Original Article
Molecular Basis of Different Forms of Metachromatic Leukodystrophy
N Engl J Med 1991; 324:18-22January 3, 1991
- Abstract
- Abstract
Background.
Metachromatic leukodystrophy is an autosomal recessive inherited lysosomal storage disorder caused by a deficiency of arylsulfatase A. Three forms of the disease can be distinguished according to severity and the age at onset: late infantile (1 to 2 years), juvenile (3 to 16), and adult (>16).
Methods and Results.
To understand the molecular basis of the different forms of the disease, we analyzed arylsulfatase A alleles associated with metachromatic leukodystrophy. Two alleles (termed I and A) were Identified and accounted for about half of all arylsulfatase A alleles among 68 patients with metachromatic leukodystrophy whom we examined. Sufficient information was available for 66 of the patients to allow classification of their disease. Of the six instances of homozygosity for allele I, all were associated with the late-infantile form of the disease; of the eight instances of homozygosity for allele A, five were associated with the adult form and three with the juvenile form. When both alleles were present, the juvenile form resulted (seven of seven instances). Heterozygosity for allele I (with the other allele unknown) is usually associated with late-infantile disease, and heterozygosity for allele A with a later onset of the disease. The clinical variability can be explained by the different levels of residual arylsulfatase A activity associated with these genotypes.
Conclusions.
Like many lysosomal storage disorders, metachromatic leukodystrophy shows clinical heterogeneity that seems to reflect genetic heterogeneity. One of the known alleles (allele I) is associated with earlier and more severe disease than the other (allele A). (N Engl J Med 1991;324:18–22.)
Article Activity
- Article
ARYLSULFATASE A is a lysosomal enzyme inL volved in the degradation of cerebroside sulfate, a polar glycolipid that is found mainly as a component of the myelin sheaths of the nervous system. Deficiency of arylsulfatase A results in metachromatic leukodystrophy, a lysosomal storage disease characterized by the accumulation of cerebroside sulfate.1 The storage of sulfatide mainly affects the nervous system, where it is associated with progressive demyelination and loss of white matter. Clinically, there may be neurologic symptoms, such as weakness, ataxia, progressive spastic tetraparesis, optic atrophy, and dementia. In older patients psychiatric symptoms may precede the neurologic manifestations. The age of onset ranges from less than two years to the third or fourth decade of life. Three forms of metachromatic leukodystrophy can be distinguished according to the age at onset: late infantile (1 to 2 years), juvenile (3 to 16), and adult (>16). The late-infantile form is fatal within a few years, whereas the course of the juvenile and adult forms is more protracted. The incidence of metachromatic leukodystrophy among whites is estimated to be 1 in 40,000, suggesting a frequency of 0.5 percent for metachromatic leukodystrophy alleles.2 Approximately 0.5 percent3 to 2 percent4 , 5 of the population has very low levels of residual arylsulfatase A activity but is asymptomatic. This condition has been called arylsulfatase A pseudodeficiency and is in most cases caused by homozygosity for the arylsulfatase A pseudodeficiency allele. Estimates of the frequency of this allele range from 7.3 percent3 to 15 percent.4 , 5 We recently analyzed the mutations in this allele6 and found that the low residual activity is due to reduced synthesis of arylsulfatase A, which can be explained by the loss of a polyadenylation signal. However, at least in those who are homozygous for the arylsulfatase A pseudodeficiency allele, enough arylsulfatase A is synthesized to prevent clinically apparent disease.
In this report we describe four genotypes that are combinations of two arylsulfatase A alleles that cause metachromatic leukodystrophy and the pseudodeficiency allele. These genotypes are associated with different levels of residual arylsulfatase A activity —from 0 to approximately 10 percent — and represent the clinical spectrum from the most severely affected children to apparently healthy adults.
