Original Article
Evidence of Limited Variability of Antigen Receptors on Intrathyroidal T Cells in Autoimmune Thyroid Disease
N Engl J Med 1991; 325:238-244July 25, 1991
- Abstract
- Abstract
Background.
Patients with autoimmune thyroid diseases, including Graves' disease and Hashimoto's disease, have marked lymphocytic infiltration in their thyroid glands. We examined the gene for the variable regions of the α-chain of the human T-cell receptor (the Vα gene) in intrathyroidal T cells to determine whether the infiltration is a secondary heterogeneous immune response or a more restricted, and therefore primary and presumably pathogenetic, reaction to thyroid autoantigens.
Methods.
We used the polymerase chain reaction to detect small numbers of T cells expressing the variable region of the Vα gene. Different oligonucleotides were used to amplify complementary DNA for the 18 known families of the Vα gene in intrathyroidal T cells from 9 patients with autoimmune thyroid disease. We compared the findings with the results in patients with nonautoimmune thyroid disease as well as those in normal subjects.
Results.
We found marked restriction in the expression of T-cell–receptor Vα genes by T cells from the thyroid tissue of patients with autoimmune thyroid disease. An average of only 5 of the 18 Vα genes were expressed in such samples, as compared with 17 Vα genes expressed in peripheral-blood T cells from the same patients. No such restriction was found in thyroid tissue from patients with nonautoimmune thyroid disease. The predominantly expressed Vα genes differed from patient to patient, however, with no clear association with the type of disease.
Conclusions.
Intrathyroidal T-cell accumulation in autoimmune thyroid disease is highly restricted and points to the primacy of T cells in causing thyroid disorders. These results present the possibility of using antibodies to the T-cell receptor for the specific inhibition of abnormal T-cell function in autoimmune thyroid disease. (N Engl J Med 1991; 325:238–44.)
Article Activity
- Article
INTRATHYROIDAL lymphocytic infiltrates have recently been characterized in human autoimmune thyroid disease.1 2 3 The majority of such cells are T lymphocytes, and there is extensive selection of particular T-cell subgroups, as determined by their surface markers (phenotype).3 We have found intrathyroidal accumulations of suppressor—cytotoxic T cells (CD8+) and suppressor—inducer T cells (CD45RA+), but it is unclear whether the cells migrated to the thyroid gland (secondary immune response) or resulted from the maturation of selected T cells in the thyroid tissue itself (primary immune response). It is well known, however, that T cells are important as a cause of thyroiditis in animals. For example, T cells that respond only to thyroglobulin can transfer thyroiditis to unaffected animals.4 , 5 Obviously, no such data are available for disease in humans, and evidence of the primacy of T cells must be obtained in a different manner.
Secondary immune responses are polyclonal in nature,6 whereas primary or pathogenetic immune reactions are likely to show restricted clonality. Evidence of T-cell restriction can be obtained in a variety of ways. In persons with autoimmune thyroid disease, the finding of T cells that recognized only part of a single molecule (the epitope) of the thyroid-stimulating hormone (TSH) receptor, thyroglobulin, or thyroid peroxidase (the major thyroid autoantigens) would be highly suggestive of a restricted response. Cloning of thyroid antigen—specific cells in humans has been difficult, however, and such clones have been short-lived.7 , 8 Another, more recent approach to the study of T-cell variability has been to examine the expression of the genes for the variable regions (V) of the α- and β-chains of the T-cell receptor.9 The T-cell–receptor genes undergo rearrangement only in T cells, just as immunoglobulin genes undergo rearrangement only in B cells. A single clone of T cells uses the same Vα and the same Vβ genes, and different clones of T cells recognizing the same epitope may use (i.e., rearrange) the same T-cell–receptor Vα genes. There are, however, many different T-cell–receptor V genes. The introduction of the polymerase chain reaction (PCR) to examine simultaneously many T-cell–receptor V genes has considerably simplified the screening of samples for gene rearrangements or their transcription of messenger RNA (mRNA). Such studies have now revealed restricted heterogeneity of the T-cell response in autoimmune disease in humans.9 10 11 We have therefore applied such analyses to intrathyroidal populations of T cells in humans and have found evidence of T-cell restriction. Our results add further evidence of the role of T cells in the pathogenesis of autoimmune thyroid diseases and offer potential for the development of alternative remedies for these common diseases.
Methods
Study Subjects and Surgical Material
We obtained samples of peripheral blood and thyroid tissue from euthyroid patients undergoing treatment for hyperthyroid Graves' disease (nine patients), autoimmune (Hashimoto's) thyroiditis (five patients), or the removal of solitary thyroid nodules (four patients, three with benign follicular adenomas and one with papillary carcinoma), and four normal subjects. The patients were chosen without other criteria for selection and on the basis of the availability of samples and informed consent. We also studied thyroid tissue from a fetus of 22 weeks' gestation, obtained with approval of our institutional review board and with informed consent. The patients were grouped on the basis of the availability of peripheral-blood mononuclear cells, intrathyroidal T-cell cultures, or surgically obtained thyroid tissue (Table 1Table 1
Characteristics of the Study Subjects.); only peripheral-blood mononuclear cells were obtained from the normal subjects.Graves' disease was defined by the presence of clinical and biochemical hyperthyroidism and either detectable serum TSH-receptor antibodies or a normal or increased 24-hour thyroidal uptake of radioiodine and a normal or enlarged thyroid gland, as determined with radioiodine scanning. TSH-receptor antibodies were measured by a radioreceptor assay (BRS Research, Cardiff, United Kingdom). All the patients with Graves' disease were being treated with an antithyroid drug (methimazole or propylthiouracil) at the time of sampling; those from whom surgical specimens were obtained had also been treated with inorganic iodide for two weeks before surgery. Autoimmune thyroiditis was defined by the presence of clinical and biochemical hypothyroidism and high serum titers of antibodies to thyroglobulin, thyroid peroxidase, or both, as measured by specific enzyme-linked immunosorbent assays12 and, when possible, confirmed histologically.
