Original Article
A Long-Term Study of Hepatitis C Virus Replication in Non-A, Non-B Hepatitis
N Engl J Med 1991; 325:98-104July 11, 1991
- Abstract
Background.
Although antibodies to the hepatitis C virus (HCV) are known to be associated with nonA, non-B hepatitis, little is known about the pattern of HCV replication, its relation to antibody levels, and the clinical course of non-A, non-B hepatitis.
Methods.
We measured HCV RNA in serial serum samples from five patients with post-transfusion non-A, non-B hepatitis who were followed for 10 to 14 years after transfusion. We also studied four chimpanzees that were experimentally infected with serum from four of these patients. Serum HCV RNA was detected by a "nested" polymerase-chain-reaction (PCR) assay that used two sets of primers derived from the third (NS3) and fourth (NS4) nonstructural gene regions of the HCV genome.
Results.
HCV sequences were detected by PCR in only two of the five patients and two of the four chimpanzees with the set of primers corresponding to the NS3 region, but in all five patients (and in all four chimpanzees) with the primers from the NS4 region. Serum HCV RNA was first detected within three weeks of transfusion in all five patients and within one week in three patients. The viremia lasted less than 4 months in the patient (and two chimpanzees) with acute, self-limited hepatitis, whereas it persisted for 10 to 14 years in the four patients (and for 1 and 3 years in two chimpanzees) with chronic non-A, non-B hepatitis. Antibodies to HCV were first detected at week 12 to 14; they disappeared after nine years in the patient with self-limited disease and became borderline after five years in one of the patients with chronic disease.
Conclusions.
During the early phase of primary HCV infection, there is a period of several months of seronegativity during which HCV RNA is the only diagnostic marker of infection. The disappearance of HCV RNA from serum appears to correlate with the resolution of non-A, non-B hepatitis, whereas viremia persists in patients whose disease progresses to chronic hepatitis. In contrast, antibody levels do not necessarily remain elevated in patients with chronic disease. (N Engl J Med 1991; 325:98–104.)
Media in This Article
Figure 1
Biochemical and Virologic Course of HCV Infection in Patient 4 (Panel A) and Chimpanzee 189 (Panel B), Which Was Inoculated with Serum from Patient 4.Figure 2
Biochemical and virologic Course of HCV Infection in Patient 1 (Panel A) and Chimpanzee 51 (Panel B), Which Was Inoculated with Serum from the Fifth Passage in Chimpanzees of HCV Derived from Patient 1.Article Activity
- Article
THE genome of the hepatitis C virus (HCV), the etiologic agent of post-transfusion non-A, non-B hepatitis, was recently identified, and the products of viral genes were expressed in prokaryotic and eukaryotic systems.1 Infection with HCV is routinely diagnosed by identifying in serum specific antibodies to these expressed proteins.2 Several studies have shown a clear association between the presence of antibodies to HCV (anti-HCV) and chronic non-A, non-B hepatitis.3 4 5 6 7 However, antibody testing cannot determine whether a patient with anti-HCV has recovered from the infection or is still carrying the virus and is potentially infectious. In addition, anti-HCV often appears late after the onset of hepatitis,5 , 8 and the duration of infectivity preceding seroconversion remains uncertain.
Amplification of HCV nucleic acid sequences with the polymerase chain reaction (PCR) is a powerful technique for the detection of viremia during acute and chronic HCV infection.9 , 10 In experimentally infected chimpanzees, HCV RNA was detected in serum as early as three days after inoculation and for an extended period before the appearance of anti-HCV.11 Investigations of HCV RNA in humans have been undertaken primarily in patients studied at one point in their illness, regardless of the clinical stage of the infection. Studies are lacking of the pattern of HCV RNA during the entire course of infection in patients with transfusion-associated non-A, non-B hepatitis. Therefore, we examined the replication of HCV in patients with acute and chronic non-A, non-B hepatitis whom we followed for up to 14 years, the relation between anti-HCV and hepatitis C viremia, and the possibility that alterations in the pattern of serum HCV RNA predict the outcome of HCV infection.
Methods
Patients
Serial serum samples were obtained from five patients included in a study of post-transfusion non-A, non-B hepatitis at the National Institutes of Health.12 All five patients, one woman and four men (mean age, 57 years), were followed before transfusion during openheart surgery and for an average of 12.8 years (range, 10 to 14) after transfusion. One patient (Patient 4) had acute, self-limited hepatitis, whereas four had acute hepatitis that progressed to a chronic form (Patients 1, 2, and 5 had chronic active hepatitis, and Patient 3 had chronic persistent hepatitis). Blood samples were obtained weekly or biweekly during the first 3 months after transfusion, monthly for the next 3 months, and then at intervals of 2 to 12 months during the subsequent years of follow-up. The diagnosis of acute hepatitis was based on the finding of one or both of the following: symptoms suggestive of acute viral hepatitis and alanine aminotransferase levels at least 2.5 times the upper limit of normal (53 U per liter), followed by levels at least twice the upper limit of normal, between 2 and 26 weeks after transfusion. Non-A, non-B hepatitis was diagnosed if all the other known causes of acute hepatitis could be excluded by clinical, serologic, and laboratory studies. The progression from acute to chronic hepatitis was identified by the persistence of abnormal enzyme levels, often with a characteristic fluctuating pattern, and confirmed in all cases by histologie examination of at least one percutaneous liver-biopsy specimen. The five patients were selected because they represented five unequivocal cases of post-transfusion non-A, non-B hepatitis with extensive follow-up and because serial serum samples were available. In addition, they had no evidence of previous liver disease, had not received any transfusions before undergoing open-heart surgery, were available for long-term follow-up, and gave informed consent.
Chimpanzees
Selected samples of plasma or serum (range, 0.5 to 75 ml), obtained during the acute or chronic phase of post-transfusion non-A, non-B hepatitis from Patients 1,2,3, and 4, were individually inoculated intravenously into four chimpanzees. HCV RNA was measured in serum weekly or biweekly during the first six months after inoculation and then every one to three months during follow-up. Antibody to HCV was assayed weekly throughout the observation period. Liver-biopsy specimens were obtained before inoculation and at intervals of one or more weeks during the experimental study. None of the animals had been exposed previously to HCV.13
Anti-HCV Testing
Serum samples were tested for anti-HCV by an enzyme immunoassay according to the manufacturer's instructions (Ortho Diagnostic Systems, Raritan, N.J.). Plates were read on an Ortho Autoreader II at 490 nm, for which the upper limit of optical density is 3.0. The cutoff value was established as the mean of the values of three negative controls plus 0.4 optical-density unit.
Oligonucleotide Primers
The PCR was performed as a two-step reaction with two pairs of "nested" primers (see below). Oligonucleotide primers were synthesized with a DNA synthesizer (model 391, Applied Biosystems, Foster City, Calif.). Two sets of nested primers from different regions of the HCV genome14 were used. The first set was from the third nonstructural gene (NS3) region and consisted of an outer primer pair, Al (54'CTGCAATACGTGTGCCACCC3'), starting at map position 3011, and A2 (5'ACATGCATGTCATGATGTAT3'), starting at map position 3600, and an inner primer pair, A3 (5'AGACAGTCGATTTCAGCCTT3'), starting at map position 3031, and A4 (5'TTGGTGACTGGGTGCGTCAG3'), starting at map position 3580. The second set of nested primers was from the fourth nonstructural gene (NS4) region and consisted of an outer primer pair, P1 (5'GTTCGATGAGATGGAAGAGTG3'), starting at map position 3764, and P2 (5'ACCAGGCAGCGTTGACAAGCC3'), starting at map position 4001, and an inner primer pair, P3 (5'CTCAGCACTTACCGTACATCG3'), starting at map position 3788, and P4 (5'GCCCGCCAAGTATTGTATCCC3'), starting at map position 3983.
RNA Preparation
During RNA extraction, special care was taken to avoid crosscontamination. In each experiment, a negative control for each test sample was subjected to RNA extraction, reverse transcription, and amplification in parallel with the test sample.
RNA was prepared according to the guanidinium—phenol—chloroform method. In brief, 100 μl of the serum or plasma sample was mixed with 400 μl of extraction buffer (4.2 mol of guanidinium thiocyanate per liter, 0.5 percent sodium N-lauroyl sarcosinate, 25 mmol of TRIS–hydrochloric acid per liter, and 0.7 mol of 2-mercaptoethanol per liter) and 50 μl (10X) phenol extraction buffer (1 mol of TRIS–hydrochloric acid [ph 8.0] per liter, 0.1 mol of EDTA per liter, and 10 percent sodium dodecyl sulfate). Proteins were removed by extraction with phenol—chloroform at 65°C for 30 minutes followed by two extractions at room temperature: one with phenol—chloroform and one with chloroform alone. After precipitation with isopropanol, the RNA pellet was resuspended in 9 μl of diethyl pyrocarbonate—treated water and heated at 65°C for two minutes to denature the RNA immediately before reverse transcription.
Reverse Transcriptase Reaction and PCR Testing
Synthesis of complementary DNA was carried out in a volume of 20 μl containing the template (9 μl of sample RNA solution), 40 units of ribonuclease inhibitor (Promega Biotech, Madison, Wis.), 50 pmol of the reverse primer, 80 units of avian myeloblastosis virus reverse transcriptase (Promega), 1 mmol each of four DTPs (Pharmacia), and PCR buffer (10X PCR buffer consists of 10 mmol of TRIS–hydrochloric acid [pH 8.3], 50 mmol of potassium chloride, and 2.5 mmol of magnesium chloride). The reaction was incubated at 43°C for 60 minutes. The complementary DNA product was boiled for five minutes, chilled on ice, amplified in a total volume of 100 μl containing 50 pmol of each outer primer, 2.5 units of Taq polymerase (Perkin—Elmer Cetus), and the PCR buffer, and then overlaid with 100 μl of light mineral oil (Sigma, St. Louis). The reaction was performed for 35 cycles, including denaturation at 94°C for one minute, primer annealing at 45°C for two minutes, and primer extension at 72°C for three minutes, in a programmable DNA thermal cycler (Perkin—Elmer Cetus, Norwalk, Conn.). After the first amplification step, 10 μl of the PCR product was amplified for 35 cycles with the corresponding inner primer pair. For the second PCR reaction, we used the same conditions described for the first PCR. After the second amplification, 10 μl of the PCR product was analyzed by electrophoresis on 2 percent agarose gel and visualized by ultraviolet fluorescence after staining with ethidium bromide.