Methods
Amplification of Fragments from Genomic DNA
Procedures used lor the amplification of DNA fragments have been described elsewhere.6 For the amplification of fragment D, the elongation time was increased to five minutes. The sequences of oligonucleotides used to amplify the fragments shown in Figure 1Figure 1
Mutations in the Arylsulfatase A Gene. were as follows: for fragment A, oligonucleotide 1 sequence 5′TCGAATTCTGCTGGAGCCAAGTAGCCCT3′ and oligonucleotide 3 sequence 5′GAAAGACTGGAGTTAGCACT3′; for fragment C, oligonucleotide 4 sequence 5′CGGAATTCTTGATGGGGAACTGAGTGAC3′ and oligonucleotide 5 sequence 5′GCGAAGCTTCCTCATTGGTACCACAGG3′; and for fragment D, the sequence of oligonucleotide 1 was the same as that in fragment A and oligonucleotide 2 sequence 5′GAGGATCCCAGTGCAGGAGGCACTGAGG3′. The fragments were subcloned into M13mp18 and M13mp19 and sequenced according to standard techniques.7 Hybridization of Allele-Specific Oligonucleotides
The genotype of the patients was determined by hybridization of allele-specific oligonucleotides. Fragments A and C (Fig. 1) were amplified, blotted onto nylon filters, and hybridized to oligonucleotides end-labeled with [32P]ATP and T4 kinase. The methods used have been described elsewhere.6 The sequence of oligonucleotides used to detect the splice-site mutation of allele I was 5′TGGTTCCTACCTGGTCGT3′ (57°C) for the normal allele and 5′TGGTTCCTATCTGGTCGT3′ (57°C) for the mutant allele. The sequence of oligonucleotides used to detect the exchange of leucine for proline at position 426 in allele A was 5′CATAGAGCAGCGGGGGCT3′ (59°C) for the normal allele and 5′CATAGAGCAGCAGGGGCT3′ (59°C) for the mutant allele. (Values in parentheses indicate the temperatures at which the filters were washed to give an allele-specific signal.)
Transfection and Western Blot Analysis
Transfection of the arylsulfatase A complementary DNA (cDNA) into baby-hamster kidney cells was performed as described elsewhere.8 Western blot analysis and treatment of cultured human fibroblasts with carbobenzoxy Phe-Ala diazomethylketone were carried out as described elsewhere.9 , 10
Results
Identification of Mutations in the Arylsulfatase A Gene
The arylsulfatase A gene has been characterized recently.11 It can be amplified in two overlapping fragments (Fig. 1). To identify the molecular defects in metachromatic leukodystrophy, we amplified the arylsulfatase A gene of a patient with juvenile onset of the disease. The amplified fragments were subcloned into M13mp18 and M13mp19 and sequenced in both directions.
Two different metachromatic leukodystrophy alleles were identified in this patient. One allele — designated allele I — differed in three positions from the published gene sequence for arylsulfatase A: a G → T transversion changing tryptophan at position 193 to cysteine, a C → G transversion changing threonine at position 391 to serine, and a G → A transition destroying the splice donor site of exon 2 by changing the classic exon-intron boundary consensus sequence AG gt... to AG at.... The exchange of serine for threonine at position 391 is a polymorphism that was found in the DNA of four of eight healthy controls (unpublished data).
The exchange of cysteine for tryptophan at position 193 was introduced into the arylsulfatase A cDNA12 by site-directed mutagenesis, and a mutated cDNA was transiently expressed in baby-hamster kidney cells after transfection. The arylsulfatase A activity measured in the transfected cells was comparable to that in cells transfected with wild-type cDNA, indicating that the exchange of cysteine for tryptophan at position 193 is functionally silent. Of the three changes found in allele I, only the loss of the splice donor site was considered to be of relevance for metachromatic leukodystrophy.
The second metachromatic leukodystrophy allele —designated allele A — differed from the published arylsulfatase A sequence in one position: a C → T transition causing the change of proline at position 426 to leucine. The introduction of this mutation into the arylsulfatase A cDNA and its expression in baby-hamster kidney cells led to a small increase in the activity of arylsulfatase A in the transfected cells. Three independent transfection experiments showed that this increase was only 3 percent (range, 2 to 5) of that observed in cells transfected with the normal arylsulfatase A cDNA. Metachromatic leukodystrophy allele A thus codes for low residual arylsulfatase A activity.
Frequencies of Alleles I and A among Patients with Metachromatic Leukodystrophy
Fragments A and C (Fig. 1) were amplified from the DNA of 68 patients affected with different clinical forms of the disease, and the frequencies of alleles I and A were determined by allele-specific oligonucleotide hybridization. Of the 68 patients, 50 carried at least one of the two metachromatic leukodystrophy alleles (I or A). Twenty-three patients were homozygous for either allele I or allele A or heterozygous for both alleles. In 18 patients neither allele I nor allele A was found. In total, 37 I alleles and 36 A alleles were found. Thus, the two alleles accounted for about half of all arylsulfatase A alleles in this fairly typical selection of patients with metachromatic leukodystrophy.