Preparation of T Lymphocytes
Peripheral-blood mononuclear cells were prepared from heparinized blood by Ficoll–Hypaque density-gradient centrifugation (Pharmacia, Piscataway, N.J.) and stored in liquid nitrogen, as described elsewhere.3 , 8 Intrathyroidal lymphocytes were obtained through the digestion by collagenase of thyroid tissue obtained at the time of surgery, followed by density-gradient centrifugation and storage in liquid nitrogen.3 , 8 Between 2×106 and 5×l06 cells were obtained from each sample. Unless stated otherwise, all lymphocytes were subsequently thawed (with 80 to 90 percent viability, as evidenced by trypan blue staining) and expanded in HEPES-buffered RPMI 1640 medium containing penicillin and streptomycin (GIBCO, Madison, Wis.) with 10 percent fetal-calf serum, 10 percent interleukin-2 (Biotest, Frankfurt, Germany), and 1 μg of phytohemagglutinin (PHA; Sigma, St. Louis) per milliliter for five to six days. Peripheral-blood mononuclear cells and intrathyroidal lymphocytes from five patients were cultured simultaneously under identical conditions.
T-Cell Surface Markers
Two-color—fluorescence phenotyping was performed with pairs of murine monoclonal antibodies directed against different defined determinants of human T cells and analyzed with a standardized laser-activated flow cytometer (Epics C, Coulter Electronics, Hialeah, Fla.). The monoclonal antibodies used allowed the determination of the presence of helper (CD4+), suppressor—cytotoxic (CD8+), and suppressor—inducer (CD45RA+) T cells, as well as the total number of T cells (CD2+) and B cells (CD29+).3
T-Cell–Receptor PCR
The entire amount of cellular RNA was extracted from the T-cell cultures and thyroid tissue with guanidinium thiocyanate and phenol (RNAzol B; Cinna/Bioteck Laboratories International, Friends-wood, Tex.) and stored in alcohol and saline. Samples of peripheral-blood mononuclear cells and intrathyroidal T cells from the same patients were prepared and analyzed together. Transcripts of complementary DNA (cDNA) were prepared with oligodeoxythymidine priming ( 1 μg per 20 μl) and avian reverse transcriptase (30 U per 20 μl) (Life Sciences, St. Petersburg, Fla.) in the presence of RNAsin (40 U per 20 μl) (Promega, Madison, Wis.).13 The cDNA, synthesized from the equivalent of 10 μg of total cellular RNA, was stored in 200 μl of sterile water.
For the amplification of the cDNA transcripts from the T-cell receptors, we synthesized 18 different Vα-gene 5′-oligonucleotide primers, using an Applied Biosystems DNA synthesizer (Table 2Table 2
Oligonucleotides Specific to the Vα-Gene Families and Predicted Sizes of the Resulting PCR Fragments.*), and paired them with a 3′-primer matched to the single constant region of the Vα gene (Cα) (Fig. 1Figure 1
Geography of Primers for the T-Cell–Receptor Vα Genes Used in the PCR and Hybridization Studies.). Such a system will generate a fragment of the correct size by PCR only if the appropriate Vα-gene family is represented in the cDNA in the sample. The purity of the oligonucleotides was tested by polyacrylamide-gel electrophoresis; none needed further purification. The predicted size of the amplified PCR fragments based on the 18 individual Vα-gene families is also shown in Table 2. For the PCR, 5 μl of denatured cDNA was amplified in a final volume of 25 μl with 1 U of Taq DNA polymerase, 0.3 μg of both primers, Taq polymerase buffer, and 1.5 mM of each nucleotide.9 , 13 We usually carried out 35 cycles of amplification, unless otherwise stated, using a stepwise program (95°C for 1 minute, 56°C for 2 minutes, and 72°C for 3 minutes) followed by a 10-minute extension at 72°C (Model PTC100 Programmable Thermal Controller, M.J. Research, Cambridge, Mass.). The negative controls included tubes without cDNA. The amplified products were subjected to electrophoresis on 1.5 percent agarose gels with ethidium bromide and visualized under ultraviolet light with a 123-bp (base-pair) molecular-size—control ladder (BRL, Gaithersburg, Md.).Hybridization of T-Cell–Receptor Vα Genes
In order to improve the sensitivity of fragment detection and examine the specificity of the PCR products, the agarose gels were blotted onto nitrocellulose membranes (Hybond-C, Amersham, Arlington Heights, Ill.), baked, and prehybridized.9 All the blots were subsequently hybridized with a [32P]gamma ATP—labeled oligonucleotide probe specific to the Cα region and internal to the predicted T-cell–receptor products (Table 2 and Fig. 1). Approximately 5×105 cpm of probe per milliliter was hybridized with each filter for 18 hours at 42°C in 6× SSC (1× SSC is 150 mM sodium chloride and 115 mM sodium citrate), 1 × Denhardt's solution, 0.05 percent sodium pyrophosphate, and transfer RNA. The filters were washed in 2× SSC with 0.05 percent sodium pyrophosphate at increasing temperatures (50°C, 60°C, and 70°C). After each washing, the blots were exposed to x-ray film with an intensifying screen at —80°C for 3 to 24 hours.
Quantitative Assessment of T-Cell–Receptor Vα Genes
To obtain quantitative data on the proportions of T-cell–receptor Vα genes expressed, we examined the autoradiographs by computerized quantitative densitometry (Model 300A, Molecular Dynamics, Sunnyvale, Calif.), using a mathematical procedure for the derivation of area volume from autoradiographic scanning (Version 2.0, Image Quant, Molecular Dynamics). Each T-cell–receptor Vα gene was then expressed as a percentage of all the Vα genes detected on that scan.
Quality Control
The high level of sensitivity of the PCR technique may lead to false positive results and differing fragment sizes when immature or aberrant mRNAs are analyzed. The hybridization technique described above allowed only highly specific assessments of gene expression, since it was performed under very stringent conditions and the fragments measured were of a defined and predicted size. In addition, all cDNA preparations used were first tested by PCR with a different pair of primers specific to the Cα region to ensure the presence of T-cell–receptor cDNA with a predicted transcript size of 312 bp (5′CAGAAGCCTGACCCTGCCGTGTAC and 3′CAGGTTTTGAAAGTTTAGGTTCGTATCTGT). Since the PCRs were all performed under the same conditions, it was also possible that not every amplifying oligomer was annealing to cDNA at its optimal conditions. Hence, we included simultaneous studies of T-cell receptors from peripheral-blood mononuclear cells as controls to demonstrate the appropriateness of the experimental conditions. Studies that included PCRs without cDNA or with cDNA that was not relevant to this investigation yielded no transcripts.
Statistical Analysis
When appropriate, the results were compared by Student's paired or unpaired t-tests.
