factor receptor expression is abnormal in murine polycystic kidney. Kidney International 47:2, 490-499
     CrossRef

255. 255

     Takatoshi Aoki, Hiromi Kouho, Masanori Hisaoka, Hiroshi Hashimoto, Hajime Nakata, Akinori Sakai. (1995) Intramuscular myxoma with fibrous dysplasia: A report of two cases with a review of the literature. Pathology International 45:2, 165-171
     CrossRef

256. 256

     Kopp, Peter, van Sande, Jacqueline, Parma, Jasmine, Duprez, Laurence, Gerber, Hans, Joss, Etienne, Jameson, J. Larry, Dumont, Jacques E., Vassart, Gilbert, . (1995) Congenital Hyperthyroidism Caused by a Mutation in the Thyrotropin-Receptor Gene. New England Journal of Medicine 332:3, 150-154
     Full Text

257. 257

     Marian E. Ludgate, Gilbert Vassart. (1995) The thyrotropin receptor as a model to illustrate receptor and receptor antibody diseases. Baillière's Clinical Endocrinology and Metabolism 9:1, 95-113
     CrossRef

258. 258

     A. Spada, M. Bassetti, P. Gil-del-Alamo, K. Saccomanno, A. Lania. (1995) Etiology of acromegaly: A molecular biological approach. Metabolism 44, 31-33
     CrossRef

259. 259

     Elizabeth A. Williamson, Mark Daniels, Sally Foster, William F. Kelly, Pat Kendall-Taylor, Philip E. Harris. (1994) Gsα and Gi2α mutations in clinically non-functioning pituitary tumours. Clinical Endocrinology 41:6, 815-820
     CrossRef

260. 260

     Fredrik Mertens, Auxilium Albert, Sverre Heim, Johan Lindholm, Otte Brosjö, Felix Mitelman, Nils Mandahl. (1994) Clonal structural chromosome aberrations in fibrous dysplasia. Genes, Chromosomes and Cancer 11:4, 271-272
     CrossRef

261. 261

     Bernards, Andre, Gusella, James F., . (1994) The Importance of Genetic Mosaicism in Human Disease. New England Journal of Medicine 331:21, 1447-1449
     Full Text

262. 262

     J. G. Hall, E. Lopez-Rangel. (1994) Non-traditional forms of inheritance in skeletal dysplasias. Pediatric Radiology 24:6, 407-409
     CrossRef

263. 263

     M. T. Tauber, A. G. Harris, P. Rochiccioli. (1994) Clinical use of the long acting somatostatin analogue octreotide in pediatrics. European Journal of Pediatrics 153:5, 304-310
     CrossRef

264. 264

     Shaun R. Coughlin. (1994) Expanding horizons for receptors coupled to G proteins: diversity and disease. Current Opinion in Cell Biology 6:2, 191-197
     CrossRef

265. 265

     Christine Gicquel, Marie Leblond-Francillard, Xavier Bertagna, Albert Louvel, Yves Chapuls, Jean-Pierre Luton, François Girard, Yves Bouc. (1994) Clonal analysis of human adrenocortical carcinomas and secreting adenomas. Clinical Endocrinology 40:4, 465-477
     CrossRef

266. 266

     E. RIEGER, R. KOFLER, M. BORKENSTEIN, J. SCHWINGSHANDL, H.P. SOYKR, H. KERL. (1994) Melanotic macules following Blaschko's lines in McCune-Albright syndrome. British Journal of Dermatology 130:2, 215-220
     CrossRef

267. 267

     Lise Wogensen, Ma Yan-Hui, Gerold M. Grodsky, R.Paul Robertson, Frank Burton, J.Gregor Sutcliffe, Nora Sarvetnick. (1993) Functional effects of transgenic expression of cholera toxin in pancreatic beta-cells. Molecular and Cellular Endocrinology 98:1, 33-42
     CrossRef

268. 268

     Chia-Ping Chang, Richard V. Pearse, Shawn O'Connell, Michael G. Rosenfeld. (1993) Identification of a seven transmembrane helix receptor for corticotropin-releasing factor and sauvagine in mammalian brain. Neuron 11:6, 1187-1195
     CrossRef

269. 269

     Arne Mørk. (1993) Actions of Lithium on the Cyclic AMP Signalling System in Various Regions of the Brain - Possible Relations to its Psychotropic Actions -: A Study on the Adenylate Cyclase in Rat Cerebral Cortex, Corpus Striatum and Hippocampus. Pharmacology & Toxicology 73:S3, 1-47
     CrossRef

270. 270

     Lee S. Weinstein, Andrew Shenker. (1993) G protein mutations in human disease. Clinical Biochemistry 26:5, 333-338
     CrossRef

271. 271

     William F. Schwindinger, Michael A. Levine. (1993) McCune-Albright syndrome. Trends in Endocrinology & Metabolism 4:7, 238-242
     CrossRef

272. 272

     P. E. F. Daubeney, K. Pal, R. Stanhope. (1993) Hypomelanosis of Ito and precocious puberty. European Journal of Pediatrics 152:9, 715-716
     CrossRef