Distribution of Alleles I and A among Patients with Different Clinical Forms of Metachromatic Leukodystrophy
Sufficient information was available for 66 of the patients with metachromatic leukodystrophy to allow classification of their disease as late infantile, juvenile, or adult. Table 1Table 1
Genotypes and Clinical Form of Metachromatic Leukodystrophy in 68 Patients. shows the correlation between the genotype and the clinical form of the disease. All six patients with metachromatic leukodystrophy who were homozygous for allele I (loss of the splice donor site of exon 2) had the late-infantile form, whereas five of the patients who were homozygous for allele A (substitution of leucine for proline at position 426) had the adult form and three had the juvenile form. Among the patients with juvenile-onset metachromatic leukodystrophy, seven had both allele I and allele A. The I allele was found in combination with an unidentified allele in 14 patients with the late-infantile form, 2 with the juvenile form, and 1 with the adult form of the disease. The A allele was found in combination with an unidentified metachromatic leukodystrophy allele in 10 patients with either the adult or the juvenile form of the disease.These results suggest that homozygosity for allele I predisposes patients to the late-infantile form of metachromatic leukodystrophy, homozygosity for allele A to the adult form, and compound heterozygosity of both alleles to the juvenile form. This is supported by the correlation of the age at onset with the genotype (Fig. 2Figure 2
Arylsulfatase A Genotype and Age at Onset of Metachromatic Leukodystrophy.). The age at onset of the disease was known for 19 patients with metachromatic leukodystrophy who had a fully identifiable genotype. In patients who were homozygous for allele I, the disease started around the age of 2 years; in patients who were homozygous for allele A, the onset was between 8 and 22 years (mean, 17.3); and in patients carrying both alleles, the onset was between 4 and 7 years (mean, 5.8).More complete clinical information was available for five of the six patients with the late-infantile form who were homozygous for allele I. In all cases the initial symptoms were gait disturbances due to muscular hypotonia. In the older patients the first symptoms were either neurologic or psychiatric. A summary of the clinical data for most of the patients with the lateonset form shown in Figure 2 has been presented elsewhere.14
Biochemical Characterization of Patients Homozygous for Allele I or Allele A
Patients homozygous for allele I who had late-infantile metachromatic leukodystrophy were characterized biochemically by the absence of arylsulfatase A polypeptides after metabolic labeling of fibroblasts with [35S]methionine (data not shown). Fibroblasts contain three forms of arylsulfatase A RNA; the smallest, a 2.1-kilobase (kb) species, is efficiently polyadenylated and appears to be the predominant form of messenger RNA used for translation, whereas the two larger forms (3.7 kb and 4.8 kb) are poorly polyadenylated.6 We have previously reported that the 2.1-kb species was not detectable and levels of the two larger forms were severely diminished in measurements of total RNA in a patient with metachromatic leukodystrophy who was homozygous for allele I.6 We conclude that the deficiency of the splice donor site of exon 2 renders the three forms of arylsulfatase A RNA unstable and that the presence of allele I does not lead to the synthesis of detectable amounts of polypeptides that cross-react with arylsulfatase A.
The biochemical phenotype of two patients with the adult form of metachromatic leukodystrophy who proved to be homozygous for allele A in this study was reported earlier.9 Incubation of fibroblasts from these patients with inhibitors of cysteine proteinases partially restored the arylsulfatase A activity. The deficiency was thought to result from an increased susceptibility of the mutant arylsulfatase A polypeptides to lysosomal cysteine proteinases.9 , 13 The accumulation of arylsulfatase A polypeptides in fibroblasts from a patient homozygous for allele A in response to incubation with a cysteine proteinase inhibitor is shown in Figure 3Figure 3
Molecular Phenotype of Mutant Arylsulfatase A Alleles.. We conclude from these results that the exchange of leucine for proline at position 426 increases the susceptibility of arylsulfatase A to lysosomal cysteine proteinases and results in a severe reduction in the half-life of the mutant polypeptides.Identification of Compound Heterozygotes for the Arylsulfatase A Pseudodeficiency Allele and Allele I We previously identified the mutations in the arylsulfatase A pseudodeficiency allele.6 The gene frequency of this allele is estimated to range from 7.3 to 15 percent, and persons who are homozygous for the pseudodeficiency allele are clinically healthy.3 , 4 We have identified two persons with compound heterozygosity for the pseudodeficiency allele and the metachromatic leukodystrophy allele I. The combination of these alleles is expected to reduce arylsulfatase A activity to about 10 percent14 of normal. Both persons are in their third decade of life and so far have no symptoms characteristic of metachromatic leukodystrophy.
Discussion
It is apparent from this study that a clear correlation exists between the arylsulfatase A genotype and the clinical phenotype. The most severe type of metachromatic leukodystrophy, the late-infantile form, is associated with homozygosity for allele I, which does not encode for functional arylsulfatase A polypeptides. One copy of allele A, which encodes for an unstable but active arylsulfatase A, is sufficient to mitigate the clinical course and produce the juvenile form, whereas two copies of this allele allow for the mildest course of the disease, the adult form of metachromatic leukodystrophy. One copy of the arylsulfatase A pseudodeficiency allele is sufficient to sustain a normal phenotype. Although one cannot be certain that symptoms will not develop in these persons very late in life, it seems that the critical threshold is approximately 10 percent residual arylsulfatase A activity. Small variations in residual arylsulfatase A activity may greatly influence the accumulation of its substrates and its clinical manifestation.