Results
Analysis of T-Cell Surface Markers
We previously published a detailed evaluation of the phenotypes of both peripheral-blood and intrathyroidal T cells from patients with autoimmune thyroid disease.3 The results in the small number of samples in this study were similar. From 40 to 80 percent of the intrathyroidal lymphocytes were of T-cell origin at the time the cultures were initiated. Analyses of subgroups according to phenotype demonstrated a higher ratio of suppressor—cytotoxic (CD8+) cells to helper (CD4+) cells in intrathyroidal lymphocytes than in peripheral-blood mononuclear cells in the patients with Graves' disease (Table 1). In addition, and as demonstrated elsewhere,3 the proportion of suppressor—inducer (CD45RA+) T cells was higher in thyroid tissue than in peripheral blood in these patients (Table 1).
Vα-Gene Expression by Peripheral-Blood T Cells from Normal Subjects and Patients with Autoimmune Thyroid Disease
RNA obtained from the cell and tissue samples was used to prepare a cDNA transcript as a template for the PCR. The peripheral-blood mononuclear cells from the normal subjects actively expressed mRNA from the majority of the T-cell–receptor Vα-gene families, as judged by the production of fragments from the cDNA (Fig. 2Figure 2
Quantitative Distribution of T-Cell–Receptor Vα-Gene Expression in T Cells from the Thyroid Tissue of a Patient with Autoimmune Thyroiditis. and Tables 1 and 3Table 3
Contribution of Individual Vα-Gene Families to Vα-Gene Expression in Peripheral-Blood Mononuclear Cells from Normal Subjects and Patients with Autoimmune Thyroid Disease.*). Overall, of the 18 different Vα-gene families, we detected an average (±SE) of 17.3±0.3 in these normal subjects. The size of the PCR transcripts of the Vα genes expressed by the T-cell receptors was usually similar to that predicted, varying from 265 to 456 bp (Table 2). Larger or smaller fragments were also found in some samples but were not counted; they were thought to be due to incompletely spliced mRNA or to a nonfunctional, partly deleted mRNA transcript. Each detectable Vα gene accounted for 2.1 to 12.7 percent of the total expression of Vα genes in the circulating T cells when data from individual patients were analyzed. The 18 families of Vα genes were not equally represented, and not all the Vα genes were detectable in all subjects, indicating that some T-cell–receptor genes were not being expressed. Stimulation of the peripheral-blood mononuclear cells from the four normal subjects by mitogen (PHA) for five days appeared to increase the number of T cells in the cultures but did not change the overall pattern of Vα-gene expression in these subjects (mean number of Vα genes detected after stimulation, 15.3±0.9) (Table 3).As in the normal subjects, the peripheral-blood mononuclear cells of the patients with autoimmune thyroid disease did not express all Vα-gene families. The number of Vα-gene transcripts expressed in these 10 patients ranged from 13 to 17 (mean, 14.8±0.8) (Table 1). The results were similar in the patients with Graves' disease or Hashimoto's disease. The percentages of particular Vα genes in relation to the total number of Vα-gene transcripts, as measured by densitometry, varied from 1.2 to 16.2 percent in the peripheral-blood mononuclear cells from these patients when analyzed individually and did not differ significantly from those in the normal subjects (Table 3).
T-Cell–Receptor Vα-Gene Expression in Intrathyroidal T Cells
Initially, we examined Vα-gene expression in freshly prepared intrathyroidal T cells from a patient with Graves' disease and compared the results with those obtained after culturing the patient's T cells for five days with mitogen (Fig. 2). In contrast to the results obtained with peripheral-blood mononuclear cells, the Vα-gene expression in the intrathyroidal T cells was restricted in both fresh cells and cells cultured with PHA. In this patient, the proportion of a single gene (Vα 15) was particularly high in fresh cells, and the number of detectable Vα genes increased after mitogen stimulation. Thus, the number of T-cell–receptor Vα genes expressed was not decreased by in vitro culture of the T cells.
We then studied intrathyroidal T cells from four additional patients. We obtained peripheral-blood mononuclear cells from each of these patients at the time of surgery and determined the expression of the T-cell–receptor Vα genes in both types of cells simultaneously. Although many Vα genes were expressed in peripheral-blood T cells from these four patients, only a few were expressed in each of the intrathyroidal T-cell preparations, as shown in Figure 3Figure 3
Qualitative Examples of T-Cell–Receptor Vα-Gene Expression in a Patient with Graves' Disease.. The number of Vα genes expressed in the intrathyroidal-lymphocyte preparations from all five patients ranged from 2 to 6, and the mean was 4.6±1.0, as compared with 14.8±0.9 in the peripheral-blood mononuclear cells from the same patients (Table 1). Among the two to six Vα genes detectable in these intrathyroidal-lymphocyte preparations, one often predominated (Fig. 4Figure 4
Quantitative Comparison of Vα-Gene Expression in Peripheral-Blood Mononuclear Cells and Intrathyroidal T Cells from Patients with Autoimmune Thyroid Disease.). However, the predominant Vα genes expressed varied from patient to patient. Quantitative densitometric analysis showed that an individual Vα gene contributed up to 75 percent of the T-cell–receptor transcripts in the intrathyroidal T cells, and the average was 25.0±5.7 percent in the five patients (Fig. 2 and 4).Detection of Vα-Gene mRNA in Thyroid Tissue
Because of the difficulty of obtaining fresh, normal thyroid tissue from adults, we studied fetal thyroid tissue. This tissue was histologically normal and had no detectable lymphocytic infiltrate. PCR analysis showed many T-cell–receptor Vα-gene transcripts from the cDNA derived from this tissue; 15 rearranged and actively transcribing T-cell–receptor Vα genes were detectable, presumably because of the blood in the tissue. The proportion of each Vα gene varied from 2.1 to 12.4 percent. We also studied cDNA transcripts prepared from three follicular adenomas of the thyroid and one papillary thyroid carcinoma (Table 1). There was similar widespread T-cell–receptor Vα-gene expression in each of these tissues.