Evaluation of Sensitivity and Specificity
To assess the sensitivity of our nested PCR technique, we analyzed 10-fold serial dilutions of a reference plasma sample obtained from Patient 3, whose inoculum had been demonstrated to contain 106 , 5 50 percent chimpanzee-infective doses per milliliter of HCV15 (and Purcell RH: unpublished data). HCV sequences were detected at a dilution of 10—7 but were not found at a dilution of 10—8. These data indicate that the sensitivity of our test was less than one 50 percent chimpanzee-infective dose.
To reduce the risk of contamination of our samples with PCR products, a number of precautions were taken, as recommended by Kwok and Higuchi.16 Results were considered valid only if they were consistent in repeated experiments: all samples were tested at least twice, and many were tested three or more times. The specificity of our PCR assay was confirmed by the use of nested primers and by partial sequencing of the PCR products. For sequencing, PCR fragments were cut from 1 percent agarose gels and purified with Geneclean (Bio 101, La Jolla, Calif.). Sequencing was performed with Sequenase (United States Biochemical, Cleveland) as previously described.17
Results
Detection of HCV Sequences by Two Sets of Primers
Although the set of primers from the NS3 region detected HCV sequences in only two of the five patients tested (Patients 1 and 3), the set of primers from the NS4 region identified HCV RNA in all the patients studied. HCV RNA from an experimentally infected chimpanzee reacted with one or both sets of primers in the same way as the HCV RNA from the patient whose serum was used to infect the chimpanzee (Table 1Table 1
Detection of HCV Sequences by PCR with the Use of Two Sets of Nested Primers from the NS3 and NS4 Regions of the HCV Genome.*). Thus, the pattern of response in the two sets of primers appeared to be a genetic trait of the specific HCV strain.Patients
The clinical and serologic data for each patient are summarized in Table 2Table 2
Clinical and serologic Evaluation of Type C Hepatitis in Ptospectively Followed Patients and Chimpanzees.*. In Patient 4, who had acute, self-limited non-A, non-B hepatitis, HCV RNA first appeared in the serum 1 week after transfusion, preceding the initial elevation in the serum levels of alanine aminotransferase by 5 weeks, and it was present for approximately 15 weeks (Fig. 1Figure 1Biochemical and Virologic Course of HCV Infection in Patient 4 (Panel A) and Chimpanzee 189 (Panel B), Which Was Inoculated with Serum from Patient 4.A). Antibody seroconversion occurred 12 weeks after transfusion (6 weeks after the onset of hepatitis) and, despite the resolving clinical course, persisted unmodified for the next 5 years; the antibody levels declined and eventually disappeared 9 years after the onset of infection.In the four patients (Patients 1, 2, 3, and 5) with acute hepatitis that progressed to a chronic form, serum samples were persistently positive for HCV for up to 14 years, and in three patients (Patients 1, 3, and 5) viremia was associated with a sustained antibody response. A typical example of this pattern (Patient 1) is shown in Figure 2Figure 2
Biochemical and virologic Course of HCV Infection in Patient 1 (Panel A) and Chimpanzee 51 (Panel B), Which Was Inoculated with Serum from the Fifth Passage in Chimpanzees of HCV Derived from Patient 1.A. Hepatitis C viremia became detectable 2 weeks after transfusion, preceding the clinical onset and the appearance of anti-HCV by 10 and 11 weeks, respectively. The acute hepatitis progressed to chronic active hepatitis, documented by a liver biopsy performed six months after the onset of the acute episode. HCV RNA was present in serum during the acute phase and, in parallel with the progressive course of the disease, remained detectable throughout the following 14 years in association with a sustained antibody response. Alanine aminotransferase levels remained elevated until week 48, then declined, and a fluctuating pattern typical of non-A, non-B hepatitis was seen throughout the follow-up period. In contrast, no such pattern of fluctuation was observed for HCV RNA or anti-HCV. In this patient, a second liver biopsy performed 3.5 years after the first, at the time of a transient decrease in serum alanine aminotransferase values, showed histologic improvement from chronic active hepatitis to chronic persistent hepatitis.In one patient (Patient 2), the persistent viremia was associated with a fluctuating antibody pattern (Fig. 3Figure 3
Biochemical and Virologic Course of HCV Infection in Patient 2 (Panel A) and Chimpanzee 196 (Panel B), Which Was Inoculated with Plasma from Patient 2.A). Hepatitis C viremia preceded the initial elevation of alanine aminotransferase levels and the appearance of anti-HCV by at least 3 and 11 weeks, respectively. The acute illness progressed to chronic active hepatitis, as documented by liver biopsies performed eight months and three years after the acute episode. Serum was positive for HCV RNA during the acute phase, became negative in parallel with a decrease in serum alanine aminotransferase values into the normal range, and again was positive on week 34, concomitant with a second peak in the levels of alanine aminotransferase. Subsequently, HCV RNA remained detectable in the serum throughout follow-up, despite the normal to near-normal alanine aminotransferase values consistently observed during the following 12 years. Anti-HCV reached the highest optical-density values (>3.0) four weeks after its first appearance and persisted unmodified throughout the next five years. In contrast to the persistence of HCV RNA in serum, the antibody levels slowly declined and fluctuated between borderline negative and weakly positive values during the final eight years of follow-up.Chimpanzees
The clinical and serologic data for each chimpanzee are summarized in Table 2. In chimpanzee 189, which was inoculated with serum obtained from Patient 4 during the acute phase of infection, HCV sequences appeared in the serum within 1 week after inoculation, preceding clinical onset by 11 weeks, and persisted through week 18 of the acute phase (Fig. 1B). Antibody seroconversion occurred on week 30 and lasted through week 47. After the acute episode, alanine aminotransferase values returned to normal and remained so for the two years of the study. In contrast, chimpanzee 51, which was inoculated with HCV originally obtained from Patient 1, had acute hepatitis that progressed to a chronic form (Fig. 2B). Serum HCV sequences became detectable 1 week after inoculation, 5 weeks before the initial elevation of alanine aminotransferase levels and 17 weeks before the appearance of anti-HCV. After the acute episode, in parallel with a persistent elevation in the levels of alanine aminotransferase, HCV RNA remained detectable in serum throughout the three years of follow-up except in a single repeatedly negative sample obtained after the resolution of the acute episode. The continued presence of HCV RNA in serum was accompanied by a sustained antibody response. The pattern of serologic markers of HCV infection observed in chimpanzee 196, inoculated with plasma obtained from Patient 2 during the early phase of chronic infection, is shown in Figure 3B. Hepatitis C viremia first appeared five weeks after inoculation, preceding clinical onset by eight weeks, and persisted through week 18. anti-HCV was found one week after inoculation, reflecting passive transmission by the large (75 ml) inoculum, and disappeared eight weeks later. The chimpanzee again became positive for anti-HCV 20 weeks after inoculation and remained positive throughout follow-up.
Chimpanzee 1304 was inoculated with plasma obtained from Patient 3 during the early phase of acute non-A, non-B hepatitis and had acute hepatitis that progressed to a chronic form. The early events of HCV infection, including the pattern of HCV RNA in the serum, as determined by a single PCR amplification and Southern blot hybridization, have been reported previously.11 HCV RNA appeared in the serum three days after inoculation and remained detectable until week 13, when the last sample was tested. We confirmed these results using the nested PCR technique. In addition, we extended the analysis and found that HCV RNA and anti-HCV were still detectable one year after inoculation.
Discussion
The recent molecular cloning of the HCV genome and the development of a serologic assay to detect antibody to HCV have greatly advanced our understanding of non-A, non-B hepatitis. However, the absence of a test to detect HCV antigenemia has impeded progress in understanding the biologic characteristics of this virus. The PCR technique provided us with the opportunity to study the natural course of HCV infection in a well-defined group of patients who had post-transfusion non-A, non-B hepatitis and who were followed for up to 14 years. A sensitive assay, such as the PCR, is particularly important in the identification of HCV infection, in which low levels of viremia, as demonstrated by experimental studies in chimpanzees,15 appear to be the rule. The sensitivity of our nested PCR assay enabled us to detect less than one 50 percent chimpanzee-infective dose. Because of its high degree of sensitivity, however, one of the major concerns with the use of the PCR as a diagnostic test is the risk of false positive results due to crosscontamination. For this reason, in addition to employing the most stringent standard precautions, we also tested each sample with a negative serum control during RNA extraction, reverse transcription, and amplification. Our data also show that another important concern in the use of diagnostic PCR is the occurrence of false negative results due to genetic heterogeneity of the template nucleic acid. The first set of nested primers that we used, derived from the NS3 region of the HCV genome, was able to identify HCV sequences in only two of the five patients studied despite proof —transmission of the infection to chimpanzees — that most of them were infectious. This prompted us to design a novel set of primers from the NS4 region that permitted the detection of HCV viremia in the five patients as well as in the four chimpanzees inoculated with homologous HCV strains. These data show that there is genetic heterogeneity among HCV strains in the United States, as is the case in Japan,18 19 20 21 and indicate the importance of designing appropriate primers within the most conserved regions of the HCV genome.