Bone marrow transplantation has been proposed as a treatment for metachromatic leukodystrophy. Improvement of the clinical symptoms was recently reported in a girl who had received a bone marrow transplant several years earlier.15 Our data support the view that the low levels of enzyme delivered to the brain by the microglial cells derived from the donor's bone marrow may be sufficient to alter the course of the disease. Patients with the juvenile or adult form of metachromatic leukodystrophy should be better candidates for bone marrow transplantation than those with the late-infantile form, because their level of residual arylsulfatase A activity is higher and therefore less enzyme needs to be replaced.
Although the average age at onset is clearly different in the three forms of metachromatic leukodystrophy, there is a remarkable variability among the patients who are homozygous for allele A. This genotype can be found both among patients with the juvenile form and among those with the adult form of the disease. Such variability can occur within a single family10 and suggests the existence of additional loci that can influence the clinical phenotype of metachromatic leukodystrophy. For example, the pattern of expression and activity of lysosomal proteinases may differ from person to person, and this in turn may influence the half-life of the mutant arylsulfatase A protein and explain the variability of the clinical manifestations in adult patients with metachromatic leukodystrophy.
Supported by a grant from the Deutsche Forschungsgemeinschaft (Gi 155/2–1 ) and the Fond der Chemischen Industrie.
Source Information
From the Department of Biochemistry II. Georg-August-Universität Göttingen, Gosslerstr. 12d, D-3400 Göttingen, Germany, where reprint requests should be addressed to Dr. Gieselmann.
- References
References
1
Kolodny EH. Metachromatic leukodystrophy and multiple sulfatase deficiency: sulfatide lipidosis. In: Scriver CR, Beaudet AL, Sly WS, Valle D, eds. Metabolic basis of inherited disease. 6th ed. Vol. 2. New York: McGraw-Hill, 1989:1721–50.
2
Gustavson
CrossRef | Web of Science | Medline3
Hohenschutz
CrossRef | Web of Science | Medline4
Herz
CrossRef | Web of Science | Medline5
Gieselmann
Web of Science6
Gieselmann
CrossRef | Web of Science | Medline7
Tabor S. Sequencing by the dideoxy method. In: Ausubel FM, Brent R, Kingston RE, et al., eds. Current protocols in molecular biology. New York: Wiley, 1987:7.4.13–7.4.28.
8
Kingston RE. Transfection of DNA into eukaryotic cells. In: Ausubel FM, Brent R, Kingston RE, et al., eds. Current protocols in molecular biology. New York: Wiley, 1987:9.1.1–9.1.3.
9
von Figura
Web of Science | Medline10
Hohenschutz
CrossRef | Web of Science | Medline11
Kreysing
CrossRef | Medline12
Stein
Web of Science | Medline13
von Figura
CrossRef | Web of Science | Medline14
Kappler 15
Krivit
Full Text | Web of Science | Medline16
Clarke
CrossRef | Web of Science | Medline
- Citing Articles (69)
Citing Articles
1
CHRISTIANE KEHRER, GUNNAR BLUMENSTOCK, VOLKMAR GIESELMANN, INGEBORG KRÄGELOH-MANN, . (2011) The natural course of gross motor deterioration in metachromatic leukodystrophy. Developmental Medicine & Child Neurology 53:9, 850-855
CrossRef2
Raymond Y. Wang, Olaf A. Bodamer, Michael S. Watson, William R. Wilcox. (2011) Lysosomal storage diseases: Diagnostic confirmation and management of presymptomatic individuals. Genetics in Medicine 13:5, 457-484
CrossRef3
A. Biffi, P. Aubourg, N. Cartier. (2011) Gene therapy for leukodystrophies. Human Molecular Genetics 20:R1, R42-R53
CrossRef4