To compare the degree of aggregation of T cells in the thyroid-tissue specimens, we counted the number of active Vα-gene transcripts. We did so by amplifying only the Cα-gene region present in the different cDNA preparations. Each of the thyroid-tissue preparations from four patients with autoimmune thyroid disease contained more Cα-gene transcripts than the fetal thyroid tissue, as assessed by the quantity of the fragments from the Cα region amplified by PCR (data not shown), an indication that they contained more T cells than the fetal thyroid tissue. The whole-thyroid-tissue cDNA preparations from these four patients also contained, in different degrees, T-cell–receptor Vα-gene transcripts of limited heterogeneity (Table 1 and Fig. 5Figure 5
Southern Blotting of T-Cell–Receptor Vα-Gene Expression in Cellular mRNA from Whole-Thyroid Tissue of Two Patients with Autoimmune Thyroiditis.). The intrathyroidal T cells in these four tissue specimens expressed from 4 to 9 Vα genes (mean, 5.3±1.3). The contribution of each actively transcribing Vα gene to the total activity, as assessed by densitometry, was 19.0±2.0 percent. Again, there was no predominant T-cell–receptor Vα-gene family or shared pattern of Vα-gene expression in the different tissues. However, such data were again supportive of restricted T-cell accumulation of Vα genes within the diseased thyroid glands.Discussion
We found that in patients with Graves' disease or autoimmune thyroiditis, the intrathyroidal T-cell population was restricted at the level of T-cell–receptor Vα-gene expression. These results suggest that T cells are likely to be the most important part of the initial immune response to thyroid antigen in such patients. Therefore, the evidence of the initiation of thyroiditis by the transfer of T cells specific for thyroid antigen in animals is likely to be applicable to disease in humans.4 , 5
There is a variety of ways to examine the T cells in a lymphocytic infiltrate. In humans with autoimmune thyroid disease, the analysis of intrathyroidal T-cell surface markers provided the first indication of selective T-cell accumulation within the diseased gland.1 2 3 Intrathyroidal T-cell clones have also been described that are specific for autologous thyroid cells,7 , 8 thyroglobulin,8 and thyroid peroxidase (microsomal antigen),14 although not as yet for the TSH receptor, thought to be the primary antigen of Graves' disease. Although most such clones have been of the helper-T-cell (CD4+) phenotype, we described a cytotoxic-T-cell (CD8+) clone that lysed thyroid cells from a patient with autoimmune thyroiditis.15 Hence, both the accumulation and the specificity of intrathyroidal T cells in humans have been amply demonstrated.
Given the difficulty of long-term culture of human T cells, it has not been possible to study the detailed interaction of T-cell clones with individual parts (epitopes) of the target thyroid antigens. This would be helpful, because each of the thyroid antigens, such as thyroglobulin and thyroid peroxidase, has multiple antigenic sites. Nevertheless, even at the level of such specificity, T cells in animals may still express different T-cell–receptor Vα genes yet recognize the same antigen and even the same epitope.16 Therefore, the most direct way to examine the question of T-cell restriction may be at the molecular level. Examination of restriction-fragmentlength polymorphisms of the T-cell receptor has indicated restricted T-cell expression in autoimmune disease,17 but this is a tedious and indirect approach and may not indicate actual T-cell–receptor Vα-gene expression. The technique we used is much simpler, because the presence of many different mRNAs generated by each of the rearranged T-cell–receptor genes can be studied simultaneously.
In addition to the primary role of T cells in the thyroid autoimmune response, there are other possible explanations for the restriction in T-cell–receptor Vα-gene expression. Antithyroid drugs (methimazole and propylthiouracil) have immunosuppressive actions at the concentrations found in thyroid tissue from patients with Graves' disease who are being treated with these agents,18 , 19 although such actions should not be selective for the Vα gene. However, we detected T-cell Vα-gene restriction in patients with autoimmune thyroiditis as well as in those with Graves' disease, and the patients with autoimmune thyroiditis had not received any antithyroid drug. Furthermore, the intrathyroidal lymphocytes were cultured for five to six days in vitro before study, which should have minimized any effects of antithyroid drug therapy. Our direct comparison of T-cell Vα-gene expression with and without such culture showed little difference. If anything, culture with mitogen reduced rather than enhanced the degree of restriction. Lack of sensitivity of the PCR technique does not explain the restriction, since studies with peripheral-blood mononuclear cells showed that all V genes were capable of being amplified. Even if expression of some Vα genes was not detected because of insufficient sensitivity in the PCR technique, there must still be an explanation for the presence in the thyroid of so few T cells containing the undetected V genes. However, not all T cells that accumulate at the site of antigenic stimulation (in this case the thyroid gland) are likely to be reactive to antigen. Indeed, on the basis of cloning data, very few appear to be.8 , 15 It is therefore possible that certain T-cell–receptor Vα genes are associated with the act of homing to the thyroid or with endothelial passage into the thyroid. Our finding of an inconsistent restriction in the T-cell–receptor Vα genes, with the T cells from each patient having a different pattern of Vα expression, also suggests a relation to the person's HLA type, as well as to the particular thyroid antigens.
The PCR technique described here has been used to study T-cell–receptor Vα-gene expression in clones of T cells from humans.9 Theoretically, such experiments require the detection and isolation of only a few antigen-specific T cells. Such studies should therefore allow us to examine further the specificity of the human immune response to thyroid antigens with an analysis of T-cell clones reactive to specific thyroid antigens.20 Since it is possible to suppress T-cell—mediated responses with a variety of approaches, particularly the use of T-cell vaccination21 and monoclonal antibodies to specific T-cell–receptor families,22 the identification of each patient's intrathyroidal Vα-gene expression (perhaps by aspiration biopsy of the thyroid) would allow the use of specific immunization regimens. Although the treatment of patients with autoimmune thyroid disease is often simple, such an approach might offer a major therapeutic advance in patients with Graves' ophthalmopathy.
Supported in part by grants (DK28243 and DK35764) from the National Institute of Diabetes and Digestive and Kidney Diseases to Dr. Davies and from the Charles H. Revson Foundation to Dr. Martin. Dr. Ben-Nun is a recipient of the Cancer Research Institute/Albert and Cherry Krassner Investigator Award.
We are indebted to Drs. Eugene Friedman and Arthur Schwartz for providing access to surgical material, and to Dean Nathan Kase and Dr. Richard Gorlin for providing the financial support that has made this interlaboratory study possible.
Source Information
From the Department of Medicine, Mount Sinai School of Medicine, New York (T.F.D., A.M., E.S.C., P.G.), and the Department of Cell Biology, Weizmann Institute of Science, Rehovot, Israel (L.C., A.B.-N.). Address reprint requests to Dr. Davies at Box 1055, Mount Sinai Medical Center, 1 Gustave Levy Pl., New York, NY 10029.
- References
References
1
Jansson
CrossRef | Web of Science | Medline2
Margolick
CrossRef | Web of Science | Medline3
Martin
CrossRef | Web of Science | Medline4
Maron
Web of Science | Medline5
Romball
Web of Science | Medline6
Goodman MG, Weigle WO. Polyclonal activation of B lymphocytes and its role in self discrimination. In: Inglis JR, ed. B lymphocytes today. Amsterdam: Elsevier, 1982:63–9.
