Original Article
Mutation of the Prion Protein in Libyan Jews with Creutzfeldt–Jakob Disease
N Engl J Med 1991; 324:1091-1097April 18, 1991
- Abstract
- Abstract
Background.
Creutzfeldt—Jakob disease is a transmissible neurodegenerative disorder that occurs more than 100 times more frequently among Libyan Jews than in the worldwide population. We examined 11 patients with the disease — 10 Libyan Jews from Israel and 1 Libyan Jew from Italy — to determine whether abnormalities of the prion protein could be detected in them. Abnormal forms of this host-encoded protein are the predominant if not sole components of the transmissible agent that causes the disease.
Methods.
The prion-protein open-reading frame in peripheral-leukocyte DNA from the Italian patient was amplified with the polymerase chain reaction and sequenced. Allele-specific oligonucleotide hybridization was used to assess a prion-protein codon 200 lysine mutation in the 10 Israeli patients and 37 control subjects.
Results.
The prion-protein sequence in DNA from the Italian patient revealed a single nucleotide change (G→A) at the first position of codon 200 that resulted in a substitution of lysine for glutamate. This substitution was detected in all 10 Israeli patients, 8 of whom had a positive family history of Creutzfeldt—Jakob disease. One patient was homozygous for the lysine mutation, and her clinical course did not differ from that of the patients heterozygous for the mutation. The lysine mutation was not found in one Moroccan Jew from Israel with Creutzfeldt—Jakob disease.
Conclusions.
The codon 200 lysine mutation of the prion-protein gene is consistently present among Libyan Jews with Creutzfeldt—Jakob disease, strongly supporting a genetic pathogenesis of their illness. The similarity of the clinical courses of the patient homozygous for this mutation and the patients heterozygous for it argues that familial Creutzfeldt—Jakob disease is a true dominant disorder. (N Engl J Med 1991; 324:1091–7.)
Article Activity
- Article
CREUTZFELDT—JAKOB disease, a transmissible neurodegenerative disorder of humans, has a worldwide incidence of 1 to 2 cases per million population, with a few exceptions.1 , 2 Among Libyan Jews it occurs more than 100 times more frequently, at a rate of about 1 case per 10,000 population (Kahana E: unpublished data). We have systematically studied patients from several Israeli communities of Libyan Jews and an Italian Libyan Jew, all of whom had Creutzfeldt—Jakob disease, in an attempt to determine the basis for this discrepancy.
The cultural or culinary practices of Libyan Jews have been invoked to explain their high incidence of the disorder. The favorite culprit has been lightly cooked sheep brain,3 4 5 6 a delicacy consumed not only by Libyan Jews but by all Mediterranean Jews. The consumption of sheep eyeballs has also been proposed as a mode of transmission.7 Transmission through consumption of sheep brain was an attractive hypothesis because ritualistic cannibalism, including eating brains, is thought to be responsible for the spread of kuru among the Fore people of New Guinea.8 , 9 Recently, oral transmission of scrapie has been invoked as the cause of bovine spongiform encephalopathy, or "mad cow disease." 10 Scrapie is a transmissible neurodegenerative disease of sheep similar to Creutzfeldt—Jakob disease; however, there is no evidence that the flocks whose meat has been eaten by Libyan Jews have a higher than usual incidence of scrapie. In fact, scrapie appears largely confined to flocks in Europe and North America and may have spared flocks in the Middle East and North Africa.11 , 12 Libyan Jews are indistinguishable from other Sephardic Jews in their other cultural or culinary practices. Therefore, on closer examination, none of the living habits of the Libyan Jews appear to be responsible for their high incidence of Creutzfeldt—Jakob disease. Moreover, the high incidence is not related to their nation of origin, since the incidence of the disease among non-Jews in Libya appears to be similar to the incidence worldwide.13
These epidemiologic considerations led us to investigate the possibility that Creutzfeldt—Jakob disease is a genetic disorder in Libyan Jews. We were encouraged by previous work demonstrating an association of various mutations in prion protein with some cases of familial Creutzfeldt—Jakob disease and a related disease, Gerstmann—Sträussle—-Scheinker syndrome.14 15 16 17 18 19 20 21 22 Prion protein is a host-encoded protein whose function is not known; the modified forms described in these diseases are thought to be the major if not sole components of the agents responsible for transmission. Furthermore, a missense variant of prion protein exhibited significant genetic linkage to Gerstmann—Sträussler—Scheinker disease.14 While our studies were under way, we learned that the same prion-protein codon 200 lysine variant that we found in our studies of Libyan Jews had been found in other Mediterranean Sephardic Jews with Creutzfeldt—Jakob disease, including four of Libyan origin.23 Our findings agree with those findings and provide a more complete historical, statistical, epidemiologic, and genetic analysis.
Methods
Clinical Histories and Pathological Examinations
Patients
The clinical courses and the results of pathological examinations of 11 Libyan Jews with Creutzfeldt—Jakob disease — 10 from Israel and 1 from Italy — and of 1 Moroccan Jew with the disorder are summarized in Table 1Table 1
Clinical and Laboratory Findings in Patients with Creutzfeldt—Jakob Disease.*. The patients living in Israel represented a sample of patients followed for 1 1/2 years; patients with Creutzfeldt—Jakob disease have been followed serially since 1963, when the first was identified. Since then, the disorder has been documented in more than 160 patients (Kahana E: unpublished data). A family history of confirmed Creutzfeldt—Jakob disease was elicited in 9 of the 11 patients. Accurate medical histories predating immigration to Israel or Italy were difficult or impossible to obtain. The Moroccan Jew (Patient 12) had no family history of the disorder.All patients met the established criteria for Creutzfeldt—Jakob disease,24 including rapidly progressive dementia with pyramidal, cerebellar, or extrapyramidal signs; myoclonus; periodic complexes of 1 to 2 cycles per second on electroencephalographic examination; and a duration of illness of less than 12 months. Computerized axial tomography and magnetic resonance imaging of the brain as well as analysis of cerebrospinal fluid gave normal results in all patients. Neuropathological examination by means of light microscopy of brain tissue obtained at biopsy or autopsy was performed in four patients. Immunoblotting of the tissue was performed before and after digestion with proteinase K according to a previously described method.25 Abnormal forms of prion protein characteristically are resistant to proteinase K digestion, whereas normal prion protein is readily hydrolyzed by the enzyme.