Pallavi Shukla, Suman Vasisht, Ranjana Srivastava, Neerja Gupta, Manju Ghosh, Manoj Kumar, Raju Sharma, Arun K. Gupta, Punit Kaur, Mahesh Kamate, Sheffali Gulati, Veena Kalra, Shubha Phadke, Pratibha Singhi, Alpa J. Dherai, Madhulika Kabra. (2011) Molecular and structural analysis of metachromatic leukodystrophy patients in Indian population. Journal of the Neurological Sciences 301:1-2, 38-45
CrossRef5
M.A.F. Tan, M. Fuller, Z.A.M.H. Zabidi-Hussin, J.J. Hopwood, P.J. Meikle. (2010) Biochemical profiling to predict disease severity in metachromatic leukodystrophy. Molecular Genetics and Metabolism 99:2, 142-148
CrossRef6
Dong-Hee Kang, Dong Hwan Lee, Yong-Hee Hong, Seung-Tae Lee, Byung Ryul Jeon, You Kyoung Lee, Chang-Seok Ki, Yong-Wha Lee. (2010) Identification of a Novel Splicing Mutation in the ARSA Gene in a Patient with Late-infantile Form of Metachromatic Leukodystrophy. The Korean Journal of Laboratory Medicine 30:5, 516
CrossRef7
Evren Önder, Incilay Sinici, F. Müjgan Sönmez, Meral Topçu, H. Asuman Özkara. (2009) Identification of two novel arylsulfatase A mutations with a polymorphism as a cause of metachromatic leukodystrophy. Neurological Research 31:1, 60-66
CrossRef8
A Ługowska, P Wlodarski, R Płoski, H Mierzewska, M Dudzińska, A Matheisel, H Świętochowska, A Tylki-Szymańska. (2009) Molecular and clinical consequences of novel mutations in the arylsulfatase A gene. Clinical Genetics 75:1, 57-64
CrossRef9
Tyler Mark Pierson, Carsten G. Bonnemann, Richard S. Finkel, Nancy Bunin, Gihan I. Tennekoon. (2008) Umbilical cord blood transplantation for juvenile metachromatic leukodystrophy. Annals of Neurology 64:5, 583-587
CrossRef10
Volkmar Gieselmann. (2008) Metachromatic leukodystrophy: genetics, pathogenesis and therapeutic options. Acta Paediatrica 97:s457, 15-21
CrossRef11
Hojka G. Kumperscak, Blanka K. Plesnicar, Bojan Zalar, Peter Gradisnik, Tomaz Seruga, Eduard Paschke. (2007) Adult metachromatic leukodystrophy: a new mutation in the schizophrenia-like phenotype with early neurological signs. Psychiatric Genetics 17:2, 85-91
CrossRef12
CRISTINA MATTIOLI, MARCO GEMMA, CRISTINA BALDOLI, MARIA SESSA, ANDREA ALBERTIN, LUIGI BERETTA. (2007) Sedation for children with metachromatic leukodystrophy undergoing MRI. Pediatric Anesthesia 17:1, 64-69
CrossRef13
Doug A. Brooks, Viv J. Muller, John J. Hopwood. (2006) Stop-codon read-through for patients affected by a lysosomal storage disorder. Trends in Molecular Medicine 12:8, 367-373
CrossRef14
Agnieszka Lugowska, Olga Amaral, Johannes Berger, Linda Berna, Nils U. Bosshard, Amparo Chabas, Anthony Fensom, Volkmar Gieselmann, Natalia G. Gorovenko, Willy Lissens, Jan-Eric Mansson, Ana Marcao, Helen Michelakakis, Hanno Bernheimer, Natalia V. Ol’khovych, Stefano Regis, Richard Sinke, Anna Tylki-Szymanska, Barbara Czartoryska. (2005) Mutations c.459+1G>A and p.P426L in the ARSA gene: Prevalence in metachromatic leukodystrophy patients from European countries. Molecular Genetics and Metabolism 86:3, 353-359
CrossRef15
V Gieselmann. (2005) What can cell biology tell us about heterogeneity in lysosomal storage diseases?. Acta Paediatrica 94, 80-86
CrossRef16
Linda Bern
, Volkmar Gieselmann, Helena Poup?tov
CrossRef17
Barry Eng, Tim Heshka, Mark A. Tarnopolsky, Lisa M. Nakamura, Ma?gorzata J.M. Nowaczyk, John S. Waye. (2004) Infantile metachromatic leukodystrophy (MLD) in a compound heterozygote for the c.459 + 1G > A mutation and a complete deletion of theARSA gene. American Journal of Medical Genetics 128A:1, 95-97
CrossRef18
Frédéric Colomb, Vincent Laroche, Olivier Laroche, Eric Jacob Benizri. (2004) Dopage aux androgènes dans le milieu sportif. Evaluation du risque médical. A propos du cas d'un patient qui pratique le bodybuilding. Andrologie 14:2, 221-223
CrossRef19