7
Londei
CrossRef | Web of Science | Medline8
Mackenzie
CrossRef | Web of Science | Medline9
Ben-Nun
CrossRef | Web of Science | Medline10
Oksenberg
CrossRef | Web of Science | Medline11
Wucherpfennig
CrossRef | Web of Science | Medline12
Roman
Web of Science | Medline13
Frohman
CrossRef | Web of Science | Medline14
Fisfalen
CrossRef | Web of Science | Medline15
Mackenzie
Web of Science | Medline16
Spinella
Web of Science | Medline17
Moebius
CrossRef | Web of Science | Medline18
Weiss
CrossRef | Web of Science | Medline19
Volpe
CrossRef | Web of Science | Medline20
Kimura
CrossRef | Medline21
Ben-Nun
CrossRef | Web of Science | Medline22
Acha-Orbea
CrossRef | Web of Science | Medline
- Citing Articles (83)
Citing Articles
1
M. Okajima, T. Wada, M. Nishida, T. Yokoyama, Y. Nakayama, Y. Hashida, F. Shibata, Y. Tone, A. Ishizaki, M. Shimizu, T. Saito, K. Ohta, T. Toma, A. Yachie. (2009) Analysis of T cell receptor Vβ diversity in peripheral CD4 + and CD8 + T lymphocytes in patients with autoimmune thyroid diseases. Clinical & Experimental Immunology 155:2, 166-172
CrossRef2
Heung Yong Jin, Seon Mee Kang, So Young Kim, Ji Hyun Park, Hong Sun Baek, Tae Sun Park. (2009) A Case of Graves' Disease Combined with Hantaan Virus Infection. Journal of Korean Medical Science 24:1, 158
CrossRef3
Takao Ando, Rauf Latif, TerryF. Davies. (2005) Thyrotropin receptor antibodies: new insights into their actions and clinical relevance. Best Practice & Research Clinical Endocrinology & Metabolism 19:1, 33-52
CrossRef4
A. P. Weetman. (2004) Cellular immune responses in autoimmune thyroid disease. Clinical Endocrinology 61:4, 405-413
CrossRef5
A Gasbarri, S Sciacchitano, A Marasco, M Papotti, A Di Napoli, A Marzullo, P Yushkov, L Ruco, A Bartolazzi. (2004) Detection and molecular characterisation of thyroid cancer precursor lesions in a specific subset of Hashimoto's thyroiditis. British Journal of Cancer
CrossRef6
Eric L. Greidinger, Tal Gazitt, Kimberly F. Jaimes, Robert W. Hoffman. (2004) Human T cell clones specific for heterogeneous nuclear ribonucleoprotein A2 autoantigen from connective tissue disease patients assist in autoantibody production. Arthritis & Rheumatism 50:7, 2216-2222
CrossRef7
S Pirovano, E Mazzolari, S Pasic, A Albertini, Luigi D Notarangelo, L Imberti. (2003) Impaired thymic output and restricted T-cell repertoire in two infants with immunodeficiency and early-onset generalized dermatitis. Immunology Letters 86:1, 93-97
CrossRef8
Y. Hashimoto, N. Matsuoka, A. Kawakami, M. Tsuboi, T. Nakashima, K. Eguchi, T. Tomioka, T. Kanematsu. (2001) Novel immunosuppressive effect of FK506 by augmentation of T cell apoptosis. Clinical and Experimental Immunology 125:1, 19-24
CrossRef9
B. L. Talken, C. W. Bailey, S. L. Reardon, C. W. Caldwell, R. W. Hoffman. (2001) Structural Analysis of TCRalpha and beta Chains from Human T-Cell Clones Specific for Small Nuclear Ribonucleoprotein Polypeptides Sm-D, Sm-B and U1-70 kDa: TCR Complementarity Determining Region 3 Usage Appears Highly Conserved. Scandinavian Journal of Immunology 54:1-2, 204-210
CrossRef10
Ki-Hoan Nam, Zsolt Illés, Keiji Terao, Yasuhiro Yoshikawa, Takashi Yamamura. (2000) Characterization of expanded T cell clones in healthy macaques: ontogeny, distribution and stability. Developmental & Comparative Immunology 24:6-7, 703-715
CrossRef11
Hiroyuki Inada, Kaname Yoshizawa, Masao Ota, Yoshihiko Katsuyama, Tetsuya Ichijo, Takeji Umemura, Eiji Tanaka, Kendo Kiyosawa. (2000) T cell repertoire in the liver of patients with primary biliary cirrhosis. Human Immunology 61:7, 675-683
CrossRef12
T. Umemura, K. Yoshizawa, M. Ota, Y. Katsuyama, H. Inada, E. Tanaka, K. Kiyosawa. (2000) Analysis of T cell repertoire in the liver of patients with chronic hepatitis C. Clinical and Experimental Immunology 121:1, 120-126
CrossRef13
Peter N. Graves, Terry F. Davies. (2000) NEW INSIGHTS INTO THE THYROID-STIMULATING HORMONE RECEPTOR. Endocrinology & Metabolism Clinics of North America 29:2, 267-286
CrossRef14
Sandra M. McLachlan, Basil Rapoport. (2000) Autoimmune Response to the Thyroid in Humans: Thyroid Peroxidase-The Common Autoantigenic Denominator. International Reviews of Immunology 19:6, 587-618
CrossRef15
Leonard D. Kohn, Giorgio Napolitano, Dinah S. Singer, Monica Molteni, Raffaella Scorza, Naoki Shimojo, Yoichi Kohno, Edna Mozes, Minoru Nakazato, Luca Ulianich, Hyun-Kyung Chung, Hana Matoba, Bertrand Saunier, Koichi Suzuki, Frank Schuppert, Motoyasu Saji. (2000) Graves’ Disease: A Host Defense Mechanism Gone Awry. International Reviews of Immunology 19:6, 633-664
CrossRef16
Atsushi Yoshitomi, Atsuhiko Sato, Hiroshi Hayakawa, Kingo Chida, Mikio Toyoshima, Masato Uchijima, Atsushi Yoshida, Yukio Koide. (1999) Biased T cell receptor Vbeta gene expression in bronchoalveolar lavage fluid from Japanese patients with sarcoidosis. Respirology 4:4, 339-347
CrossRef17
Federica M. Murelii-Berg, Robert I. Lechler. (1999) Antigen presentation by parenchymal cells: a route to peripheral tolerance?. Immunological Reviews 172:1, 297-314
CrossRef18
Kaname Yoshizawa, Masao Ota, Yoshihiko Katsuyama, Tetsuya Ichijo, Hiroyuki Inada, Takeji Umemura, Eiji Tanaka, Kendo Kiyosawa. (1999) T cell repertoire in the liver of patients with autoimmune hepatitis. Human Immunology 60:9, 806-815
CrossRef19
TERRY F. DAVIES. (1999) The Thyroid Immunology of the Postpartum Period. Thyroid 9:7, 675-684
CrossRef20
Livio Trentin, Luisa Imberti, Renato Zambello, Alessandra Sottini, Roberto Raimondi, Monica Facco, Sefania Cazzavillan, Emanuela Bonoldi, Simona Signorini, Andrea Bacigalupo, Gianpietro Semenzato, Francesco Rodeghiero, Daniele Primi. (1999) Detection of identical T-cell clonotype expansions in both the donor and recipient after allogeneic bone marrow transplantation. British Journal of Haematology 106:1, 119-127
CrossRef21