Controls
The 37 unrelated Libyan Jews selected for the control sample met the following criteria: they had no personal or family history of neurologic disease, and they were older than the oldest Libyan Jew with confirmed Creutzfeldt—Jakob disease — i.e., more than 66 years old.
Genetic Studies
DNA Extraction and Amplification of the Prion-Protein OpenReading Frame
A leukocyte pellet was obtained by centrifugation of 10 ml of whole blood anticoagulated with EDTA or citrate to which 40 ml of 0.144 M ammonium chloride and 0.5 ml of 0.1 M ammonium bicarbonate had been added to lyse the erythrocytes.
DNA was obtained by lysis of the leukocyte pellet with 9.4 ml of a solution containing 150 mM sodium chloride, 50 mM TRIS–hydrochloric acid (pH 7.5), and 1 mM EDTA, 0.1 ml of proteinase K (10 mg per milliliter), and 0.5 ml of sodium dodecyl sulfate (10 percent wt/vol). The mixture was shaken gently by hand or mechanically for 30 minutes at room temperature and then incubated for 30 minutes at 55°C. The aqueous phase was extracted with phenolchloroform and carefully removed so that the interphase was not disturbed. DNA was precipitated from the aqueous phase with 1 ml of sodium acetate (2 M) and 20 ml of ethanol at room temperature, and spooled with a sterile pipette. After rinsing in 5 to 10 ml of 70 percent ethanol, the DNA was dissolved by incubation for several hours at 55°C in 0.5 to 1 ml of 10 mM TRIS (pH 7.5) with 1 mM EDTA.
The prion-protein open-reading frame of genomic leukocyte DNA was amplified with use of the polymerase chain reaction and thermostable Taq polymerase. The primers used, H and K, were respectively 5′AAGGATCCCTCAAGCTGGAAAAAGA 3′ (antisense) and 5′AAGAATTCTCTGACATTCTCCTCTTCA 3′ (sense) (Fig. 1Figure 1
Prion-Protein—Gene Point Mutation at Codon 200 in Libyan Jews with Creutzfeldt—Jakob Disease.). H and K contain BamHI and EcoRI linkers, respectively. Genomic DNA (1.5 μg) was amplified in a reaction volume of 100 μl with 500 ng each of the primers, 10 μl of the reaction buffer for the polymerase chain reaction (Cetus), 10 μl of a 2 mM nucleotide solution (deoxyadenosine triphosphate, deoxyguanosine triphosphate, deoxythymidine triphosphate, and deoxycytidine triphosphate), 2 μl of 50 mM EDTA (pH 8.0), and 2.5 units of Taq polymerase. The sample was overlaid with mineral oil to prevent evaporation, and cycling reactions were performed in a DNA Thermal Cycler (Perkin—Elmer Cetus). The cycles were as follows: 94°C for 1 minute, 50°C for 30 seconds, and 72°C for 2 minutes 30 seconds, for 5 cycles; then 94°C for 1 minute, 55°C for 30 seconds, and 72°C for 2 minutes 30 seconds, for 30 cycles. After amplification, the reaction product was fractionated on a 4 percent 3:1 NuSieve/SeaKern agarose gel and examined for the presence of the appropriate 864—base-pair fragment. This fragment was excised from the gel and purified with GeneClean (Bio 101) for sequencing. The unfractionated reaction product was used for allele-specific oligonucleotide hybridization.DNA Sequencing
Sequencing reactions were performed on gel-purified products of the polymerase chain reaction, according to the Sanger dideoxy method and the Sequenase DeazaG sequencing reagent kit (U.S. Biochemical). Double-stranded template DNA was denatured at 98°C for eight minutes in the presence of primer before chain extension. The four primers used to sequence the prion-protein open-reading frame were KH02, 5′CAGGGCAGCCCTGGAGGCAA 3′ (sense); KH03, 5′AAGGAGGTGGCACCCACAGT 3′ (sense); KH06, 5′TCCCTCAAGCTGGAAAAAGA 3′(antisense); and KH07, 5′CTCTGACATTCTCCTCTTCA 3′(sense). The amount of DNA used per reaction was 100 ng, with 60 ng of primers KH03 and KH06 and 120 ng of primers K.H02 and KH07.