Ana Marcão, Jorge E Azevedo, Volkmar Gieselmann, M.C Sá Miranda. (2003) Oligomerization capacity of two arylsulfatase A mutants: C300F and P425T. Biochemical and Biophysical Research Communications 306:1, 293-297
CrossRef20
Ana Marc
CrossRef21
N Baumann. (2002) Motor and psycho-cognitive clinical types in adult metachromatic leukodystrophy: genotype/phenotype relationships?. Journal of Physiology-Paris 96:3-4, 301-306
CrossRef22
Rudi D’Hooge, Debby Van Dam, Frieda Franck, Volkmar Gieselmann, Peter P De Deyn. (2001) Hyperactivity, neuromotor defects, and impaired learning and memory in a mouse model for metachromatic leukodystrophy. Brain Research 907:1-2, 35-43
CrossRef23
Manuel Comabella, John S. Waye, Nuria Raguer, Barry Eng, Carmen Dom
CrossRef24
Stefanie Hermann, Frank Schestag, Andreas Polten, Sabine Kafert, Johann Penzien, Joel Zlotogora, Nicole Baumann, Volkmar Gieselmann. (2000) Characterization of four arylsulfatase A missense mutations G86D, Y201C, D255H, and E312D causing metachromatic leukodystrophy. American Journal of Medical Genetics 91:1, 68-73
CrossRef25
William Krivit, Patrick Aubourg, Elsa Shapiro, Charles Peters. (1999) Bone marrow transplantation for globoid cell leukodystrophy, adrenoleukodystrophy, metachromatic leukodystrophy, and Hurler syndrome. Current Opinion in Hematology 6:6, 377
CrossRef26
Rudi D'Hooge, Ruth Coenen, Volkmar Gieselmann, Renate Lüllmann-Rauch, Peter P. De Deyn. (1999) Decline in brainstem auditory-evoked potentials coincides with loss of spiral ganglion cells in arylsulfatase A-deficient mice. Brain Research 847:2, 352-356
CrossRef27
Yong Qu, Emmanuel Shapira, Robert J. Desnick. (1999) Metachromatic Leukodystrophy: Subtype Genotype/Phenotype Correlations and Identification of Novel Missense Mutations (P148L and P191T) Causing the Juvenile-Onset Disease. Molecular Genetics and Metabolism 67:3, 206-212
CrossRef28
Thomas Kolter, Konrad Sandhoff. (1999) Sphingolipide – ihre Stoffwechselwege und die Pathobiochemie neurodegenerativer Erkrankungen. Angewandte Chemie 111:11, 1632-1670
CrossRef29
Johannes Berger, Marion Gmach, Udo Mayr, Brunhilde Molzer, Hanno Bernheime. (1999) Coincidence of two novel arylsulfatase a alleles and mutation 459+1G>A within a family with metachromatic leukodystrophy: Molecular basis of phenotypic heterogeneity. Human Mutation 13:1, 61-68
CrossRef30
Laura Gort, M. Josep Coll, Amparo Chab
CrossRef31
Marion B. Coulter-Mackie, Liane Gagnier. (1998) Two novel mutations in the arylsulfatase A gene associated with juvenile (R390Q) and adult onset (H397Y) metachromatic leukodystrophy. Human Mutation 11:S1, S254-S256
CrossRef32
Chiara Perusi, Macarena Gomez-Lira, Monica Mottes, Pier Franco Pignatti, Nicolo Rizzuto, Alessandro Salviati. (1997) A novel mutation which represents the fifth non-pathogenic polymorphism in the coding sequence of the Arylsulfatase A gene. Molecular and Cellular Probes 11:6, 449-451
CrossRef33
Marion Coulter-Mackie, Liane Gagnier. (1997) Two new polymorphisms in the arylsulfatase A gene and their haplotype associations with normal, metachromatic leukodystrophy and pseudodeficiency alleles. American Journal of Medical Genetics 73:1, 32-35
CrossRef34
Agnieszka Ługowska, Anna Tylki-Szymańska, Johannes Berger, Brunhilde Molzer. (1997) Elevated sulfatide excretion in compound heterozygotes of metachromatic leukodystrophy and ASA-pseudodeficiency allele. Clinical Biochemistry 30:4, 325-331
CrossRef35
Johannes Berger, Beate Löschl, Hanno Bernheimer, Agnieszka Lugowska, Anna Tylki-Szymanska, Volkmar Gieselmann, Brunhilde Molzer. (1997) Occurrence, distribution, and phenotype of arylsulfatase A mutations in patients with metachromatic leukodystrophy. American Journal of Medical Genetics 69:3, 335-340
CrossRef36