Rajiv Khanna, Sharon L. Silins, Zhiping Weng, David Gatchell, Scott R. Burrows, Leanne Cooper. (1999) Cytotoxic T cell recognition of allelic variants of HLA B35 bound to an Epstein-Barr virus epitope: influence of peptide conformation and TCR-peptide interaction. European Journal of Immunology 29:5, 1587-1597
CrossRef22
Beth L Talken, David R Lee, Charles W Caldwell, Thomas P Quinn, Kim R Schäfermeyer, Robert W Hoffman. (1999) Analysis of T cell receptors specific for U1-70kD small nuclear ribonucleoprotein autoantigen: the alpha chain complementarity determining region three is highly conserved among connective tissue disease patients. Human Immunology 60:3, 200-208
CrossRef23
Andreas Martin, Giuseppe Barbesino, Terry F. Davies. (1999) T-Cell Receptors and Autoimmune Thyroid Disease—Signposts for T-Cell-Antigen Driven Diseases. International Reviews of Immunology 18:1-2, 111-140
CrossRef24
Motoko Kotani, Yoh-ichi Tagawa, Yoichiro Iwakura. (1999) Involvement of autoimmunity against type II collagen in the development of arthritis in mice transgenic for the human T cell leukemia virus type Itax gene. European Journal of Immunology 29:1, 54-64
CrossRef25
P. Cacoub, L. Musset, P. Hausfater, P. Ghillani, F. L. Fabiani, F. Charlotte, E. Angevin, P. Opolon, T. Poynard, J.-C. Piette, B. Autran, . (1998) No evidence for abnormal immune activation in peripheral blood T cells in patients with hepatitis C virus (HCV) infection with or without cryoglobulinaemia. Clinical and Experimental Immunology 113:1, 48-54
CrossRef26
ARMIN E. HEUFELDER. (1998) T-Cell Restriction in Thyroid Eye Disease. Thyroid 8:5, 419-422
CrossRef27
George Philippou, Alan M. McGregor. (1998) The aetiology of Graves' disease: what is the genetic contribution?. Clinical Endocrinology 48:4, 393-395
CrossRef28
Claudia Barth, Jozef Stachowski, Albrecht Menges, Petra Lammerding, Conrad A. Baldamus. (1998) Immunologische, alloantigenabhängige Faktoren in der chronischen Transplantatabstoßung. Medizinische Klinik 93:1, 1-5
CrossRef29
Yukihiro Shimizu, Kiyohiro Higuchi, Yoshirou Kashii, Megumi Miyamoto, Takashi Tsukishiro, Akiharu Watanabe. (1997) Clonal accumulation of Vβ5.1-positive cells in the liver of a patient with autoimmune cholangiopathy. Liver 17:1, 7-12
CrossRef30
Claudia Barth, Albrecht von Menges, Bernd Zanker, Petra Lammerding, Jozef Stachowski, Conrad A Baldamus. (1996) Restricted T cell Vβ repertoire in renal allografts during acute and chronic rejection. Kidney International 50:6, 2020-2026
CrossRef31
Kazuya Yamagata, Hiromu Nakajima, Koji Tomita, Naoto Itoh, Jun-ichiro Miyagawa, Tomoya Hamaguchi, Mitsuyoshi Namba, Shinji Tamura, Sumio Kawata, Norio Kono, Masamichi Kuwajima, Tamio Noguchi, Toshiaki Hanafusa, Yuji Matsuzawa. (1996) Dominant TCR α-chain clonotypes and interferon-γ are expressed in the pancreas of patients with recent-onset insulin-dependent diabetes mellitus. Diabetes Research and Clinical Practice 34:1, 37-46
CrossRef32
Bach-Nga Pham, Françoise Degos, Jean-François Mosnier, Stéphane Ollivier, Alain Sauvanet, Serge Erlinger, Jacques H.M. Cohen. (1996) Restriction of V beta gene usage of liver-derived lymphocytes in chronic hepatitis B and C. Human Immunology 49:1, 56-63
CrossRef33
Dayan, Colin M., Daniels, Gilbert H., . (1996) Chronic Autoimmune Thyroiditis. New England Journal of Medicine 335:2, 99-107
Full Text34
YOSHINORI SEKO, ENOKAWA YOSHIFUMI, HIDEO YAGITA, KO OKUMURA, YOSHIO YAZAKI. (1996) RESTRICTED USAGE OF T-CELL RECEPTOR Vα GENES IN INFILTRATING CELLS IN MURINE HEARTS WITH ACUTE MYOCARDITIS CAUSED BY COXSACKIE VIRUS B3. The Journal of Pathology 178:3, 330-334
CrossRef35
Sai A. Patibandla, Bellur S. Prabhakar. (1996) Autoimmunity to the thyroid stimulating hormone receptor. Advances in Neuroimmunology 6:4, 347-357
CrossRef36
A. D. Weinberg, M. Lemon, A. J. Jones, M. Vainiene, B. Celnik, A. C. Buenafe, N. Culbertson, A. Bakke, A. A. Vandenbark, H. Offner. (1996) OX-40 antibody enhances for autoantigen specific V?8.2+ T cells within the spinal cord of lewis rats with autoimmune encephalomyelitis. Journal of Neuroscience Research 43:1, 42-49
CrossRef37
Miguel Pedroza-Seres, Stephanie Goei, Jesus Merayo-Lloves, James E Dutt, Soon J Lee, Victor Arrunategui-Correa, C Stephen Foster. (1995) T cell receptor vβ gene expression in experimental herpes stromal keratitis. Eye 9:5, 599-604
CrossRef38
Armin E. Heufelder, Rebecca S. Bahn, Peter C. Scriba. (1995) Analysis of T-Cell Antigen Receptor Variable Region Gene Usage in Patients with Thyroid-Related Pretibial Dermopathy.. Journal of Investigative Dermatology 105:3, 372-378
CrossRef39
Colleen Olive. (1995) T cell receptor usage in autoimmune disease. Immunology and Cell Biology 73:4, 297-307
CrossRef40
TAKASHI AKAMIZU, YOSHIMICHI UEDA, LI HUA, JYOJI OKUDA, TORU MORI. (1995) Establishment and Characterization of an Antihuman Thyrotropin (TSH) Receptor-Specific CD4 + T Cell Line from a Patient with Graves' Disease: Evidence for Multiple T Cell Epitopes on the TSH Receptor Including the Transmembrane Domain. Thyroid 5:4, 259-264
CrossRef41
Daisuke Ueda, Noriyuki Sato, Akihiro Matsuura, Aya Sasaki, Shuji Takahashi, Hideyuki Ikeda, Yoshimasa Wada, Kokichi Kikuchi. (1995) T-Cell Receptor Gene Structures of HLA-A26-restricted Cytotoxic T Lymphocyte Lines against Human Autologous Pancreatic Adenocarcinoma. Cancer Science 86:7, 691-697
CrossRef42
E. CASO-PELAEZ, A. M. McGREGOR, J. P. BANGA. (1995) A Polyclonal T Cell Repertoire of V-Alpha and V-Beta T Cell Receptor Gene Families in Intrathyroidal T Lymphocytes of Graves' Disease Patients. Scandinavian Journal of Immunology 41:2, 141-147
CrossRef43
Katsumi Eguchi, Naoki Matsuoka, Shigenobu Nagataki. (1995) Cellular immunity in autoimmune thyroid disease. Baillière's Clinical Endocrinology and Metabolism 9:1, 71-94
CrossRef44
George M. Happ. 1995. Thyroiditis—A model canine autoimmune disease. , 97-139.