Allele-Specific Oligonucleotide Hybridization
DNA in 20 ptl of polymerase-chain-reaction product was denatured in 180 μl of the TRIS—EDTA solution (pH 8.0) and 20 μl of 3 N sodium hydroxide at room temperature for 10 minutes. After neutralization with 200 μl of 2 M ammonium acetate, DNA was immobilized on nitrocellulose filters with a slot blot or dot blot apparatus. Duplicate filters immersed in hybridization solution (3× SSPE [440 mM sodium chloride, 32 mM sodium phosphate, 3 mM EDTA], 5× Denhardt's solution, 0.5 percent sodium dodecyl sulfate, and 500 mg of sheared salmon-sperm DNA per milliliter) were probed for one hour at 42°C with either of two wild-type 15mer probes, designated HUE200, 5′AACTTCACCGAGACC3′, and HU2E200, 5′GGTCTCGGTGAAGTT3′, and with the mutant probe HUK200, 5′GGTCTTGGTGAAGTT3′, Radio-labeled with 32P, with the use of T4 polynucleotide kinase. The filters were rinsed twice at room temperature with 2× SSPE and 0.1 percent sodium dodecyl sulfate and washed twice with 2× SSPE and 0.1 percent sodium dodecyl sulfate for 10 minutes each at 42°C. The signal of the hybridizing probe was detected on x-ray film after one to two hours of exposure.
Results
Ancestral Origins of the Patients
In each case in which information about ancestral origin was available, the patient's family was traced to the island of Djerba off the coast of Tunisia. Accurate family histories were sometimes difficult to obtain; for example, the families of Patients 1 and 4 were uncooperative in this regard.
Clinical Course
The ages of the 11 patients ranged from 35 to 66 years (mean ±SD, 53±11 years). The duration of illness ranged from 3 to 10 months (mean, 5±2 months). The patient with the 10-month course has been in a coma and receiving mechanical ventilation for 8 months. All patients presented with rapidly progressive dementia, and all subsequently had myoclonus. Spasticity and rigidity accompanied the dementia later in the course, with ataxia in some patients.
Neuropathologlcal and Immunoblot Findings
Neuropathological examination of brain tissue from four patients revealed spongiform degeneration and gliosis but no formation of amyloid plaques (Fig. 2Figure 2
Photomicrograph of a Histologie Section of Frontal Cortex from Patient 3, Showing Spongiform Change (Hematoxylin and Eosin, ×130).). Immunoblots of brain extracts exposed to prion-protein antiserum demonstrated protease-resistant prion proteins25 26 27 in all four patients studied; Figure 3Figure 3
Immunoblot Demonstrating Protease-Resistant Prion Protein in Brain Tissue from Three Patients with the Codon 200 Mutation Who Died of Creutzfeldt—Jakob Disease. shows the results in three. These results confirmed the clinical diagnosis of Creutzfeldt—Jakob disease in these patients.Molecular Genetics
Sequencing of the amplified open-reading frame of the prion-protein gene from the Libyan Jew from Italy (Patient 9) revealed a G-to-A change in the first position of codon 200 in one allele, which resulted in a substitution of lysine for glutamate. No other mutations were found.28 Although the mutation at codon 200 eliminated a unique BsmAl restriction site within the open-reading frame of the prion-protein gene, digestions with this enzyme were frequently incomplete, and therefore the results did not reliably identify codon 200 haplotypes in samples with known haplotypes ascertained through DNA sequencing. In the other cases, the codon 200 haplotypes were determined by allele-specific oligonucleotide hybridization.
The results of DNA dot blotting in samples from the 37 control subjects and 11 patients led us to conclude that a prion-protein—gene codon 200 lysine substitution was present in every Libyan Jew with Creutzfeldt—Jakob disease, but not in Libyan Jews without the disease or in the Moroccan Jew with the disorder (Patient 12) (Table 1 and Fig. 4Figure 4
Allele-Specific Oligonucleotide Hybridization.). All patients but one (Patient 6) were heterozygous for this substitution. This patient was the only patient known to be homozygous for a disease-associated prion-protein—gene mutation. Her clinical course and age at onset of symptoms did not differ appreciably from those of the other patients.The codon 200 haplotypes of four pedigrees are shown in Figures 5Figure 5
Pedigree of Libyan Jewish Family M with Creutzfeldt—Jakob Disease. and 6Figure 6
Pedigrees of Three Libyan Jewish Families with Creutzfeldt—Jakob Disease.. In all four families, the lysine at codon 200 "tracked" with the disease. The codon 200 lysine substitution also was found in some healthy members of Families M, Z, and G, who are at risk for disease, and in all four offspring of the homozygous patient in Family G (Fig. 6).A chi-square analysis of the codon 200 lysine haplotype in Libyan Jews revealed a significant association of this haplotype with Creutzfeldt—Jakob disease (chi-square = 42, P<0.001).
Discussion
We have demonstrated that Creutzfeldt—Jakob disease in Libyan Jews consistently occurs in persons with a prion-protein codon 200 lysine haplotype, strongly supporting a genetic cause for the pathogenesis of their illness. These results dispel the widely held belief that their disease is due to cultural or culinary habits.
The codon 200 lysine haplotype of the prion-protein gene has also been found in Greek and Tunisian Jews with Creutzfeldt—Jakob disease,23 a finding that could be predicted from historical migration patterns of Libyan Jews and Jews from Djerba, a Tunisian island. Djerban Jews and Libyan Jews in Tripoli associated freely and engaged in maritime trade with other Mediterranean Jews, notably in Greece and in Livorno, Italy. The formation of the state of Israel in 1948 led to a massive worldwide movement of Jews to Israel, including most of those living in Libya and Djerba. Later, the independence of Tunisia from French colonial rule and of Libya from Italian colonial rule caused the migration of most of the remaining local Jews to France, Italy, and Israel.
The nearly 30,000 Jews who migrated from Libya formed small, tightly knit communities in Israel. Many of them now live in the Israeli towns of Ashkelon and Natania. By contrast, 1 million Sephardic Jews from Morocco are now dispersed throughout Israel. The prevalence of Creutzfeldt—Jakob disease in this large community of Moroccan Jews is no higher than the prevalence worldwide, approximately one to two cases per million population. The scourge of Creutzfeldt—Jakob disease in the small community of Libyan Jews living in Israel is especially salient against this background, now having reached the unprecedented rate of one new case every other month during the past two years.