Marion B. Coulter-Mackie, Derek A. Applegarth, Jennifer Toone, Hilary Vallance. (1997) DNA-based diagnosis of arylsulfatase A deficiencies as a supplement to enzyme assay: A case in point. Clinical Biochemistry 30:1, 57-61
CrossRef37
Ruxandra Draghia, Franck Letourneur, Cristina Drugan, Jeanne Manicom, Christophe Blanchot, Axel Kahn, Livia Poenaru, Catherine Caillaud. (1997) Metachromatic leukodystrophy: Identification of the first deletion in exon 1 and nine novel point mutations in the arylsulfatase A gene. Human Mutation 9:3, 234-242
CrossRef38
W. Lissens, R. Vervoort, N. Regemorter, P. Bogaert, M. Freund, C. Verellen-Dumoulin, S. Seneca, I. Liebaers. (1996) A D255H substitution in the arylsulphatase A gene of two unrelated Belgian patients with late-infantile metachromatic leukodystrophy. Journal of Inherited Metabolic Disease 19:6, 782-786
CrossRef39
Michael H. Ricketts, Jay D. Amsterdam, David S. Park, Rong-Sheng Yang, Ronald D. Poretz, Xiaoping Zhang, Michelle Fanale, Andrew Baddoo, Paul Manowitz. (1996) A novel arylsulfatase A protein variant and genotype in two patients with major depression. Journal of Affective Disorders 40:3, 137-147
CrossRef40
Reiko Minamikawa-Tachino, Yuji Maeda, Issei Fujishiro, Kohji Itoh, Akira Satake, Shigeki Aoki, Hideo Yamada, Yoshiyuki Suzuki, Hitoshi Sakuraba. (1996) Three-dimensional brain visualization for metachromatic leukodystrophy. Brain and Development 18:5, 394-399
CrossRef41
T TSUDA, Y HASEGAWA, Y ETO. (1996) Two novel mutations in a Japanese patient with the late-infantile form of metachromatic leukodystrophy. Brain and Development 18:5, 400-403
CrossRef42
Michael H. Ricketts, David Goldman, Jeffrey C. Long, Paul Manowitz. (1996) Arylsulfatase A pseudodeficiency-associated mutations: Population studies and identification of a novel haplotype. American Journal of Medical Genetics 67:4, 387-392
CrossRef43
David S. Park, Ronald D. Poretz, Michael H. Ricketts, Paul Manowitz. (1996) Arylsulfatase A: Relationship of genotype to variant electrophoretic properties. Biochemical Genetics 34:3-4, 149-161
CrossRef44
Atsushi Yamagishi, Shunji Tomatsu, Seiji Fukuda, Atsushi Uchiyama, Nobuyuki Shimozawa, Yasuyuki Suzuki, Naomi Kondo, Kazuko Sukegawa, Tadao Orii. (1996) Mucopolysaccharidosis type I: Identification of common mutations that cause Hurler and Scheie syndromes in Japanese populations. Human Mutation 7:1, 23-29
CrossRef45
Barbara Hess, Sabine Kafert, Uwe Heinisch, David A. Wenger, Joel Zlotogora, Volkmar Gieselmann. (1996) Characterization of two arylsulfatase A missense mutations D335V and T274M causing late infantile metachromatic leukodystrophy. Human Mutation 7:4, 311-317
CrossRef46
Jiro Fujiyama, Hitoshi Sakuraba, Masaru Kuriyama, Takehisa Fujita, Kazuya Nagata, Hiroto Nakagawa, Mitsuhiro Osame. (1996) A new mutation (LIPA Tyr22X) of lysosomal acid lipase gene in a Japanese patient with Wolman disease. Human Mutation 8:4, 377-380
CrossRef47
Teako Yasutake, Takeshi Yamada, Hirokazu Furuya, Nobue Shinnoh, Ikuo Goto, Takuro Kobayashi. (1995) Molecular analysis of X-linked adrenoleukodystrophy patients. Journal of the Neurological Sciences 131:1, 58-64
CrossRef48
V Gieselmann. (1995) Lysosomal storage diseases. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease 1270:2-3, 103-136
CrossRef49
Maria Luiza Barth, Anthony Fensom, Ann Harris. (1995) Identification of seven novel mutations associated with metachromatic leukodystrophy. Human Mutation 6:2, 170-176
CrossRef50
Joël Zlotogora, Gideon Bach, Claudia Böusenberg, Ygal Barak, Kurt Von Figura, Volkmar Gieselmann. (1995) Molecular basis of late infantile metachromatic leukodystrophy in the Habbanite Jews. Human Mutation 5:2, 137-143
CrossRef51
J. Rapola. (1994) Lysosomal Storage Diseases in Adults. Pathology - Research and Practice 190:8, 759-766
CrossRef52