The detection of HCV RNA in serum is believed to be a sensitive and reliable indicator of infectivity. Our study demonstrates that during the early phase of acute HCV infection, HCV RNA is present in serum long before other markers can be detected. As a rule, HCV RNA was detected in our patients one to two weeks after transfusion, in the earliest sample available for testing. The mean interval between exposure to HCV and the first appearance of HCV RNA was very short in all the patients and chimpanzees studied. In contrast, we observed a prolonged interval (up to 8 weeks) between the detection of HCV RNA and the onset of hepatitis, and an even longer interval (up to 12 weeks) before the first appearance of anti-HCV. During this serologically silent period, HCV RNA is the only marker that permits the diagnosis of the primary HCV infection and the identification of potentially infectious patients who would be missed by conventional antibody testing. The early replication of HCV, documented in all our patients, is consistent with the pattern observed in experimentally infected chimpanzees. In a previous study of this animal model, Shimizu et al. did not detect HCV RNA until three to four days after inoculation, suggesting that the PCR results reflect de novo viral replication rather than the passive transfer of virus from the inoculum.11
Our finding that the measurement of serum HCV RNA may provide important information on the outcome of the disease is of major clinical relevance. Basically, we observed two patterns. Hepatitis C viremia was transient in acute, self-limited hepatitis, but it persisted for up to 14 years in patients in whom acute hepatitis progressed to a chronic form. We obtained similar results in experimentally inoculated chimpanzees. In contrast, the persistence of antibody did not always correlate with the persistence of infection. In the patient with resolving hepatitis, despite the clearance of HCV RNA from the blood, assays for anti-HCV were persistently positive for nine years. Thus, HCV RNA is the only currently available marker that can discriminate between apparent past HCV infection and active infection. Furthermore, the persistence of an active HCV infection may not always be associated with a sustained antibody response. In one of the four patients in whom chronic hepatitis developed, the persistence of HCV RNA in serum was associated with a fluctuating antibody pattern that alternated between weakly positive and weakly negative during the final eight years of follow-up. These data indicate that a negative or marginal antibody test does not exclude active HCV infection and that HCV RNA is again the only available marker that can reliably identify active HCV infection.
During the long-term follow-up of chronic non-A, non-B hepatitis, we failed to observe any correlation between the HCV RNA pattern and the serum alanine aminotransferase profile except for a transient loss of HCV RNA positivity after a transient elevation in alanine aminotransferase levels in two patients (Patients 2 and 3) and two chimpanzees. HCV RNA appeared for the first time well before the initial elevation of alanine aminotransferase levels, and persisted thereafter throughout the fluctuations and eventual progressive decline in the levels of alanine aminotransferase that are characteristic of chronic non-A, non-B hepatitis.22 , 23 This disparity between HCV RNA and alanine aminotransferase levels may indicate that HCV replication is not always associated with serious liver damage, presumably as a result of the low cytopathic effect of this virus or, possibly, nonhepatic sites of replication. Whether patients positive for HCV RNA who have normal alanine aminotransferase levels are "healthy" carriers of HCV or have mild chronic liver disease can be established only by diagnostic liver biopsy. Our study suggests that subclinical chronic hepatitis due to HCV infection may be quite common.
Recently, Garson et al.24 described the course of viremia in five prospectively followed patients with hemophilia in whom non-A, non-B hepatitis developed after the infusion of commercial factor VIII. They reported that HCV RNA was detectable by PCR in relatively few of the relevant serial serum samples tested, and only a single serum sample was positive for HCV RNA in three of the five patients. In two of these patients the single positive sample was obtained late in the course of the infection, approximately 35 and 300 weeks after the onset of the acute episode. As compared with our results, which showed early and almost continuous HCV replication for 3 to 4 months in acute, resolving hepatitis and for up to 14 years in all the patients with progressing hepatitis, the data of Garson et al.24 led to a less optimistic interpretation of the value of PCR as a diagnostic tool in both acute and chronic HCV infection. Whether the discrepancies between these two studies are attributable to different sensitivities of the PCR assay or to the use of primers that, because of genetic heterogeneity, are not compatible with some of the HCV strains studied by Garson et al. remains to be established. In support of our data are the observations that serum samples obtained during either the acute or the chronic phase of infection that were positive according to the PCR were shown to transmit non-A, non-B hepatitis to chimpanzees13; that a large proportion of single serum samples from patients with chronic non-A, non-B hepatitis in one study were positive for HCV RNA9; and that the pattern of HCV RNA in serial serum samples from patients and chimpanzees in this study was the same as that observed in an independent study of experimentally infected chimpanzees, even when tested by a different procedure in another laboratory.11
Several points emerge from the present study. Our data indicate that HCV RNA is a crucial marker for establishing a diagnosis of primary HCV infection early in the course of infection and discriminating between past and active HCV infection in patients with persistent or fluctuating antibody patterns. In addition, testing for HCV RNA has prognostic value; sustained clearance of HCV RNA correlates with resolution of the disease, whereas persistence of detectable HCV RNA predicts progression to a chronic form of hepatitis.
We are indebted to Dr. Yohko Shimizu, Professor Michael Kew, and Jacqueline C. Melpolder for helpful critical comments and to Todd Heishman and Sandra Chang for editorial assistance.
Source Information
Fom the Hepatitis Viruses Section, Laboratory of Infectious Diseases, National Institute of Allergy and Infectious Diseases (P.F., D.W., R.H.M., R.H.P.), and the Department of Transfusion Medicine, Warren G. Magnuson Clinical Center (H.J.A., J.W.S., B.J.), National Institutes of Health, Bethesda, Md. Address reprint requests to Dr. Farci at Bldg. 7, Rm. 202, National Institutes of Health, 9000 Rockville Pike, Bethesda, MD 20892.
- References
References
1
Choo
CrossRef | Web of Science | Medline2
Kuo
CrossRef | Web of Science | Medline3
Esteban
CrossRef | Web of Science | Medline4
van der Poel
CrossRef | Web of Science | Medline5
Alter
Full Text | Web of Science | Medline6
Miyamura
CrossRef | Web of Science | Medline7
Makris
CrossRef | Web of Science | Medline8
Esteban
Full Text | Web of Science | Medline9
Weiner
CrossRef | Web of Science | Medline10
Kaneko
CrossRef | Web of Science | Medline11
Shimizu
CrossRef | Web of Science | Medline12
Koziol
Web of Science | Medline13
Alter
CrossRef | Web of Science | Medline14
Houghton M, Choo Q-L, Kuo G. NANBV diagnostics and vaccines. Munich, Germany: European Patent Office, 1988. (European patent application number 88310922.5. Publication number 0318216.)
15
Feinstone
CrossRef | Web of Science | Medline16
Kwok
CrossRef | Web of Science | MedlineErratum, Nature 1989; 339:490.
Web of Science17
Winship
CrossRef | Web of Science | Medline18
Kato
CrossRef19
Okamoto
Medline20
Kubo
CrossRef | Web of Science | Medline21
Okamoto
Medline22
Dienstag
Web of Science | Medline23
Alter HJ. Chronic consequences of non-A, non-B hepatitis. In: Seeff LB, Lewis JH, eds. Current perspectives in hepatology. New York: Plenum Medical, 1989:83–97.
24
Garson
CrossRef | Web of Science | Medline
- Citing Articles (185)
Citing Articles
1
Jama M. Darling, Stanley M. Lemon, Michael W. Fried. 2011. Hepatitis C. , 582-652.
CrossRef2
Philipp de Leuw, Christoph Sarrazin, Stefan Zeuzem. (2011) How to use virological tools for the optimal management of chronic hepatitis C. Liver International 31, 3-12
CrossRef3
Robert J. Basseri, Michael T. Schmidt, Benjamin Basseri. (2010) Autoimmune hemolytic anemia in treatment-naive chronic hepatitis C infection: a case report and review of literature. Clinical Journal of Gastroenterology 3:5, 237-242
CrossRef4
Anurag Maheshwari, Paul J. Thuluvath. (2010) Management of Acute Hepatitis C. Clinics in Liver Disease 14:1, 169-176
CrossRef5
Resat Ozaras, Veysel Tahan. (2009) Acute hepatitis C: prevention and treatment. Expert Review of Anti-infective Therapy 7:3, 351-361
CrossRef6
Erik J. Groessl, Kimberly R. Weingart, Robert M. Kaplan, Jack A. Clark, Allen L. Gifford, Samuel B. Ho. (2008) Living with Hepatitis C: Qualitative Interviews with Hepatitis C-infected Veterans. Journal of General Internal Medicine 23:12, 1959-1965
CrossRef7
Nicolaos C Tassopoulos, George V Papatheodoridis, Ioanna Delladetsima, Angelos Hatzakis. (2008) Clinicopathological features and natural history of acute sporadic non-(A-E) hepatitis. Journal of Gastroenterology and Hepatology 23:8pt1, 1208-1215
CrossRef8
Anurag Maheshwari, Stuart Ray, Paul J Thuluvath. (2008) Acute hepatitis C. The Lancet 372:9635, 321-332
CrossRef9
Adnan Said, Nasia Safdar, Jennifer Wells, Michael R. Lucey. 2008. Liver Disease in Renal Transplant Recipients. , 508-533.