A large cluster of cases of Creutzfeldt—Jakob disease in Czechoslovakia is associated with the prion-protein codon 200 lysine haplotype,22 but there appears to be no common ancestry between Libyan Jews and Slovaks with the disorder. The codon 200 lysine mutation may have resulted from deamination of deoxycytidine—phosphate—deoxyguanosine and the subsequent formation of deoxythymidine—phosphate—deoxyguanosine (in the negative DNA strand). This mutation, which occurs frequently in mammalian DNA,29 could explain how the same mutation developed independently in two geographically separate populations.
In some families of Libyan Jews the onset of symptoms of Creutzfeldt—Jakob disease occurred at younger ages in successive generations. This phenomenon, called anticipation, has been observed in other diseases, including Huntington's disease30 and myotonic dystrophy.31 It has also been observed in mice bearing prion-protein transgenes containing a codon 101 leucine Substitution, the murine equivalent of the codon 102 of the prion-protein—gene leucine substitution linked to Gerstmann—Sträussler—Scheinker disease.32 The molecular mechanism by which anticipation occurs is not understood.
The finding that Patient 6 (Table 1 and Fig. 6) was homozygous for codon 200 of the prion-protein—gene lysine haplotype and had clinical symptoms similar to those in heterozygous patients argues that, like Huntington's disease,33 inherited Creutzfeldt—Jakob disease displays complete phenotypic dominance. It also demonstrates that a normal copy of the prion-protein gene is not required for fetal viability or for normal growth and development through young adulthood. Finally, it argues against the possibility that the disease is triggered in heterozygous patients when a recessive, somatic mutation disables the wild-type prion-protein allele.
Two members of Family M (Subjects V-15 and V-23, 68 and 66 years old, respectively) have the prion-protein codon 200 lysine haplotype but no signs of illness to date (Fig. 5). One interpretation of this finding is that the prion-protein codon 200 mutation is insufficient to cause illness. Alternatively, other genes that delay the onset of the illness may be present, since genes both linked and unlinked to the prion-protein gene are known to influence the incubation times of scrapie in mice.34 35 36 37 38
Three other mutations in the prion-protein gene are associated with disease. A codon 102 leucine substitution is genetically linked to Gerstmann—Sträussler—Scheinker disease with a lod score of approximately 4.5.14 , 18 This mutation is almost certainly more than just a linked genetic marker, since spongiform neurodegeneration develops spontaneously in transgenic mice with the mutation.32 Two other mutations — a codon 117 valine substitution and insertions of six tandem repeat sequences at codon 53 — segregate with CreutzfeldtJakob disease in small families.17 , 19 , 39 , 40 Linkage data for these mutations are not available because of the small size of the corresponding pedigrees. However, in view of the significant lod scores in families with Gerstmann—Sträussler—Scheinker disease and the biologic activity of the codon 102 mutation in transgenic mice, it is likely that these mutations also directly influence the pathogenesis of disease. It should be possible to test the biologic activity of these mutations and the codon 200 lysine mutation in transgenic mice. The development of spontaneous neurodegeneration in these mice would underscore the central role of prion protein in the pathogenesis of Creutzfeldt—Jakob disease and Gerstmann—Sträussler—Scheinker disease.
The incidence of Creutzfeldt—Jakob disease among Libyan Jews in Israel has increased from 31 cases to more than 75 cases per million per year during the past two decades,1 in part because increased longevity has permitted late onset of disease in the middle-aged and elderly. Younger Libyan Jews are marrying outside their ethnic community, with the inevitable result that the autosomal dominant familial Creutzfeldt—Jakob disease associated with the codon 200 of the prion-protein—gene lysine mutation will spread in Israeli and other communities. In this setting, prenatal diagnostic testing warrants serious consideration as a measure to control the increased phenotypic expression and spread of the prion-protein—lysine mutation within and outside the Libyan Jewish community.
Supported by research grants from the Israeli Ministry of Health, the American Health Assistance Foundation, and the National Institutes of Health (AG-02132, NS-14069, AG-08967, and NS-22786). Dr. Hsiao is the recipient of awards from the National Institutes of Health, the Bernard Osher Philanthropic Fund, the Culpeper Foundation, the California Alzheimer's Disease Program, and the Alzheimer's Disease and Related Disorders Association.
We are indebted to Professors Adam Friedman and Dov Safer and the Hadassah Molecular Biology Unit for technical help and advice; to the staffs of the neurologic departments and units of the hospitals (Tel Hashomer, Tel Aviv; Beilinson, Petach Tikva; Soroka, Beer Sheva; Ziv, Safed; Mcir, Klar Saba; and Hasharon, Petach Tikva), who collaborated with us in collecting data about the patients, to Drs. Claudio Miriani and Nereo Bresolin for their help; and to Jurg Ott for helpful discussions.
Source Information
From the Departments of Neurology (K.H., C.C., S.B.P.) and Biochemistry and Biophysics (S.B.P.), University of California, San Francisco; the Department of Neurology, Hadassah University Hospital, Jerusalem, Israel (Z.M., I.K., D.A., O.A., R.G.); Barzilai Medical Center and Ben Gurion University of the Negev, Ashkelon, Israel (E.K.); and Universkà di Milano, Ospedale Maggiore—Policlinico, Istituto di Clinica Neurologica, Milan, Italy (G.S.). Address reprint requests to Dr. Gabizon at the Department of Neurology, Hadassah University Hospital, Ein Karem, 91120 Jerusalem, Israel.