CrossRef45
Yaron Tomer, Terry F. Davies. (1995) Infections and autoimmune endocrine disease. Baillière's Clinical Endocrinology and Metabolism 9:1, 47-70
CrossRef46
Andreas Martin, Naoki Matsuoka, Erlinda S. Concepcion, Terry F. Davies. (1995) Endogenous Antigen Presentation by Autoantigen-Transfected Epstein-Barr Viruslymphoblastoid Cells: T Cell Receptor N-Region Hydrophobicity Relates to Thyroid Antigen Recognition. Autoimmunity 21:4, 223-230
CrossRef47
W. Jean Dodds. 1995. Estimating disease prevalence with health surveys and genetic screening. , 29-96.
CrossRef48
Johan Grunewald, Rune Andersson, Lennart Rydberg, Dulceaydee Gigliotti, Christopher Schaufelberger, Gö Ran K. Hansson, Hans Wigzell. (1994) CD4+ and CD8+ T cell expansions using selected TCR V and J gene segments at the onset of giant cell arteritis. Arthritis & Rheumatism 37:8, 1221-1227
CrossRef49
Christopher Lindberg, Anders Oldfors, Andrzej Tarkowski. (1994) Restricted use of T cell receptor V genes in endomysial infiltrates of patients with inflammatory myopathies. European Journal of Immunology 24:11, 2659-2663
CrossRef50
Einat Zisman, Michael Sela, Avraham Ben-Nun, Edna Mozes. (1994) Dichotomy between the T and the B cell epitopes of the synthetic polypeptide (T,G)-A–L. European Journal of Immunology 24:10, 2497-2505
CrossRef51
Kazuaki Chikamatsu, Masao Eura, Koji Nakano, Yuichi Kanzaki, Hiroaki Matsuoka, Keisuke Masuyama, Takeru Ishikawa. (1994) Analysis of T Cell Receptor Variability in Fresh Tumor-infiltrating Lymphocytes from Human Head and Neck Cancer. Cancer Science 85:6, 626-632
CrossRef52
Halina Offner, George A. Hashim, Arthur A. Vandenbark. (1994) Immunity to T cell receptor peptides: theory and applications. Regulatory Peptides 51:2, 77-90
CrossRef53
EDÉĈAIO CUNHA-NETO, RICARDO MOLITERNO, VERÔNICA COELHO, LUIZA GUILHERME, EDIMAR BOCCHI, MARIA DE LOURDES HIGUCHI, NOEDIR STOLF, FULVIO PILEGGI, LAWRENCE STEINMAN, JORGE KALIL. (1994) Restricted heterogeneity of T cell receptor variable alpha chain transcripts in hearts of Chagas’disease cardiomyopathy patients. Parasite Immunology 16:4, 171-179
CrossRef54
Sun-Lung Tsai, Pei-Jer Chen, Pei-Ming Yang, Ta-Hsiu Liao, Juei-Low Sung, Ming-Yang Lai, Jyh-Hsiung Huang, Tong-Hsuan Chang, Ding-Shinn Chen. (1994) Characterization of T cell clones specific to a determinant of hepatitis B virus core and e antigens in chronic type B hepatitis: Implication for a T cell mechanism of HBV immunopathogenesis. Journal of Biomedical Science 1:2, 105-118
CrossRef55
Eckhart Weidmann, Massimo Trucco, Theresa L. Whiteside. (1994) Relevance of the T cell receptor for immunotherapy of cancer. Cancer Immunology Immunotherapy 39:1, 1-14
CrossRef56
N. Lahat, A. Ben-Nun, A. Kinarty, T. F. Davies. (1994) Selection of Human TcR V Gene Families in Autologous Mixed Lymphocyte Reactions: Relevance to Autoimmune Immunopathology. Autoimmunity 18:2, 133-139
CrossRef57
S. De Riu, A. Martin, M. Valentine, E. S. Concepcion, L. D. Shultz, T. F. Davies. (1994) Graves' Disease Thyroid Tissue Transplants in Scid Mice: Persistent Selectivity in hTcR Va Gene Family use. Autoimmunity 19:4, 271-277
CrossRef58
Hiroshi Kimura, Yoshihiro Ando, Motohiro Shibata, Tokuichiro Abe, Tsuneo Morishima. (1993) T-cell receptor Vα region usage in the cerebrospinal fluid of patients with mumps meningitis. Journal of Medical Virology 41:4, 306-311
CrossRef59
TAMÁS ORAVECZ, MICHAEL A. NORCROSS. (1993) Costimulatory Properties of the Human CD4 Molecule: Enhancement of CD3-Induced T Cell Activation by Human Immunodeficiency Virus Type 1 through Viral Envelope Glycoprotein gp120. AIDS Research and Human Retroviruses 9:10, 945-955
CrossRef60
Masanori Tsuchida, Yoh Matsumoto, Hiroyuki Hirahara, Haruo Hanawa, Katsuhiro Tomiyama, Toru Abo. (1993) Preferential distribution of Vβ 8.2-positive T cells in the central nervous system of rats with myelin basic protein-induced autoimmune encephalomyelitis. European Journal of Immunology 23:10, 2399-2406
CrossRef61
Bruce Lee Hall, Susan L. Hand, Mark D. Alter, Allan D. Kirk, Olivera D. Finn. (1993) Variables affecting the T cell receptor Vβ repertoire heterogeneity of T cells infiltrating human renal allografts. Transplant Immunology 1:3, 217-227
CrossRef62
Toshiaki Maruyama, Ichiro Saito, Sachiko Miyake, Hiroshi Hashimoto, Kazuto Sato, Hideo Yagita, Ko Okumura, Nobuyuki Miyasaka. (1993) A possible role of two hydrophobic amino acids in antigen recognition by synovial T cells in rheumatoid arthritis. European Journal of Immunology 23:9, 2059-2065