CrossRef10
L. T. F. Yeung, T. To, S. M. King, E. A. Roberts. (2007) Spontaneous clearance of childhood hepatitis C virus infection. Journal of Viral Hepatitis 14:11, 797-805
CrossRef11
A A. Ali, C. S. Suresh. (2007) Oral lichen planus in relation to transaminase levels and hepatitis C virus. Journal of Oral Pathology & Medicine 36:10, 604-608
CrossRef12
AI Kim, A Dorn, R Bouajram, S Saab. (2007) The treatment of chronic hepatitis C in HIV-infected patients: a meta-analysis. HIV Medicine 8:5, 312-321
CrossRef13
(2007) Asian Pacific Association for the Study of the Liver consensus statements on the diagnosis, management and treatment of hepatitis C virus infection. Journal of Gastroenterology and Hepatology 22:5, 615-633
CrossRef14
Jaydeep S. Kadam, Andrew H. Talal. (2007) Changing Treatment Paradigms: Hepatitis C Virus in HIV-Infected Patients. AIDS Patient Care and STDs 21:3, 154-168
CrossRef15
R. Solà Lamoglia. (2006) Tratamiento de la hepatitis aguda C. Gastroenterología y Hepatología 29, 163-167
CrossRef16
J. M. Micallef, J. M. Kaldor, G. J. Dore. (2006) Spontaneous viral clearance following acute hepatitis C infection: a systematic review of longitudinal studies. Journal of Viral Hepatitis 13:1, 34-41
CrossRef17
Annie Luetkemeyer, C Bradley Hare, John Stansell, Phyllis C Tien, Edwin Charlesbois, Paula Lum, Diane Havlir, Marion Peters. (2006) Clinical Presentation and Course of Acute Hepatitis C Infection in HIV-Infected Patients. JAIDS Journal of Acquired Immune Deficiency Syndromes 41:1, 31-36
CrossRef18
Hidenari Nagai, Katsuhiko Matsumaru, Kazue Shiozawa, Kouichi Momiyama, Noritaka Wakui, Masao Shinohara, Manabu Watanabe, Koji Ishii, Hiroko Nonaka, Akira Hasegawa, Tatsuo Teramoto, Wataru Yamamuro, Yasukiyo Sumino, Kazumasa Miki. (2005) Disappearance of HCV after cessation of immunosuppression in a patient with ulcerative colitis and renal transplantation. Journal of Gastroenterology 40:8, 848-853
CrossRef19
D. M. Netski, T. Mosbruger, E. Depla, G. Maertens, S. C. Ray, R. G. Hamilton, S. Roundtree, D. L. Thomas, J. McKeating, A. Cox. (2005) Humoral Immune Response in Acute Hepatitis C Virus Infection. Clinical Infectious Diseases 41:5, 667-675
CrossRef20
Christiane Gérard, Jean Delwaide, Dolores Vaira, Boris Bastens, Benoît Servais, Etienne Wain, Christian Bataille, Guy Daenen, Jacques Belaïche, . (2005) Evolution over a 10 year period of the epidemiological profile of 1,726 newly diagnosed HCV patients in Belgium. Journal of Medical Virology 76:4, 503-510
CrossRef21
GS Chopra, RM Gupta, SR Gedela, PP Varma, R Rai, SK Nema. (2005) Hepatitis C virus infection in haemodialysis patients: “Wolf in sheep's clothing”. Medical Journal Armed Forces India 61:3, 241-244
CrossRef22
Andrea L. Cox, Timothy Mosbruger, Georg M. Lauer, Drew Pardoll, David L. Thomas, Stuart C. Ray. (2005) Comprehensive analyses of CD8+ T cell responses during longitudinal study of acute human hepatitis C. Hepatology 42:1, 104-112
CrossRef23
Ayse Aytaman, Gul Bahtiyar, Samy I McFarlane. (2005) Interferon- therapy and Type 1 diabetes mellitus in patients with hepatitis C: pathophysiologic insights. Therapy 2:3, 439-446
CrossRef24
Ayse Aytaman, Gül Bahtiyar, Samy I McFarlane. (2005) Interferon-α therapy and Type 1 diabetes mellitus in patients with hepatitis C: pathophysiologic insights. Therapy 2:3, 439-446
CrossRef25
Andrea L. Cox, Dale M. Netski, Timothy Mosbruger, Susan G. Sherman, Steffanie Strathdee, Danielle Ompad, David Vlahov, David Chien, Venkatakrishna Shyamala, Stuart C. Ray, David L. Thomas. (2005) Prospective Evaluation of Community‐Acquired Acute‐Phase Hepatitis C Virus Infection. Clinical Infectious Diseases 40:7, 951-958
CrossRef26
(2005) Hepatitis C Virus (HCV). Transfusion Medicine and Hemotherapy 32:3-4, 184-195
CrossRef27
Johannes Wiegand, Andrej Potthoff, Michael P. Manns, Heiner Wedemeyer. (2004) Acute hepatitis C infection: Can immunology teach us the right way to treat?. Current Hepatitis Reports 3:4, 148-156
CrossRef28
Naglaa H. Shoukry, Andrew G. Cawthon, Christopher M. Walker. (2004) CELL-MEDIATED IMMUNITY AND THE OUTCOME OF HEPATITIS C VIRUS INFECTION. Annual Review of Microbiology 58:1, 391-424
CrossRef29
Lorna M. Dove. (2004) A general approach to the management of chronic hepatitis C. Gastroenterology Clinics of North America 33:3, 463-477
CrossRef30
Doris B. Strader, Teresa Wright, David L. Thomas, Leonard B. Seeff. (2004) Diagnosis, management, and treatment of hepatitis C. Hepatology 39:4, 1147-1171
CrossRef31
Brian L. Pearlman. (2004) Hepatitis C Infection: A Clinical Review. Southern Medical Journal 97:4, 365-373
CrossRef32
Jean-Jacques Lefrere, Robert Girot, Francois Lefrere, Nicolas Guillaume, Joelle Lerable, Nadine Le Marrec, Francoise Bouchardeau, Syria Laperche. (2004) Complete or partial seroreversion in immunocompetent individuals after self-limited HCV infection: consequences for transfusion. Transfusion 44:3, 343-348
CrossRef33
B. Kazemi ., Bandehpour ., H. Yahya zadeh ., M. Roozbehi ., N. Seyed ., A. Ghotasloo ., A. Taherpour .. (2004) Comparative Study on HCV Detection in Iranian Patients by RT-PCR and ELISA Techniques During 2001-2003. Journal of Medical Sciences(Faisalabad) 4:2, 132-135
CrossRef34
Antigoni S. Katsoulidou, Zissis M. Moschidis, Renia E. Gialeraki, Dimitrios N. Paraskevis, Vana A. Sypsa, Marios C. Lazanas, Nicholaos C. Tassopoulos, Mina A. Psichogiou, John N. Boletis, Anastasia S. Karafoulidou, Angelos E. Hatzakis. (2004) Clinical evaluation of an HIV-1 and HCV assay and demonstration of significant reduction of the HCV detection window before seroconversion. Transfusion 44:1, 59-66
CrossRef35
Regina Moreira, João Renato Rebello Pinho, Jorge Fares, Isabel Takano Oba, Maria Regina Cardoso, Cláudia Patara Saraceni, Celso Granato. (2003) Prospective study of hepatitis C virus infection in hemodialysis patients by monthly analysis of HCV RNA and antibodies. Canadian Journal of Microbiology 49:8, 503-507
CrossRef36
Jean-Michel Pawlotsky. (2002) Use and interpretation of virological tests for hepatitis C. Hepatology 36:S1, S65-S73
CrossRef37
Jay H. Hoofnagle. (2002) Course and outcome of hepatitis C. Hepatology 36:S1, S21-S29
CrossRef38
L. S. Diamondstone, L. M. Aledort, J. J. Goedert, . (2002) Factors predictive of death among HIV-uninfected persons with haemophilia and other congenital coagulation disorders. Haemophilia 8:5, 660-667
CrossRef39
S.N. Natov, B.J.G. Pereira. (2002) Transmission of viral hepatitis by kidney transplantation: donor evaluation and transplant policies (Part 1: hepatitis B virus). Transplant Infectious Disease 4:3, 124-131
CrossRef40
Svetlozar N. Natov, Brian J. G. Pereira. (2002) Management of Hepatitis C Infection in Renal Transplant Recipients. American Journal of Transplantation 2:6, 483-490
CrossRef41
Alessandra Della Rossa, Antonio Tavoni, Chiara Baldini, Stefano Bombardieri. (2002) Treatment of chronic hepatitis C infection with cryoglobulinemia. Current Opinion in Rheumatology 14:3, 231-237
CrossRef42
Jean-Michel Pawlotsky. (2002) Molecular diagnosis of viral hepatitis. Gastroenterology 122:6, 1554-1568
CrossRef43
Grace Creedon, Mohamed J. E. M. F. Mabruk, Antoinette Grace, Miriam Murphy, Saied Albloushi, Patricia Billett, Frank Murray, Mary Leader, Elaine Kay. (2002) Lack of Association Between Hepatitis C Viral RNA in Serum and Liver and Histologic Gradings: A Study on Irish Anti-D-Treated Patients. Diagnostic Molecular Pathology 11:1, 27-32
CrossRef44
Anthony J Freeman, George Marinos, Rosemary A Ffrench, Andrew R Lloyd. (2001) Immunopathogenesis of hepatitis C virus infection. Immunology and Cell Biology 79:6, 515-536
CrossRef45
Jian Ping Liu, Eric Manheimer, Kiichiro Tsutani, Christian Gluud, Jian Ping Liu. 2001. Medicinal herbs for hepatitis C virus infection. .