- References
References
1
Kahana
CrossRef | Web of Science | Medline2
Brown
Web of Science | Medline3
Goldberg H, Alter M, Kahana E. The Libyan Jewish focus of CreutzfeldtJakob disease: a search for the mode of natural transmission. In: Prusiner SB, Hadlow WJ, eds. Slow transmissible diseases of the nervous system. Vol. 1. New York: Academic Press, 1979:195–211.
4
Masters
CrossRef | Web of Science | Medline5
Alter
CrossRef | Web of Science6
Alter
CrossRef | Web of Science7
Herzberg
CrossRef | Web of Science | Medline8
Alpers
Web of Science | Medline9
Gajdusek
CrossRef | Medline10
Wilesmith
Web of Science | Medline11
Masters CL, Gajdusek DC, Gibbs CJ Jr, Bernoulli C, Asher DM. Familial Creutzfeldt-Jakob disease and other familial dementias: an inquiry into possible models of virus-induced familial diseases. In: Prusiner SB, Hadlow WJ, eds. Slow transmissible diseases of the nervous system. Vol. 1. New York: Academic Press, 1979:143–94.
12
Parry HB. Recorded occurrences of scrapie from 1750. In: Oppenheimer DR, ed. Scrapie disease in sheep. New York: Academic Press, 1983:31–59.
13
Radhakrishnan
CrossRef | Web of Science | Medline14
Hsiao
CrossRef | Web of Science | Medline15
Hsiao
Web of Science16
Doh-ura
CrossRef | Web of Science | Medline17
Owen
CrossRef | Web of Science | Medline18
Goldgaber
CrossRef | Web of Science | Medline19
Hsiao 20
Hsiao
Web of Science | Medline21
Collinge
CrossRef | Web of Science | Medline22
Goldfarb
CrossRef | Web of Science | Medline23
Goldfarb
CrossRef | Web of Science | Medline24
Brown
CrossRef | Web of Science | Medline25
Serban
Web of Science | Medline26
Bockman
Full Text | Web of Science | Medline27
Bockman
CrossRef | Web of Science | Medline28
Kretzschmar
CrossRef | Medline29
Barker
CrossRef | Web of Science | Medline30
Ridley
CrossRef | Web of Science | Medline31
Howeler
CrossRef | Web of Science | Medline32
Hsiao
CrossRef | Web of Science | Medline33
Wexler
CrossRef | Web of Science | Medline34
Dickinson
CrossRef | Web of Science | Medline35
Carlson
CrossRef | Web of Science | Medline36
Hunter
CrossRef | Web of Science | Medline37
Race
CrossRef | Web of Science | Medline38
Carlson
Web of Science | Medline39
Owen
CrossRef | Medline40
Collinge
CrossRef | Web of Science | Medline
- Citing Articles (78)
Citing Articles
1
Tamar Canello, Yael Friedman-Levi, Michal Mizrahi, Orli Binyamin, Eran Cohen, Kati Frid, Ruth Gabizon. (2011) Copper is toxic to PrP-ablated mice and exacerbates disease in a mouse model of E200K genetic prion disease. Neurobiology of Disease
CrossRef2
Piero Parchi, Pierluigi Gambetti, Sabina Capellari. 2011. Genetic Creutzfeldt-Jakob Disease. , 336-345.
CrossRef3
Zeev Meiner, Esther Kahana, Fanny Baitcher, Amos D. Korczyn, Joab Chapman, Oren S. Cohen, Ron Milo, Judith Aharon-Perez, Oded Abramsky, Ruth Gabizon, Hanna Rosenmann. (2011) Tau and 14-3-3 of genetic and sporadic Creutzfeldt–Jakob disease patients in Israel. Journal of Neurology 258:2, 255-262
CrossRef4
Oren S. Cohen, Joab Chapman, Hedok Lee, Zeev Nitsan, Shmuel Appel, Chen Hoffman, Hanna Rosenmann, Amos D. Korczyn, Isak Prohovnik. (2011) Pruritus in familial Creutzfeldt–Jakob disease: a common symptom associated with central nervous system pathology. Journal of Neurology 258:1, 89-95
CrossRef5
Gabor G. Kovacs, Jérémie Seguin, Isabelle Quadrio, Romana Höftberger, István Kapás, Nathalie Streichenberger, Anne Gaëlle Biacabe, David Meyronet, Raf Sciot, Rik Vandenberghe, Katalin Majtenyi, Lajos László, Thomas Ströbel, Herbert Budka, Armand Perret-Liaudet. (2011) Genetic Creutzfeldt-Jakob disease associated with the E200K mutation: characterization of a complex proteinopathy. Acta Neuropathologica 121:1, 39-57
CrossRef6
S. A. Appel, J. Chapman, E. Kahana, H. Rosenmann, I. Prohovnik, E. Pras, H. Reznik-Wolf, O. S. Cohen. (2010) Rapidly progressive Creutzfeldt-Jakob disease in patients with Familial Mediterranean Fever. European Journal of Neurology 17:6, 861-865
CrossRef7
Matthias Schmitz, Markus Schlomm, Badrul Hasan, Michael Beekes, Eva Mitrova, Carsten Korth, Andreas Breil, Julie Carimalo, Joanna Gawinecka, Daniela Varges, Inga Zerr. (2010) Codon 129 polymorphism and the E200K mutation do not affect the cellular prion protein isoform composition in the cerebrospinal fluid from patients with Creutzfeldt-Jakob disease. European Journal of Neuroscience 31:11, 2024-2031
CrossRef8
Adriano Aguzzi. 2010. Prions of Humans and Animals. .