CrossRef63
Linda Struyk, James T. Kurnick, Gail E. Hawes, Jaap M. van Laar, Ronald Schipper, Jorge R. Oksenberg, Lawrence Steinman, RenéR.P. de Vries, Ferdinand C. Breedveld, Peter van den Elsen. (1993) T-cell receptor V-gene usage in synovial fluid lymphocytes of patients with chronic arthritis. Human Immunology 37:4, 237-251
CrossRef64
Gerd Pluschke, Anita Ginter, Heiko Taube, Inga Melchers, Hans H. Peter, Ulrich Krawinkel. (1993) Analysis of T Cell Receptor Vβ Regions Expressed by Rheumatoid Synovial T Lymphocytes. Immunobiology 188:4-5, 330-339
CrossRef65
Barry C. Cole, Marie M. Griffiths. (1993) Triggering and exacerbation of autoimmune arthritis by themycoplasma arthritidis superantigen mam. Arthritis & Rheumatism 36:7, 994-1002
CrossRef66
ARGYRIOS N. THEOFILOPOULOS, ROBERT S. BALDERAS, ROBERTO BACCALA, DWIGHT H. KONO. (1993) T-Cell Receptor Genes in Autoimmunity. Annals of the New York Academy of Sciences 681:1 Myasthenia Gr, 33-46
CrossRef67
Eckhart Weidmann, Massimo Trucco, Michael T. Lotze, Theresa L. Whiteside, Elaine M. Elder. (1993) Usage of T-cell receptor Vβ chain genes in fresh and cultured tumor-infiltrating lymphocytes from human melanoma. International Journal of Cancer 54:3, 383-390
CrossRef68
Huaizhong Hu, Màrio Rui Queirò, Marcel G. J. Tilanus, Roel A. Weger, Henk-Jan Schuurman. (1993) Expression of T-cell receptor α and β variable genes in normal and malignant human T cells. British Journal of Haematology 84:1, 39-48
CrossRef69
R. DUCHMANN, W. STROBER, S.P. JAMES. (1993) Quantitative Measurement of Human T-Cell Receptor Vβ Subfamilies by Reverse Transcription-Polymerase Chain Reaction Using Synthetic Internal mRNA Standards. DNA and Cell Biology 12:3, 217-225
CrossRef70
Shigeki Sakata, Syun-ichi Tanaka, Kenji Okuda, Kiyoshi Miura, Taghi Manshouri, M.Zouhair Atassi. (1993) Autoimmune T-cell recognition sites of human thyrotropin receptor in Graves' disease. Molecular and Cellular Endocrinology 92:1, 77-82
CrossRef71
Oscar G. Segurado, Dolores J. Schendel. (1993) Identification of predominant T-cell receptor rearrangements by temperature-gradient gel electrophoresis and automated DNA sequencing. Electrophoresis 14:1, 747-752
CrossRef72
MICHAEL D. GRANT, FIONA M. SMAILL, KAREN LAURIE, KENNETH L. ROSENTHAL. (1993) Changes in the Cytotoxic T-Cell Repertoire of HIV-1-Infected Individuals: Relationship to Disease Progression. Viral Immunology 6:1, 85-95
CrossRef73
A. A. Vandenbark, G. Hashim, H. Offner. (1993) TCR Peptide Therapy in Autoimmune Diseases. International Reviews of Immunology 9:4, 251-276
CrossRef74
Brian R. Champion, Anne Cooke, David C. Rayner. (1992) Thyroid autoimmunity. Current Opinion in Immunology 4:6, 770-778
CrossRef75
H. Z. HU, R. A. WEGER, K. BOSBOOM-KALSBEEK, M. G. J. TILANUS, J. ROZING, H. J. SCHUURMAN. (1992) T cell receptor Vβ variable gene family expression in human peripheral blood lymphocytes at the mRNA and membrane protein level. Clinical & Experimental Immunology 88:2, 335-340
CrossRef76
H. Toyoda, A. Redford, D. Magalong, E. Chan, N. Hosszufalusi, B. Formby, M. Teruya, M.A. Charles. (1992) In situ islet T cell receptor variable region gene usage in the nonobese diabetic mouse. Immunology Letters 32:3, 241-245
CrossRef77
A. P. Weetman. (1992) Autoimmune thyroiditis: predisposition and pathogenesis. Clinical Endocrinology 36:4, 307-323
CrossRef78
Thomas R. Brown, Nandalal Bagchi. (1992) The Role of Iodine in the Development of Autoimmune Thyroiditis. International Reviews of Immunology 9:2, 167-182
CrossRef79
ANDREAS MARTIN, TERRY F. DAVIES. (1992) T Cells and Human Autoimmune Thyroid Disease: Emerging Data Show Lack of Need to Invoke Suppressor T Cell Problems. Thyroid 2:3, 247-261
CrossRef80
Tery F. Davies. (1992) Preferential Use of T-Cell Receptor V Genes in Human Autoimmune Thyroid Disease. Autoimmunity 13:1, 11-16
CrossRef81
Michael A. Panzara, Jorge R. Oksenberg, Lawrence Steinman. (1992) The polymerase chain reaction for detection of T-cell antigen receptor expression. Current Opinion in Immunology 4:2, 205-210
CrossRef82
Ariel Miller, David A. Hafler, Howard L Weiner. (1991) Immunotherapy in autoimmune diseases. Current Opinion in Immunology 3:6, 936-940
CrossRef83
Utiger, Robert D., . (1991) The Pathogenesis of Autoimmune Thyroid Disease. New England Journal of Medicine 325:4, 278-279
Full Text