CrossRef46
Margaret Heitkemper, Monica Jarrett, Ella Mae Kurashige, Robert Carithers. (2001) Chronic Hepatitis C. Gastroenterology Nursing 24:4, 169-175
CrossRef47
Taro Yamashita, Shuichi Kaneko, Shin-ichi Hashimoto, Taku Sato, Shigenori Nagai, Nobuaki Toyoda, Takuji Suzuki, Kenichi Kobayashi, Kouji Matsushima. (2001) Serial Analysis of Gene Expression in Chronic Hepatitis C and Hepatocellular Carcinoma. Biochemical and Biophysical Research Communications 282:2, 647-654
CrossRef48
Ross, R. Stefan, Viazov, Sergei, Gross, TanjaHofmann, Friedrich, Seipp, Hans-Martin, Roggendorf, Michael, . (2000) Transmission of Hepatitis C Virus from a Patient to an Anesthesiology Assistant to Five Patients. New England Journal of Medicine 343:25, 1851-1854
Full Text49
Svetlozar N. Natov, Brian J. G. Pereira. (2000) Routine Serologic Testing for Hepatitis C Virus Infection Should Be Instituted Among Dialysis Patients. Seminars in Dialysis 13:6, 393-398
CrossRef50
Santiago Dueñas-Carrera, Liz Alvarez-Lajonchere, Julio C. Alvarez-Obregón, Antonieta Herrera, Lázaro J. Lorenzo, Dagmara Pichardo, Juan Morales. (2000) A truncated variant of the hepatitis C virus core induces a slow but potent immune response in mice following DNA immunization. Vaccine 19:7-8, 992-997
CrossRef51
Laura Benson, Alice Birkel, Linda Caldwell, Valerie Stafford-Fox, Beverley Casarico. (2000) Advances in the Treatment of Hepatitis C: Combination Antiviral Therapy With Interferon alfa-2b and Ribavirin. Journal of the American Academy of Nurse Practitioners 12:9, 364-373
CrossRef52
Steedman A. Sarbah, Zobair M. Younossi. (2000) Hepatitis C. Journal of Clinical Gastroenterology 30:2, 125-143
CrossRef53
Liam Fanning, Elizabeth Kenny-Walsh, John Levis, Kingshuk Roy Choudhury, Bridin Cannon, Margaret Sheehan, Michael Whelton, Fergus Shanahan. (2000) Natural fluctuations of hepatitis C viral load in a homogeneous patient population: A prospective study. Hepatology 31:1, 225-229
CrossRef54
Nidhika Berry, Anita Chakravarti, Umapada Das, Premashis Kar, B.C Das, M.D Mathur. (1999) HCV seroreactivity and detection of HCV RNA in cirrhotics. Diagnostic Microbiology and Infectious Disease 35:3, 209-213
CrossRef55
Mostafa K. El-Awady, Somayia M. Ismail, Mohamed El-Sagheer, Yousry A. Sabour, Khalda S. Amr, Essam A. Zaki. (1999) Assay for hepatitis C virus in peripheral blood mononuclear cells enhances sensitivity of diagnosis and monitoring of HCV-associated hepatitis. Clinica Chimica Acta 283:1-2, 1-14
CrossRef56
Umapada Das, Premashis Kar, V. Gopalkrishna, Joginder K. Sharma, Kaushal Madan, Bhudev C. Das. (1999) Comparative evaluation of hepatitis C virus infection in serum and liver tissue of patients with chronic liver disease by reverse transcription-polymerase chain reaction. Clinical Microbiology and Infection 5:5, 256-261
CrossRef57
NANCY L. ERIKSEN. (1999) Perinatal Consequences of Hepatitis C. Clinical Obstetrics and Gynecology 42:1, 121-133
CrossRef58
Willi Kurt Roth, Marijke Weber, Erhard Seifried. (1999) Feasibility and efficacy of routine PCR screening of blood donations for hepatitis C virus, hepatitis B virus, and HIV-1 in a blood-bank setting. The Lancet 353:9150, 359-363
CrossRef59
S. Yerly, M. Pedrocchi, L. Perrin. (1998) The use of polymerase chain reaction in plasma pools for the concomitant detection of hepatitis C virus and HIV type 1 RNA. Transfusion 38:10, 908-914
CrossRef60
Ronald L. Paquette, Ken Kuramoto, Lawrence Tran, Ghislaine Sopher, Stephen D. Nimer, Jerome B. Zeldis. (1998) Hepatitis C virus infection in acquired aplastic anemia. American Journal of Hematology 58:2, 122-126
CrossRef61
Kouzaburo Yamaji, Jun Hayashi, Yasunobu Kawakami, Norihiro Furusyo, Yasunori Sawayama, Yasuhiro Kishihara, Yoshitaka Etoh, Seizaburo Kashiwagi. (1998) Hepatitis C Viral RNA Status at Two Weeks of Therapy Predicts the Eventual Response. Journal of Clinical Gastroenterology 26:3, 193-199
CrossRef62
Brian J. G. Pereira. (1998) Hepatitis C in Dialysis. Seminars in Dialysis 11:2, 113-118
CrossRef63
K MADAN, V GOPALKRISHNA, P KAR, JK SHARMA, UP DAS, BC DAS. (1998) Detection of hepatitis C and E virus genomes in sera of patients with acute viral hepatitis and fulminant hepatitis by their simultaneous amplification in PCR. Journal of Gastroenterology and Hepatology 13:2, 125-130
CrossRef64
Francesco Donato, Paolo Boffetta, Massimo Puoti. (1998) A meta-analysis of epidemiological studies on the combined effect of hepatitis B and C virus infections in causing hepatocellular carcinoma. International Journal of Cancer 75:3, 347-354
CrossRef65
Mercedes Pérez-Ruiz, Cristina Torres, Pedro A Garcı́a-López, Angela Ruiz-Extremera, Javier Salmerón, Alfredo Berzal-Herranz. (1997) Determination of HCV RNA concentration by direct quantitation of the products from a single RT-PCR. Journal of Virological Methods 69:1-2, 113-124
CrossRef66
Chau-Ting Yeh, Wei-Chue Shyu, I-Shyan Sheen, Chia-Ming Chu, Yun-Fan Liaw. (1997) Quantitative assessment of hepatitis C virus RNA by polymerase chain reaction and a digoxigenin detection system: comparison with branched DNA assay. Journal of Virological Methods 65:2, 219-226
CrossRef67
Brian J G Pereira, Andrew S Levey. (1997) Hepatitis C virus infection in dialysis and renal transplantation. Kidney International 51:4, 981-999
CrossRef68
Mara J. Dinsmoor. (1997) HEPATITIS IN THE OBSTETRIC PATIENT. Infectious Disease Clinics of North America 11:1, 77-91
CrossRef69
Aswini K. Panigrahi, Subrat K. Panda, Rajesh K. Dixit, Kanury V. S. Rao, Subrat K. Acharya, Srinivasan Dasarathy, Ambika Nanu. (1997) Magnitude of hepatitis C virus infection in India: Prevalence in healthy blood donors, acute and chronic liver diseases. Journal of Medical Virology 51:3, 167-174
CrossRef70
Elaine M. Sloand. (1997) Viral Risks Associated with Blood Transfusion. Photochemistry and Photobiology 65:3, 428-431
CrossRef71
Wood, Alastair J.J., , Hoofnagle, Jay H., Di Bisceglie, Adrian M., . (1997) The Treatment of Chronic Viral Hepatitis. New England Journal of Medicine 336:5, 347-356
Full Text72
Patrizia Farci, Jens Bukh, Robert H. Purcell. (1997) The quasispecies of hepatitis C virus and the host immune response. Springer Seminars in Immunopathology 19:1, 5-26
CrossRef73
M. G. Ghany, T. M. Chan, R. Sanchez-Pescador, M. Urdea, A. S. F. Lok. (1996) Correlation between serum HCV RNA and aminotransferase levels in patients with chronic HCV infection. Digestive Diseases and Sciences 41:11, 2213-2218
CrossRef74
Y. Yamakawa, M. Sata, H. Suzuki, S. Noguchi, K. Tanikawa. (1996) Higher elimination rate of hepatitis C virus among women. Journal of Viral Hepatitis 3:6, 317-321
CrossRef75
F. J. Salmerón, A. Palacios, M. Pérez-Ruiz, C. Torres, S. Oyonarte, A. Fernández-Montoya, A. Ruiz-Extremera. (1996) Epidemiology, serological markers, and hepatic disease of anti-HCV ELISA-2-positive blood donors. Digestive Diseases and Sciences 41:10, 1933-1938
CrossRef76
Juan Antonio Quiroga, Teresa Cotonat, Inmaculada Castillo, Vicente Carreño. (1996) Hepatitis E virus seroprevalence in acute viral hepatitis in a developed country confirmed by a supplemental assay. Journal of Medical Virology 50:1, 16-19
CrossRef77
Brian J. G. Pereira, Teresa L Wright. (1996) HBV and HCV Genome in Peripheral Blood Mononuclear Cells in Patients Undergoing Chronic Hemodialysis, by C Oesterreicher, J Hammer, U Koch, F Pfeffel, G Sunder-Plassman, D Petermann, C Muller. Kidney Int 48:1967-1971, 1995. Seminars in Dialysis 9:5, 432-433
CrossRef78
D.D. Eckels, P. Flomenberg, J.C. Gill. (1996) Hepatitis C virus: models of immunopathogenesis and prophylaxis. Transfusion 36:9, 836-844
CrossRef79
Farci, Patrizia, Alter, Harvey J., Shimoda, Atsushi, Govindarajan, Sugantha, Cheung, Ling C., Melpolder, Jacqueline C., Sacher, Ronald A., Shih, James W., Purcell, Robert H., . (1996) Hepatitis C Virus–Associated Fulminant Hepatic Failure. New England Journal of Medicine 335:9, 631-634
Full Text80
Schreiber, George B., Busch, Michael P., Kleinman, Steven H., Korelitz, James J., . (1996) The Risk of Transfusion-Transmitted Viral Infections. New England Journal of Medicine 334:26, 1685-1690
Full Text81
K.-H. Heermann, H. Seitz, R. Thomssen. (1996) Capture and RT-PCR of hepatitis C virus RNA with safety primers. Journal of Virological Methods 59:1-2, 33-43
CrossRef82
Wang Shulin, Zhang Yaozheng. (1995) Hepatitis B and C viruses and their interaction in the pthogenesis of hepatocellular carcinoma. Chinese Journal of Cancer Research 7:4, 275-279