CrossRef9
Oren S. Cohen, Chen Hoffmann, Hedok Lee, Joab Chapman, Robert K. Fulbright, Isak Prohovnik. (2009) MRI Detection of the Cerebellar Syndrome in Creutzfeldt–Jakob Disease. The Cerebellum 8:3, 373-381
CrossRef10
Holger Wille, Michael A. Baldwin, Fred E. Cohen, Stephen J. DeArmond, Stanley B. Prusiner. 2007. Prion Protein Amyloid: Separation of Scrapie Infectivity from PrP Polymers. , 181-204.
CrossRef11
R. Engelstein, H. Ovadia, R. Gabizon. (2007) Copaxone interferes with the PrP Sc ?GAG interaction. European Journal of Neurology 14:8, 877-884
CrossRef12
Robert K. Fulbright, Peter B. Kingsley, Xiaodong Guo, Chen Hoffmann, Esther Kahana, Joab C. Chapman, Isak Prohovnik. (2006) The imaging appearance of Creutzfeldt–Jakob disease caused by the E200K mutation. Magnetic Resonance Imaging 24:9, 1121-1129
CrossRef13
Stanley B. Prusiner. 2006. Prions. .
CrossRef14
Michele Halimi, Yael Dayan-Amouyal, Zehavit Kariv-Inbal, Yael Friedman-Levi, Tehila Mayer-Sonnenfeld, Ruth Gabizon. (2006) Prion urine comprises a glycosaminoglycan-light chain IgG complex that can be stained by Congo red. Journal of Virological Methods 133:2, 205-210
CrossRef15
Alexander H. Peden, Diane L. Ritchie, Mark W. Head, James W. Ironside. (2006) Detection and Localization of PrPSc in the Skeletal Muscle of Patients with Variant, Iatrogenic, and Sporadic Forms of Creutzfeldt-Jakob Disease. The American Journal of Pathology 168:3, 927-935
CrossRef16
Tehila Mayer-Sonnenfeld, Marsha Zeigler, Michele Halimi, Yael Dayan, Christian Herzog, Corinne I. Lasmezas, Ruth Gabizon. (2005) The metabolism of glycosaminoglycans is impaired in prion diseases. Neurobiology of Disease 20:3, 738-743
CrossRef17
Adriano Aguzzi. 2005. Prion Disorders. .
CrossRef18
Zehavit Kariv-Inbal, Michele Halimi, Yael Dayan, Roni Engelstein, Ruth Gabizon. (2005) Characterization of light chain immunoglobulin in urine from animals and humans infected with prion diseases. Journal of Neuroimmunology 162:1-2, 12-18
CrossRef19
Gideon Shaked, Ruth Gabizon. 2003. In Vivo Diagnosis of Prion Diseases. .
CrossRef20
Peter Hedera, R.Scott Turner. (2002) Inherited dementias. Neurologic Clinics 20:3, 779-808
CrossRef21
Damian C. Crowther. (2002) Familial conformational diseases and dementias. Human Mutation 20:1, 1-14
CrossRef22
Yaakov Levy, Oren M. Becker. (2002) Conformational polymorphism of wild-type and mutant prion proteins: Energy landscape analysis. Proteins: Structure, Function, and Genetics 47:4, 458-468
CrossRef23
Markus Glatzel, Vladimir Pekarik, Thorsten Lührs, John Dittami, Adriano Aguzzi. (2002) Analysis of the Prion Protein in Primates Reveals a New Polymorphism in Codon 226 (Y226F). Biological Chemistry 383:6, 1021-1025
CrossRef24
Peter Mastrangelo, David Westaway. (2001) The prion gene complex encoding PrPC and Doppel: insights from mutational analysis. Gene 275:1, 1-18
CrossRef25
H. Rosenmann, G. Talmor, M. Halimi, A. Yanai, R. Gabizon, Z. Meiner. (2001) Prion protein with an E200K mutation displays properties similar to those of the cellular isoform PrPC. Journal of Neurochemistry 76:6, 1654-1662
CrossRef26
Dawn L. Rymer, Theresa A. Good. (2000) The Role of Prion Peptide Structure and Aggregation in Toxicity and Membrane Binding. Journal of Neurochemistry 75:6, 2536-2545
CrossRef27
Sabina Capellari, Piero Parchi, Claudio M. Russo, Jeremy Sanford, Man-Sun Sy, Pierluigi Gambetti, Robert B. Petersen. (2000) Effect of the E200K Mutation on Prion Protein Metabolism. The American Journal of Pathology 157:2, 613-622
CrossRef28
C J Lueck, G G McIlwaine, M Zeidler. (2000) Creutzfeldt-Jakob disease and the eye. I. Background and patient management. Eye 14:3a, 263-290
CrossRef29
Joël Zlotogora, Gideon Bach, Arnold Munnich. (2000) Molecular Basis of Mendelian Disorders among Jews. Molecular Genetics and Metabolism 69:3, 169-180
CrossRef30
E. S. Simon, E. Kahana, J. Chapman, T. A. Treves, R. Gabizon, H. Rosenmann, N. Zilber, A. D. Korczyn. (2000) Creutzfeldt-Jakob disease profile in patients homozygous for the PRNP E200K mutation. Annals of Neurology 47:2, 257-260
CrossRef31
M. Füzi. (1999) Is the pathogen of prion disease a microbial protein?. Medical Hypotheses 53:2, 91-102
CrossRef32