273. 273

     Katsuhiko Yoshimoto, Hiroyuki Iwahana, Ayumi Fukuda, Toshiaki Sano, Mitsuo Itakura. (1993) Rare mutations of the Gs alpha subunit gene in human endocrine tumors. Mutation detection by polymerase chain reaction—primer-introduced restriction analysis. Cancer 72:4, 1386-1393
     CrossRef

274. 274

     A. Levy, S. L. Lightman. (1993) The pathogenesis of pituitary adenomas. Clinical Endocrinology 38:6, 559-570
     CrossRef

275. 275

     Cabot, Richard C.Scully, Robert E., Mark, Eugene J., McNeely, William F., McNeely, Betty U., Majzoub, Joseph A.Scully, Robert E.. (1993) Case 7-1993. New England Journal of Medicine 328:7, 496-502
     Full Text

276. 276

     Yoon Sang Cho-Chung, Timothy Clair. (1993) The regulatory subunit of cAMP-dependent protein kinase as a target for chemotherapy of cancer and other cellular dysfunctional-related diseases. Pharmacology & Therapeutics 60:2, 265-288
     CrossRef

277. 277

     Anna Spada, Lucia Vallar, Giovanni Faglia. (1992) G protein oncogenes in pituitary tumors. Trends in Endocrinology & Metabolism 3:10, 355-360
     CrossRef

278. 278

     Jeanne Zeller, Pierre Bougnères. (1992) Hypoglycemia in infants. Trends in Endocrinology & Metabolism 3:10, 366-370
     CrossRef

279. 279

     Lacroix, André, Bolté, Edouard, Tremblay, Johanne, Dupré, John, Poitras, Pierre, Fournier, Hélène, Garon, Jean, Garrel, Dominique, Bayard, Francis, Taillefer, Raymond, Flanagan, Richard J., Hamet, Pavel, . (1992) Gastric Inhibitory Polypeptide–Dependent Cortisol Hypersecretion — A New Cause of Cushing's Syndrome. New England Journal of Medicine 327:14, 974-980
     Full Text

280. 280

     Bertagna, Xavier, . (1992) New Causes of Cushing's Syndrome. New England Journal of Medicine 327:14, 1024-1025
     Full Text

281. 281

     STEPHEN E. GLICKMAN, LAURENCE G. FRANK, PAUL LICHT, TAMER YALCINKAYA, PENTTI K. SIITERI, JULIAN DAVIDSON. (1992) Sexual Differentiation of the Female Spotted Hyena.. Annals of the New York Academy of Sciences 662:1 Developmental, 135-159
     CrossRef

282. 282

     D. Kessel, C. M. Hall, D. G. Shaw. (1992) Two unusual cases of nephrocalcinosis in infancy. Pediatric Radiology 22:6, 470-471
     CrossRef

283. 283

     P. Beighton, A Giedion, R. Gorlin, J. Hall, B. Horton, K. Kozlowski, R. Lachman, L. O. Langer, P. Maroteaux, A Poznanski, D. L. Rimoin, D. Sillence, J. Spranger. (1992) International classification of osteochondrodysplasias. American Journal of Medical Genetics 44:2, 223-229
     CrossRef

284. 284

     Lee S. Weinstein, Pablo V. Gejman, Philippe de Mazancourt, Nadine American, Allen M. Spiegel. (1992) A heterozygous 4-bp deletion mutation in the Gsα gene (GNAS1) in a patient with albright hereditary osteodystrophy. Genomics 13:4, 1319-1321
     CrossRef

285. 285

     , P. Beighton, A. Giedion, R. Gorlin, J. Hall, B. Horton, K. Kozlowski, R. Lachman, L. O. Langer, P. Maroteaux, A. Poznanski, D. L. Rimoin, D. Sillence, J. Spranger. (1992) International classification of osteochondrodysplasias. European Journal of Pediatrics 151:6, 407-415
     CrossRef

286. 286

     Giovanni Faglia. (1992) Commentary. Clinical Endocrinology 36:6, 608-608
     CrossRef

287. 287

     Thomas M. Wilkie, Debra J. Gilbert, Anne S. Olsen, Xiao–Ning Chen, Thomas T. Amatruda, Julie R. Korenberg, Barbara J. Trask, Pieter de Jong, Randall R. Reed, Melvin I. Simon, Nancy A. Jenkins, Neal G. Copeland. (1992) Evolution of the mammalian G protein α subunit multigene family. Nature Genetics 1:2, 85-91
     CrossRef

288. 288

     Tiina P. Iismaa, John Shine. (1992) G protein-coupled receptors. Current Opinion in Cell Biology 4:2, 195-202
     CrossRef

289. 289

     Paolo Sassone-Corsi, Emiliana Borrelli. (1992) Mutations in signal transduction pathways and inherited diseases. Current Opinion in Genetics & Development 2:3, 455-458
     CrossRef

290. 290

     Levine, Michael A., . (1991) The McCune–Albright Syndrome. New England Journal of Medicine 325:24, 1738-1740
     Full Text

291. 291

     WilliamF Schwindinger, ClairA Francomano, MichaelA Levine, VictorA Mckusick. (1991) DNA light on the Tegernsee giant. The Lancet 338:8780, 1454-1455
     CrossRef