CrossRef83
Takako Matsubara, Ryo Sumazaki, Hitoshi Takita. (1995) Mother-to-infant transmission of hepatitis C virus: A prospective study. European Journal of Pediatrics 154:12, 973-978
CrossRef84
José Raúl Oubiña, Jorge Fabián Quarleri, Marcelo Rudzinski, Carlos Parks, Isabel Badía, Stella Maris González Cappa. (1995) Genomic characterization of hepatitis C virus isolates from Argentina. Journal of Medical Virology 47:1, 97-104
CrossRef85
Flavia Bortolotti. (1995) Hepatitis C in childhood. The Indian Journal of Pediatrics 62:5, 507-518
CrossRef86
B. C. Smith, S. I. Strasser, P. V. Desmond. (1995) Current perspectives in hepatitis C. Australian and New Zealand Journal of Medicine 25:4, 350-357
CrossRef87
Ulrike Schacker, Hans-Peter Bermayer, Valerie Boehler, Doina Ionescu, Manuel Zapata, Hasan Grauer, Kamal Rai. (1995) Rapid HCV RNA detection by PCR followed by a new non-radioactive liquid hybridisation assay and comparison with RIBA. Journal of Medical Virology 46:4, 304-309
CrossRef88
OLIVER CHAZOUILLERES, TERESA L WRIGHT. (1995) Hepatitis C and liver transplantation. Journal of Gastroenterology and Hepatology 10:4, 471-480
CrossRef89
Martín Prieto, Vicente Olaso, Clara Verdú, Juan Córdoba, Concepción Gisbert, Miguel Rayón, Domingo Carrasco, Marina Berenguer, María Dolores Higón, Joaquín Berenguer. (1995) Does the healthy hepatitis C virus carrier state really exist? an analysis using polymerase chain reaction. Hepatology 22:2, 413-417
CrossRef90
David R. Gretch, Carlos E. Bacchi, Lawrence Corey, Corazon Dela Rosa, Richard R. Lesniewski, Kris Kowdley, Allen Gown, Indra Frank, James D. Perkins, Robert L. Carithers. (1995) Persistent hepatitis C virus infection after liver transplantation: Clinical and virological features. Hepatology 22:1, 1-9
CrossRef91
K. Al Meshari, M. Al Ahdal, O. Alfurayh, A. Ali, E. De Vol, G. Kessie. (1995) New insights into hepatitis C virus infection of hemodialysis patients: the implications. American Journal of Kidney Diseases 25:4, 572-578
CrossRef92
Lawrence Serfaty, Jean Baptiste Nousbaum, Marie Helene Elghouzzi, Phillipe Giral, Claire Legendre, Raoul Poupon. (1995) Prevalence, severity, and risk factors of liver disease in blood donors positive in a second-generation anti—hepatitis C virus screening test. Hepatology 21:3, 725-729
CrossRef93
Josep M. Barrera, Miguel Bruguera, M. Guadalupe Ercilla, Cristina Gil, Raquel Celis, M. Pilar Gil, M. Valle Del Onorato, Joan Rodés, Antoni Ordinas. (1995) Persistent hepatitis C viremia after acute self-limiting posttransfusion hepatitis C. Hepatology 21:3, 639-644
CrossRef94
M Resti, C Azzari, L Lega, ME Rossi, E Zammarchi, E Novembre, A Vierucci. (1995) Mother-to-infant transmission of hepatitis C virus. Acta Paediatrica 84:3, 251-255
CrossRef95
Enrico Silini, Fulvia Bono, Agostino Cividini, Antonella Cerino, Savino Bruno, Sonia Rossi, Giovanni Belloni, Bruno Brugnetti, Emilio Civardi, Laura Salvaneschi, Mario U. Mondelli. (1995) Differential distribution of hepatitis C virus genotypes in patients with and without liver function abnormalities. Hepatology 21:2, 285-290
CrossRef96
Showgo Ohkoshi, Hironobu Tawaraya, Kenji Kuwana, Takeshi Harada, Masashi Watanabe, Shoichi Higuchi, Hideo Kojima, Tomoteru Kamimura, Hitoshi Asakura. (1995) A retrospective study of hepatitis C virus carriers in a local endemic town in Japan. Digestive Diseases and Sciences 40:2, 465-471
CrossRef97
Mel Krajden, Fouad Bishai, Corinna Quan, Jim Mahony, James Brunton, David Rootman, Jiu Zhao, Wendy Lau, Gregory Snell, Janet Maurer, Steve Kesten, David Colby. (1995) Multi-organ donor transmission of hepatitis C virus to five solid organ transplant recipients and lack of transmission to corneal transplant recipients. Clinical and Diagnostic Virology 3:2, 113-121
CrossRef98
Giovanna Russo-Mancuso, Felicia Di Gregorio, Enrica Passero, Antonella Sciotto, Maria Clorinda Mazzarino, Grazia Malaponte, Gino Schilirog. (1995) Efficacy of an analysis of lymphocyte subsets in predicting the clinical response to α-interferon therapy in thalassaemia patients with chronic infection by hepatitis C virus: a pilot study. British Journal of Haematology 89:2, 291-298
CrossRef99
Brian J. G. Pereira, Andrew S. Levey. (1995) Hepatitis C infection in cadaver organ donors: strategies to reduce transmission of infection and prevent organ waste. Pediatric Nephrology 9:S1, S23-S28
CrossRef100
M. Coltorti, M. Romano, M. Persico, Filomena Morisco, Concetta Tuccillo, Nicola Caporaso. (1995) Hepatitis C virus RNA in serum and liver histology in asymptomatic anti-HCV positive subjects. Infection 23:1, 33-36
CrossRef101
S. MATSUOKA, K. TATARA, Y. HAYABUCHI, M. NII, K. MORI, Y. KURODA. (1994) Post-transfusion chronic hepatitis C in children. Journal of Paediatrics and Child Health 30:6, 544-546
CrossRef102
Giulio Diodati, Paola Bonetti, Alessandro Tagger, Carla Casarin, Franco Noventa, Marilisa Ribero, Michele Fasola, Arturo Ruol, Giuseppe Realdi. (1994) Relationship between serum HCV markers and response to interferon therapy in chronic hepatitis C. Digestive Diseases and Sciences 39:11, 2497-2502
CrossRef103
K. Siemoneit, M. Silva Cardoso, A. Wölpl, S. Epple, H. Wintersinger, K. Koerner, B. Kubanek. (1994) Isotype-specific immune response to a single hepatitis C virus core epitope defined by a human monoclonal antibody: diagnostic value and correlation to PCR. Annals of Hematology 69:3, 129-133
CrossRef104
P. A. C. Maple, T. McKee, U. Desselberger, T. G. Wreghitt. (1994) Hepatitis C virus infections in transplant patients: Serological and virological investigations. Journal of Medical Virology 44:1, 43-48
CrossRef105
Brian J G Pereira, Teresa L Wright, Christopher H Schmid, Christopher F Bryan, Ramsey C Cheung, E Shannon Cooper, Henry Hsu, Randall Heyn-Lamb, Jimmy A Light, Douglas J Norman, David H Van Thiel, Barbara G Werner, Charles E Wright, Andrew S Levey. (1994) Screening and confirmatory testing of cadaver organ donors for hepatitis C virus infection: A U.S. National Collaborative Study. Kidney International 46:3, 886-892
CrossRef106
Svetlozar N. Natov, Brian J. G. Pereira. (1994) A Dialysis Case Presentation and Discussion. Seminars in Dialysis 7:5, 360-368
CrossRef107
Nicole Simon, Anne-Marie Couroucé, Nadine Lemarrec, Christian Trépo, Stéphane Ducamp. (1994) A twelve year natural history of hepatitis C virus infection in hemodialyzed patients. Kidney International 46:2, 504-511
CrossRef108
SUGURU MATSUOKA, KATSUYOSHI TATARA, YURI USHIROGUCHI, MASAHIRO KUBO, MASAKI NII, YOSHIYUKI TAGUCHI, YASUHIRO KURODA. (1994) Importance of recall and follow-up screening for chronic hepatitis C in children receiving blood products prior to 1990 in Japan. Pediatrics International 36:4, 383-386
CrossRef109
Robert H. Purcell. (1994) Hepatitis C virus: Historical perspective and current concept. FEMS Microbiology Reviews 14:3, 181-191
CrossRef110
Ola Weiland. (1994) Interferon therapy in chronic hepatitis C virus infection. FEMS Microbiology Reviews 14:3, 279-288
CrossRef111
Jermey A. Garson. (1994) The polymerase chain reaction and hepatitis C virus diagnosis. FEMS Microbiology Reviews 14:3, 229-239
CrossRef112
Gabriele Pozzato, Suichi Kaneko, Michéle Moretti, Lory Saveria Croce, Francesco Franzin, Masashi Unoura, Luisa Bercich, Claudio Tiribelli, Marina Crovatto, Gianfranco Santini, Kenichi Kobayashi. (1994) Different genotypes of hepatitis C virus are associated with different severity of chronic liver disease. Journal of Medical Virology 43:3, 291-296
CrossRef113
D. Bresters, H. T. M. Cuypers, H. W. Reesink, E. P. Mauser-Bunschoten, H. M. van den Berg, W. P. Schaasberg, J. C. Wilber, M. S. Urdea, P. Neuwald, P. N. Lelie. (1994) Comparison of quantitative cDNA-PCR with the branched DNA hybridization assay for monitoring plasma hepatitis C virus RNA levels in haemophilia patients participating in a controlled interferon trial. Journal of Medical Virology 43:3, 262-268
CrossRef114
D. Bresters, M.E.I. Schipper, H.W. Reesink, B.D.M. Boeser-Nunnink, H.T.M. Cuypers. (1994) The duration of fixation influences the yield of HCV cDNA-PCR products from formalin-fixed, paraffin-embedded liver tissue. Journal of Virological Methods 48:2-3, 267-272
CrossRef115