Hee Suk Lee, Nyamkhishig Sambuughin, Larisa Cervenakova, Joab Chapman, Maurizio Pocchiari, Svetlana Litvak, Hai Yan Qi, Herbert Budka, Teodoro del Ser, Hisako Furukawa, Paul Brown, D. Carleton Gajdusek, Jeffrey C. Long, Amos D. Korczyn, Lev G. Goldfarb. (1999) Ancestral Origins and Worldwide Distribution of the PRNP 200K Mutation Causing Familial Creutzfeldt-Jakob Disease. The American Journal of Human Genetics 64:4, 1063-1070
CrossRef33
J. Mikol. (1999) Neuropathology of prion diseases. Biomedicine & Pharmacotherapy 53:1, 19-26
CrossRef34
Jacqueline Chatelain, Nicole Delasnerie-Laupretre, Marie-Helene Lemaire, Francoise Cathala, Jean-Marie Launay, Jean-Louis Laplanche. (1998) Cluster of Creutzfeldt-Jakob disease in France associated with the codon 200 mutation (E200K) in the prion protein gene. European Journal of Neurology 5:4, 375-379
CrossRef35
Lord Walton of Detchant. (1998) Decade of the brain: neurological advances. Journal of the Neurological Sciences 158:1, 5-14
CrossRef36
Marlene Fishman, Glenn G. Fort, Dennis J. Mikolich. (1998) Prevention of Creutzfeldt-Jakob disease in health care workers: A case study. American Journal of Infection Control 26:1, 74-79
CrossRef37
Thomas Wisniewski Md, Pierre Aucouturier Phd, Claudio Soto Phd, Blas Frangione. (1998) The prionoses and other conformational disorders. Amyloid 5:3, 212-224
CrossRef38
Stanley B. Prusiner, Michael R. Scott. (1997) GENETICS OF PRIONS. Annual Review of Genetics 31:1, 139-175
CrossRef39
Ricardo Nitrini, Sergio Rosemberg, Maria Rita Passos-Bueno, Lu
s S. Teixeira da Silva, Paula Iughetti, Maria Papadopoulos, Paulo M. Carrilho, Paulo Caramelli, Steffen Albrecht, Mayana Zatz, Andrea LeBlanc. (1997) Familial spongiform encephalopathy associated with a novel prion protein gene mutation. Annals of Neurology 42:2, 138-146
CrossRef40
Zeev Meiner, Ruth Gabizon, Stanley B. Prusiner. (1997) Familial Creutzfeldt-Jakob Disease. Medicine 76:4, 227-237
CrossRef41
G Friedman. (1997) Apolipoprotein Eε4 allele, a risk factor for late onset nonfamilial Alzheimer's disease among Israeli Jews. Archives of Gerontology and Geriatrics 24:2, 175-181
CrossRef42
A. Alpérovitch. (1996) Epidemiology of Creutzfeldt-Jakob disease-past and present uncertainties. European Journal of Neurology 3:6, 500-506
CrossRef43
Mei-Hui Teng, Joel N Buxbaum. (1996) Transgenic mice in amyloid research: an interpretive review. Amyloid 3:3, 187-208
CrossRef44
Ruth Gabizon, Glenn Telling, Zeev Meiner, Michele Halimi, Irit Kahana, Stanley B. Prusiner. (1996) Insoluble wild–type and protease–resistant mutant prion protein in brains of patients with inherited prion disease. Nature Medicine 2:1, 59-64
CrossRef45
Pawel P. Liberski. (1995) Prions, ?-sheets and transmissible dementias: is there still something missing?. Acta Neuropathologica 90:2, 113-125
CrossRef46
Jean-François Emard, Jean-Pierre Thouez, Denis Gauvreau. (1995) Neurodegenerative diseases and risk factors: A literature review. Social Science & Medicine 40:6, 847-858
CrossRef47
R. T. Perry, R. C. P. Go, L. E. Harrell, R. T. Acton. (1995) SSCP analysis and sequencing of the human prion protein gene (PRNP) detects two different 24 bp deletions in an atypical Alzheimer's disease family. American Journal of Medical Genetics 60:1, 12-18
CrossRef48
Stanley B. Prusiner, Stephen J. Dearmond. (1995) Prion protein amyloid and neurodegeneration. Amyloid 2:1, 39-65
CrossRef49
Stephen J. DeArmond, Stanley B. Prusiner. (1995) Prion Protein Transgenes and the Neuropathology in Prion Diseases. Brain Pathology 5:1, 77-89
CrossRef50
Victoria Mcgreevy Steelman. (1994) Creutzfeld-Jakob disease: Recommendations for infection control. American Journal of Infection Control 22:5, 312-318
CrossRef51
HEINO DIRINGER, MICHAEL BEEKES, ULRICH OBERDIECK. (1994) The Nature of the Scrapie Agent: The Virus Theory. Annals of the New York Academy of Sciences 724:1 Slow Infectio, 246-258
CrossRef52
KAREN K. HSIAO. (1994) The Genetics and Transgenetics of Human Prion Disease. Annals of the New York Academy of Sciences 724:1 Slow Infectio, 241-245
CrossRef53
D. CARLETON GAJDUSEK. (1994) Nucleation of Amyloidogenesis in Infectious and Noninfectious Amyloidoses of Brain. Annals of the New York Academy of Sciences 724:1 Slow Infectio, 173-190
CrossRef54
Stanley B. Prusiner, Karen K. Hsiao. (1994) Human prion diseases. Annals of Neurology 35:4, 385-395
CrossRef55