Joël Zlotogora, Yael Furman-Shaharabani, Sandra Goldenfum, Bryan Winchester, Kurt Von Figura, Volkmar Gieselmann. (1994) Arylsulfatase a psedodeficiency: A common polymorphism which is associated with a unique haplotype. American Journal of Medical Genetics 52:2, 146-150
CrossRef53
Yoav Ben-Yoseph, Deborah A. Mitchell. (1994) Rapid detection of common metachromatic leukodystrophy mutations by restriction analysis of arylsulfatase A gene amplimers. Clinica Chimica Acta 226:1, 77-82
CrossRef54
Marvin R. Natowicz, Bassem Bejjani. (1994) Genetic disorders that masquerade as multiple sclerosis. American Journal of Medical Genetics 49:2, 149-169
CrossRef55
Volkmar Gieselmann, Joel Zlotogora, Ann Harris, David A. Wenger, C. Phillip Morris. (1994) Molecular genetics of metachromatic leukodystrophy. Human Mutation 4:4, 233-242
CrossRef56
J. Zlotogora, V. Gieselman, K. von Figura, M. Zeigler, G. Bach. (1994) Late infantile metachromatic leukodystrophy in Israel. Biomedicine & Pharmacotherapy 48:8-9, 347-350
CrossRef57
Joachim Kappler, Hans Jörg Sommerlade, Kurt von Figura, Volkmar Gieselmann. (1994) Complex arylsulfatase A alleles causing metachromatic leukodystrophy. Human Mutation 4:2, 119-127
CrossRef58
N. M. Pastor-Soler, M. A. Rafi, J. D. Hoffman, D. Hu, D. A. Wenger. (1994) Metachromatic leukodystrophy in the Navajo Indian population: A splice site mutation in intron 4 of the arylsulfatase a gene. Human Mutation 4:3, 199-207
CrossRef59
Patrick Aubourg. (1993) The leukodystrophies: a window to myelin. Nature Genetics 5:2, 105-106
CrossRef60
Gordon S. Francis, Azad Bonni, Ning Shen, Peter Hechtman, Bassem Yamut, Stirling Carpenter, George Karpati, Patricia L. Chang. (1993) Metachromatic leukodystrophy: Multiple nonfunctional and pseudodeficiency alleles in a pedigree: Problems with diagnosis and counseling. Annals of Neurology 34:2, 212-218
CrossRef61
YORIYASU HASEGAWA, HIROSHI KAWAME, YOSHIKATSU ETO. (1993) Mutations in the Arylsulfatase A Gene of Japanese Patients with Metachromatic Leukodystrophy. DNA and Cell Biology 12:6, 493-498
CrossRef62
John S. Harvey, Paul V. Nelson, William F. Carey, Evelyn F. Robertson, C. Phillip Morris. (1993) An arylsulfatase A (ARSA) missense mutation (T274M) causing late-infantile metachromatic leukodystrophy. Human Mutation 2:4, 261-267
CrossRef63
Brunhilde Molzer, Regine Sundt-Heller, Marina Kainz-Korschinsky, Marta Zobel. (1992) Elevated sulfatide excretion in heterozygotes of metachromatic leukodystrophy: Dependence on reduction of arylsulfatase a activity. American Journal of Medical Genetics 44:4, 523-526
CrossRef64
J.-J. Hauw, P. Delaére, D. Seilhean, P. Cornu. (1992) Morphology of demyelination in the human central nervous system. Journal of Neuroimmunology 40:2-3, 139-152
CrossRef65
Z. G. Li, J. S. Waye, P. L. Chang. (1992) Diagnosis of arylsulfatase A deficiency. American Journal of Medical Genetics 43:6, 976-982
CrossRef66
R. J. Desnick, J. L. Schuette, M. S. Golbus, L. Jackson, H. A. Lubs, D. H. Ledbetter, M. J. Mahoney, E. Pergament, J. L. Simpson, J. M. Zachary, S. E. Fowler, G. G. Rhoads, F. De La Cruz. (1992) First-trimester biochemical and molecular diagnoses using chorionic villi: High accuracy in the U.S. collaborative study. Prenatal Diagnosis 12:5, 357-372
CrossRef67
Joachim Kappler, Kurt von Figura, Volkmar Gieselmann. (1992) Late-onset metachromatic leukodystrophy: Molecular pathology in two siblings. Annals of Neurology 31:3, 256-261
CrossRef68
L GINSBERG, N GERSHFELD. (1991) Membrane bilayer instability and the pathogenesis of disorders of myelin. Neuroscience Letters 130:1, 133-136
CrossRef69
(1991) Molecular Basis of Metachromatic Leukodystrophy. New England Journal of Medicine 324:23, 1673-1673
Full Text
- Letters