Alessandra Mangia, David S. Vallari, Adrian M. Di Bisceglie. (1994) Use of confirmatory assays for diagnosis of hepatitis C viral infection in patients with hepatocellular carcinoma. Journal of Medical Virology 43:2, 125-128
CrossRef116
Michiko Shindo, Adrian M. Di Bisceglie, Jonathan Silver, Teresa Limjoco, Jay H. Hoofnagle, Stephen M. Feinstone. (1994) Detection and quantitation of hepatitis C virus RNA in serum using the polymerase chain reaction and a colorimetric enzymatic detection system. Journal of Virological Methods 48:1, 65-72
CrossRef117
Luigi Muratori, Fabrizio Giostra, Michela Cataleta, Raffaella Francesconi, Giorgio Ballardini, Fabio Cassani, Marco Lenzi, Francesco B. Bianchi. (1994) Testing for hepatitis C virus sequences in peripheral blood mononuclear cells of patients with chronic hepatitis C in the absence of serum hepatitis C virus RNA. Liver 14:3, 124-128
CrossRef118
Sergei A. Tsarev, Tatiana S. Tsareva, Suzanne U. Emerson, Patrice O. Yarbough, Llewellyn J. Legters, Thomas Moskal, Robert H. Purcell. (1994) Infectivity titration of a prototype strain of hepatitis E virus in cynomolgus monkeys. Journal of Medical Virology 43:2, 135-142
CrossRef119
J.A. Di Paolo, N.C. Popescu, D.V. Ablashi, P. Lusso, D.B. Zimonjic, C.D. Woodworth. (1994) Multistage carcinogenesis utilizing human genital cells and human papillomaviruses. Toxicology Letters 72:1-3, 7-11
CrossRef120
George G. Schlauder, Isa K. Mushahwar. (1994) Detection of hepatitis C and E virus by the polymerase chain reaction. Journal of Virological Methods 47:3, 243-253
CrossRef121
M.G. Saleh, L.M.M.B. Pereira, C.J. Tibbs, M. Ziu, M.O. Al-Fituri, R. Williams, I.G. McFarlane. (1994) High prevalence of hepatitis C virus in the normal Libyan population. Transactions of the Royal Society of Tropical Medicine and Hygiene 88:3, 292-294
CrossRef122
T. Peters, L. Mohr, F. Scheiffele, H.-J. Schlayer, S. Preisler, H. Berthold, W. Gerok, J. Rasenack. (1994) Antibodies and viremia in acute post-transfusion hepatitis C: A prospective study. Journal of Medical Virology 42:4, 420-427
CrossRef123
S. P. Dibenedetto, R. Ragusa, A. Sciacca, A. Cataldo, V. Miraglia, S. D'Amico, L. Nigro, A. M. Ippolito. (1994) Incidence and morbidity of infection by hepatitis C virus in children with acute lymphoblastic leukaemia. European Journal of Pediatrics 153:4, 271-275
CrossRef124
J. Enríquez, K. Fuchs, F. J. Martínez Cerezo, R. Seminago, P. Madoz, J. Torras, M. Roggendorf. (1994) Demonstration of HCV-RNA and HBV-DNA in the serum of HBsAg negative patients with hepatocellular carcinoma. European Journal of Epidemiology 10:2, 189-194
CrossRef125
Ho-Hsiung Lin, Hong-Yuan Hsu, Tzu-Yao Lee, Jia-Horng Kao, Pei-Jer Chen, Ding-Shinn Chen. (1994) Hepatitis C Virus Infection in Pregnant Women: Detection by Different Anti-HCV Immunoassays and Serum HCV-RNA. Asia-Oceania Journal of Obstetrics and Gynaecology 20:1, 13-18
CrossRef126
Hiroshi Nakagawa, Hiroyuki Shimomura, Toshimi Hasui, Hideyuki Tsuji, Takao Tsuji. (1994) Quantitative detection of hepatitis C virus genome in liver tissue and circulation by competitive reverse transcription-polymerase chain reaction. Digestive Diseases and Sciences 39:2, 225-233
CrossRef127
David K.H. Wong, Jenny Heathcote. (1994) The role of interferon in the treatment of viral hepatitis. Pharmacology & Therapeutics 63:2, 177-186
CrossRef128
Renate Seelig, M. Renz, Claudia Bottner, H. P. Seelig. (1994) Hepatitis C Virus Infections in Dialysis Units: Prevalence of HCV-RNA and Antibodies to HCV. Annals of Medicine 26:1, 45-52
CrossRef129
Sayah Nedjar, Freddie Mitchell, Robin Biswas. (1994) Simultaneous amplification and detection of specific hepatitis B virus and hepatitis C virus genomic sequences in serum samples. Journal of Medical Virology 42:2, 212-216
CrossRef130
Zhi Bing Yun, Olle Reichard, Margaret Chen, Joakim Lundeberg, Gunnar Norkrans, Aril Fryden, Anders Sönnerborg, Ola Weiland. (1994) Serum Hepatitis C Virus RNA Levels in Chronic Hepatitis C-Importance for outcome of interferon alfa-2b treatment. Scandinavian Journal of Infectious Diseases 26:3, 263-270
CrossRef131
J. F. Quaranta, S. R. Delaney, S. Alleman, J. P. Cassuto, P. Dellamonica, J. P. Allain. (1994) Prevalence of antibody to hepatitis C virus (HCV) in HIV-1-infected patients (nice seroco cohort). Journal of Medical Virology 42:1, 29-32
CrossRef132
P Giral, L Serfaty, A Loria, R Poupon. (1994) L'hépatite C. La Revue de Médecine Interne 15:7, 487-493
CrossRef133
Santosh K. Nanda, Kezban Yalcinkaya, Aswini K. Panigrahi, Subrat K. Acharya, Shahid Jameel, Subrat K. Panda. (1994) Etiological role of hepatitis E virus in sporadic fulminant hepatitis. Journal of Medical Virology 42:2, 133-137
CrossRef134
Maria Eliana Lai, Anna P. Mazzoleni, Patrizia Farci, Antonello Melis, Antonella Porru, Giuseppina Orgiana, Michele Arnone, Angelo Balestrieri. (1993) Markers of hepatitis C virus infection in sardinian blood donors: Relationship with alanine aminotransferase levels. Journal of Medical Virology 41:4, 282-288
CrossRef135
Giorgio Saracco, Floriano Rosina, Maria Lorena Abate, Livio Chiandussi, Vittorio Gallo, Elena Cerutti, Angelo Di Napoli, Antonio Solinas, Angelo Deplano, Andreina Tocco, Pierangela Cossu, David Chien, George Kuo, Alan Polito, Amy J. Weiner, Michael Houghton, Giorgio Verme, Ferruccio Bonino, Mario Rizzetto. (1993) Long-term follow-up of patients with chronic hepatitis C treated with different doses of interferon-α2b. Hepatology 18:6, 1300-1305
CrossRef136
M. Makris, F.E. Preston. (1993) Chronic hepatitis in haemophilia. Blood Reviews 7:4, 243-250
CrossRef137
Stanislas Pol, Valérie Thiers, Françoise Driss, Agnès Devergie, Pierre Berthelot, Christian Bréchot, Eliane Gluckman. (1993) Lack of evidence for a role of HCV in hepatitis-associated aplastic anaemia. British Journal of Haematology 85:4, 808-810
CrossRef138
Roger H. Miller, Jens Bukh, Robert H. Purcell. (1993) Importance of the polymerase chain reaction in the study of hepatitis C virus infection. International Journal of Clinical & Laboratory Research 23:1-4, 139-145
CrossRef139
Ramsey C. Cheung, Rachel T. Chan, Anna S. F. Lok. (1993) Longitudinal study of hepatitis C viremia in chronic hepatitis C. Journal of Medical Virology 41:4, 338-342
CrossRef140
TOSHINORI KODAMA, TOMOHIRO TAMAKI, SHIGEO KATABAMI, AKIO KATAMUMA, KENTARO YAMASHITA, NAOKI AZUMA, KEIICHI KAMIJO, HIROSHI KINOSHITA, AKIRA YACHI. (1993) Histological findings in asymptomatic hepatitis C virus carriers. Journal of Gastroenterology and Hepatology 8:5, 403-405
CrossRef141
Jorge J. Gumucio, W. Michael McDonnell. (1993) Gene transefer as a new mode of vaccination: Implications for HCV. Hepatology 18:3, 696-698
CrossRef142
Anna S. F. Lok, David Chien, Qui-Lim Choo, Tak-Mao Chan, Edmond K. W. Chiu, Ignatius K. P. Cheng, Michael Houghton, George Kuo. (1993) Antibody response to core, envelope and nonstructural hepatitis C virus antigens: Comparison of immunocompetent and immunosuppressed patients. Hepatology 18:3, 497-502
CrossRef143
P. Tilston, G. Corbitt. (1993) Detection of hepatitis C virus RNA in serum, by combining reverse transcription and polymerase chain reaction in one tube. Journal of Virological Methods 44:1, 57-65
CrossRef144
J. A. Garson, R. S. Tedder. (1993) The Detection of Hepatitis C Infection. Reviews in Medical Virology 3:2, 75-83
CrossRef145
B. Nalpas, V. Thiers, S. Pol, F. Driss, P. Berthelot, C. Brechot. (1993) HCV infection in alcoholics. Gastroenterologia Japonica 28:S5, 88-90
CrossRef146
T. Jake Liang, Vinod Rustgi, Eithan Galun, Hubert E. Blum. (1993) HCV RNA in patients with chronic hepatitis C treated with interferon-α. Journal of Medical Virology 40:1, 69-75
CrossRef147
Kjell Skaug, Huayi Li, Tom Ø Jonassen, Jonn Larsen, Karl J. Figenschau. (1993) Hepatitis C Virus (HCV) RNA among Anti-HCV-Positive Blood Donors and Their Recipients. Vox Sanguinis 64:4, 215-219
CrossRef148
Eiji Tanaka, Kendo Kiyosawa, Yoshiyuki Nakatsuji, Yoshimichi Inoue, Tatsuo Miyamura, Joe Chiba, Seiichi Furuta. (1993) Clinical significance of antibodies to nonstructural and core proteins of hepatitis C virus in posttransfusion hepatitis patients during long-term follow-up. Journal of Medical Virology 39:4, 318-324
CrossRef149
R. P. Hardiman, D. R. Shaw, J. T. La Brooy, L. Rozen, W. B. Boer, R. Rowland, A. M. Beardsley, E. J. Gowans. (1993) Chronic liver disease in asymptomatic hepatitis C antibody positive blood donors. Australian and New Zealand Journal of Medicine 23:2, 176-180
CrossRef150