Lev G. Goldfarb, Paul Brown, Larisa Cervenakova, D. Carleton Gajdusek. (1994) Molecular genetic studies of Creutzfeldt-Jakob disease. Molecular Neurobiology 8:2-3, 89-97
CrossRef56
A.D. Korczyn. (1994) Neurologic genetic diseases of Jewish people. Biomedicine & Pharmacotherapy 48:8-9, 391-397
CrossRef57
R. Gabizon, M. Halimi, Z. Meiner. (1994) Genetics and biochemistry of Creutzfeldt-Jakob disease in Libyan Jews. Biomedicine & Pharmacotherapy 48:8-9, 385-390
CrossRef58
Maurizio Pocchiari. (1994) Prions and related neurological diseases. Molecular Aspects of Medicine 15:3, 195-291
CrossRef59
Edwin M. Stone, William D. Mathers, George O.D. Rosenwasser, Edward J. Holland, Robert Folberg, Jay H. Krachmer, Brian E. Nichols, Peter D. Gorevic, Chris M. Taylor, Luan M. Streb, Jill A. Fishbaugh, Thomas E. Daley, Brian M. Sucheski, Val C. Sheffield. (1994) Three autosomal dominant corneal dystrophies map to chromosome 5q. Nature Genetics 6:1, 47-51
CrossRef60
Stephen J. DeArmond, Stanley B. Prusiner. (1993) The Neurochemistry of Prion Diseases. Journal of Neurochemistry 61:5, 1589-1601
CrossRef61
Ruth Gabizon, Zeev Meiner, Michele Halimi, Shmuel A. Ben-Sasson. (1993) Heparin-like molecules bind differentially to prion-proteins and change their intracellular metabolic fate. Journal of Cellular Physiology 157:2, 319-325
CrossRef62
Robert B. Darnell. (1993) The polymerase chain reaction: Application to nervous system disease. Annals of Neurology 34:4, 513-523
CrossRef63
P LIBERSKI. (1993) Subacute spongiform encephalopathies—The transmissible brain amyloidoses: A comparison with the non-transmissible brain amyloidoses of Alzheimer type. Journal of Comparative Pathology 109:2, 103-127
CrossRef64
F. Taguchi, Y. Tamai, S. Miura. (1993) Experiments on maternal and paternal transmission of Creutzfeldt-Jakob disease in mice. Archives of Virology 130:1-2, 219-224
CrossRef65
R.M. Ridley, H.F. Baker. (1993) Occupational risk of Creutzfeldt-Jakob disease. The Lancet 341:8845, 641-642
CrossRef66
M. -C. Chartier Harlin, F. Crawford, D. P. Perl, J. Steele, J. Hardy. (1993) Sequencing of exons 16 and 17 of the β-amyloid precursor protein gene reveals the β-amyloid sequence to be normal in cases of the parkinson dementia complex of guam. Journal of Neural Transmission - Parkinson's Disease and Dementia Section 5:1, 63-65
CrossRef67
A. Pablos-Méndez, R. Defendini, E.M. Netto. (1993) Infectious prions or cytotoxic metabolites?. The Lancet 341:8838, 159-161
CrossRef68
Mark S. Palmer, John Collinge. (1993) Mutations and polymorphisms in the prion protein gene. Human Mutation 2:3, 168-173
CrossRef69
Joanne Clinton, Gareth Wyn Roberts. (1992) Prion disease: The essential facts. International Journal of Geriatric Psychiatry 7:12, 853-863
CrossRef70
Paul Brown, Sergio Gálvez, Lev G. Goldfarb, Ana Nieto, Luis Cartier, C.J. Gibbs, D.Carleton Gajdusek. (1992) Familial Creutzfeldt-Jakob disease in Chile is associated with the codon 200 mutation of the PRNP amyloid precursor gene on chromosome 20. Journal of the Neurological Sciences 112:1-2, 65-67
CrossRef71
Stanley B. Prusiner. (1992) Natural and experimental prion diseases of humans and animals. Current Opinion in Neurobiology 2:5, 638-647
CrossRef72
Karen Hsiao, Stephen R. Dlouhy, Martin R. Farlow, Carin Cass, Maria Da Costa, P. Michael Conneally, M. E. Hodes, Bernardino Ghetti, Stanley B. Prusiner. (1992) Mutant prion proteins in Gerstmann-Sträussler-Scheinker disease with neurofibrillary tangles. Nature Genetics 1:1, 68-71
CrossRef73
Lev G. Goldfarb, Paul Brown, Matti Haltia, Fran
CrossRef74
Paul Brown, Lev G. Goldfarb, Jussi Kovanen, Mattie Haltia, Fran
CrossRef75
John Collinge, Mark S. Palmer. (1992) Prion diseases. Current Opinion in Genetics & Development 2:3, 448-454
CrossRef76
Paul Brown, Lev G. Goldfarb, Françoise Cathala, Aléna Vrbovská, Michael Sulima, Ana Nieto, C.J. Gibbs, D.Carleton Gajdusek. (1991) The molecular genetics of familial Creutzfeldt-Jakob disease in France. Journal of the Neurological Sciences 105:2, 240-246
CrossRef77
Stanley B. Prusiner, Stephen J. DeArmond. (1991) Molecular Biology and Pathology of Scrapie and the Prion Diseases of Humans. Brain Pathology 1:4, 297-310
CrossRef78
Stanley B. Prusiner, Howard L. Lipton. (1991) Molecular Biology and Transgenetics of Prion Diseases. Critical Reviews in Biochemistry and Molecular Biology 26:5-6, 397-438
CrossRef