M. Cardoso, K. Koerner, S. Epple, B. Kubanek. (1993) Prevalence of HCV-RNA-positive blood donors and correlation to ELISA and RIBA status. Annals of Hematology 66:3, 147-151
CrossRef151
Joseph M. Romeo, Paul P. Ulrich, Michael P. Busch, Girish N. Vyas. (1993) Analysis of hepatitis C virus RNA prevalence and surrogate markers of infection among seropositive voluntary blood donors. Hepatology 17:2, 188-195
CrossRef152
S. Brillanti, M. Foli, S. Gaiani, C. Masci, M. Miglioli, L. Barbara. (1993) Persistent hepatitis C viraemia without liver disease. The Lancet 341:8843, 464-465
CrossRef153
John A.J. Barbara, Jeremy A. Garson. (1993) Polymerase Chain Reaction and Transfusion Microbiology. Vox Sanguinis 64:2, 73-81
CrossRef154
Averell H. Sherker, Jr-Shin Twu, Gregory R. Reyes, William S. Robinson. (1993) Presence of viral replicative intermediates in the liver and serum of patients infected with hepatitis C virus. Journal of Medical Virology 39:2, 91-96
CrossRef155
S-J. HWANG, S-D. LEE, Y-H. W. LEE, J-C. WU, C-Y. CHAN, Y-S. HUANG, Y-J. WANG, K-J. LO. (1993) A randomized controlled clinical trial of recombinant interferon α-2b in the treatment of acute post-transfusion hepatitis C: A preliminary report. Journal of Gastroenterology and Hepatology 8:S1, S92-S98
CrossRef156
Zhi-Bing Yun, Gudrun Lindh, Ola Weiland, Bo Johansson, Anders Sönnerborg. (1993) Detection of hepatitis C virus (HCV) RNA by PCR related to HCV antibodies in serum and liver histology in swedish blood donors. Journal of Medical Virology 39:1, 57-61
CrossRef157
R. K. Chaudhary, A. Andonov, C. Maclean. (1993) Detection of hepatitis C virus infection with recombinant immunoblot assay, synthetic immunoblot assay, and polymerase chain reaction. Journal of Clinical Laboratory Analysis 7:3, 164-167
CrossRef158
N. ISHIGURO, M. TOMIMATSU, H. NAGAHARA, H. OBATA. (1992) Clinical evaluation of a newly established anti-HCV assay for the diagnosis of hepatitis C in Japan. Journal of Gastroenterology and Hepatology 7:6, 602-607
CrossRef159
Hsiang Ju Lin, Naiyi Shi, Masashi Mizokami, F. Blaine Hollinger. (1992) Polymerase chain reaction assay for hepatitis C virus RNA using a single tube for reverse transcription and serial rounds of amplification with nested primer pairs. Journal of Medical Virology 38:3, 220-225
CrossRef160
D. Brown, L. Powell, A. Morris, S. Rassam, S. Sherlock, N. McIntyre, A. J. Zuckerman, G. M. Dusheiko. (1992) Improved diagnosis of chronic hepatitis C virus infection by detection of antibody to multiple epitopes: Confirmation by antibody to synthetic oligopeptides. Journal of Medical Virology 38:3, 167-171
CrossRef161
J. Craske. (1992) Hepatitis C and non-A non-B hepatitis revisited: Hepatitis E, F and G. Journal of Infection 25:3, 243-250
CrossRef162
Massimo Puoti, Antonella Zonaro, Antonella Ravaggi, Maria Grazia Marin, Filippo Castelnuovo, Elisabetta Cariani. (1992) Hepatitis C virus RNA and antibody response in the clinical course of acute hepatitis C virus infection. Hepatology 16:4, 877-881
CrossRef163
Pereira, Brian J.G., Milford, Edgar L., Kirkman, Robert L., Quan, Stella, Sayre, Keith R., Johnson, Pamela J., Wilber, Judith C., Levey, Andrew S., . (1992) Prevalence of Hepatitis C Virus RNA in Organ Donors Positive for Hepatitis C Antibody and in the Recipients of Their Organs. New England Journal of Medicine 327:13, 910-915
Full Text164
Juan Ruiz, Bruno Sangro, José I. Cuende, Oscar Beloqui, JosBé I. Riezu-Boj, JOSé I. Herrero, Jesús Prieto. (1992) Hepatitis B and C viral infections in patients with hepatocellular carcinoma. Hepatology 16:3, 637-641
CrossRef165
Shuichi Kaneko, Seishi Murakami, Masashi Unoura, Kenichi Kobayashi. (1992) Quantitation of hepatitis C virus RNA by competitive polymerase chain reaction. Journal of Medical Virology 37:4, 278-282
CrossRef166
Elisabeth Puchhammer-Stöckl, Hanns Hofmann, Franz Martin Fink, Wolfgang Mor, Sonja Höcker-Schulz, Franz-Xaver Heinz, Christian Kunz. (1992) Prevalence of hepatitis-C virus infection in children with chronic post-transfusion hepatitis. Journal of Medical Virology 37:4, 298-302
CrossRef167
Yoshiyuki Nakatsuji, Akihiro Matsumoto, Eiji Tanaka, Hiroyuki Ogata, Kendo Kiyosawa. (1992) Detection of chronic hepatitis C virus infection by four diagnostic systems: First-generation and second-generation enzyme-linked immunosorbent assay, second-generation recombinant immunoblot assay and nested polymerase chain reaction analysis. Hepatology 16:2, 300-305
CrossRef168
L. THEILMANN, C. SOLBACH, U. TOEX, H. M. MÜLLER, E. PFAFF, G. OTTO, T. GOESER. (1992) Role of hepatitis C virus infection in German patients with fulminant and subacute hepatic failure. European Journal of Clinical Investigation 22:8, 569-571
CrossRef169
Kerill Bilght, Rachel Trowbridge, Robert Rewland, Eric Gowans. (1992) Detection of hepatitis C virus RNA by in situ hybridizaiton. Liver 12:4, 286-289
CrossRef170
H. VERBAAN, A. WIDELL, S. LINDGREN, B. LINDMARK, E. NORDENFELT, S. ERIKSSON. (1992) Hepatitis C in chronic liver disease: an epidemiological study based on 566 consecutive patients undergoing liver biopsy during a 10-year period. Journal of Internal Medicine 232:1, 33-42
CrossRef171
Michiko Shindo, Adrian M. di Bisceglie, Jay H. Hoofnagle. (1992) Long-term follow-up of patients with chronic hepatitis C treated with α-interferon. Hepatology 15:6, 1013-1016
CrossRef172
Anna S. F. Lok, Ramsey Cheung, Rachel Chan, Vincent Liu. (1992) Hepatitis C viremia in patients with hepatitis C virus infection. Hepatology 15:6, 1007-1012
CrossRef173
Daniel W. Bradley, Michael J. Beach, Michael A. Purdy. (1992) Recent developments in the molecular cloning and characterization of hepatitis C and E viruses. Microbial Pathogenesis 12:6, 391-398
CrossRef174
Kelen, Gabor D., Green, Gary B., Purcell, Robert H., Chan, Daniel W., Qaqish, Bahjat F., Sivertson, Keith T., Quinn, Thomas C., . (1992) Hepatitis B and Hepatitis C in Emergency Department Patients. New England Journal of Medicine 326:21, 1399-1404
Full Text175
George G. Schlauder, Gail J. Leverenz, Lars Mattsson, Ola Weiland, Isa K. Mushahwar. (1992) Detection of hepatitis C viral RNA by the polymerase chain reaction in serum of patients with post-transfusion non-A, non-B hepatitis. Journal of Virological Methods 37:2, 189-199
CrossRef176
M. Sugitani, G. Inchauspé, A.M. Prince, M. Shindo. (1992) Sensitivity of serological assays to identify blood donors with hepatitis C viraemia. The Lancet 339:8800, 1018-1019
CrossRef177
Tiziana Giuberti, Carlo Ferrari, Silvia Marchelli, Anna Maria Degli Antoni, Claudia Schianchi, Paelo Pizzaferri, France Fiaccadori. (1992) Long-term follow-up of anti-hepatitis C virus antibodies in patients with acute nonA nonB hepatitis and different outcome of liver disease. Liver 12:2, 94-99
CrossRef178
Daniel W. Bradley. (1992) Virology, Molecular Biology, and Serology of Hepatitis C Virus. Transfusion Medicine Reviews 6:2, 93-102
CrossRef179
Michael J. Beach, Emory L. Meeks, Larry T. Mimms, David Vallari, Louise Ducharme, John Spelbring, Suhas Taskar, Joseph B. Schleicher, Krzysztof Krawczynski, Daniel W. Bradley. (1992) Temporal relationships of hepatitis C virus RNA and antibody responses following experimental infection of chimpanzees. Journal of Medical Virology 36:3, 226-237
CrossRef180
(1992) Transmission of HCV by Organ Transplantation. New England Journal of Medicine 326:6, 410-413
Full Text181
Jonathan Brown, Spyros Dourakis, Peter Karayiannis, Robert Goldin, Joe Chiba, Hiroyoshi Ohba, Tatsuo Miyamura, Howard C. Thomas. (1992) Seroprevalence of hepatitis C virus nucleocapsid antibodies in patients with cryptogenic chronic liver disease. Hepatology 15:2, 175-179
CrossRef182
(1992) Hepatitis C Virus Replication. New England Journal of Medicine 326:1, 64-66
Full Text183
W. Prohaska, E. Schroeter, Petra Kaars-Wiele, K. Kleesiek. (1992) Enzyme Immunoassays for Anti-Hepatitis C Virus Antibodies Improved Specificity and Analytical Sensitivity by Combination of Three Different Recombinant Viral Proteins in Second Generation Tests. Clinical Chemistry and Laboratory Medicine 30:7, 397-404
CrossRef184
Renate Seelig, Manfred Renz, Hans P. Seelig. (1992) PCR in the Diagnosis of Viral Hepatitis. Annals of Medicine 24:3, 225-230
CrossRef185
G. G. Frösner. (1991) Sensitivity of second generation anti-HCV test for diagnosis of acute hepatitis C. Infection 19:6, 434-434
CrossRef
- Letters
